| (3) B-CELL | (1) BRAIN | (8) BREAST | (22) CELL-LINE | (3) CERVIX | (1) FIBROBLAST | (9) HEART | (3) HELA | (1) KIDNEY | (4) LIVER | (2) OTHER | (1) OVARY | (26) SKIN | (1) TESTES | (1) XRN.ip |
| GTTTCGTAGCCATGTTTAAATTTTTGTCTTTTCGTGTTCGCTCTATACAGGTAAGCTCTGTTCAGCTTCTTTTATAGAATAAAATGTTTTAGTTGGAGCTAACTATAATTACAGTAATTAGTTATTTCGTTTTATATGTTCTTTAAAGCAGCTTTTCAAAATTCAAAACCTGTTTTGATAGAACTTTTAAAGGATAATAGCTCTGTTTACTAAAAGCCAGTTATGTGTATTATACATTTCAACTCTGTAT ....................................................................................(((..((((((....)))))).....))).......((((((...(((((...((((((((((((((.((((........)))).))))))))).)))))...))))))))))).................................................... ..................................................................................83...................................................................................................................200................................................ | Size | Perfect hit | Total Norm | Perfect Norm | SRR314796(SRX084354) "Total RNA, fractionated (15-30nt)". (cell line) | SRR037937(GSM510475) 293cand2. (cell line) | SRR207116(GSM721078) Nuclear RNA. (cell line) | SRR207110(GSM721072) Nuclear RNA. (cell line) | SRR444061(SRX128909) Sample 19cDNABarcode: AF-PP-341: ACG CTC TTC . (skin) | SRR326280(GSM769510) total cell content of unperturbed cells was s. (cell line) | SRR342894(SRX096790) small RNA seq of Right atrial tissue. (heart) | SRR029127(GSM416756) A549. (cell line) | SRR326282(GSM769512) "Dicer mRNA was knocked down using siDicer, t. (cell line) | SRR342898(SRX096794) small RNA seq of Right atrial tissue. (heart) | SRR029131(GSM416760) MCF7. (cell line) | SRR029124(GSM416753) HeLa. (hela) | SRR330865(SRX091703) tissue: skin psoriatic involveddisease state:. (skin) | SRR037941(GSM510479) 293DroshaTN. (cell line) | SRR342900(SRX096796) small RNA seq of Right atrial tissue. (heart) | SRR326279(GSM769509) cytoplasmic fraction was isolated using PARIS. (cell line) | SRR326281(GSM769511) "Dicer mRNA was knocked down using siDicer, c. (cell line) | SRR342895(SRX096791) small RNA seq of Left atrial tissue. (heart) | SRR342897(SRX096793) small RNA seq of Left atrial tissue. (heart) | SRR039623(GSM531986) HCV(+) HCC Tissue Sample. (liver) | SRR342899(SRX096795) small RNA seq of Left atrial tissue. (heart) | SRR330889(SRX091727) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR037936(GSM510474) 293cand1. (cell line) | SRR039625(GSM531988) HBV(-) HCV(-) HCC Tissue Sample. (liver) | SRR029132(GSM416761) MB-MDA231. (cell line) | SRR037934(GSM510472) 293cand4_rep3. (cell line) | SRR342901(SRX096797) small RNA seq of Left atrial tissue. (heart) | SRR330867(SRX091705) tissue: skin psoriatic involveddisease state:. (skin) | SRR330880(SRX091718) tissue: skin psoriatic involveddisease state:. (skin) | SRR189784 | SRR039621(GSM531984) HBV(+) HCC Tissue Sample 2. (liver) | SRR330888(SRX091726) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330919(SRX091757) tissue: normal skindisease state: normal. (skin) | SRR029126(GSM416755) 143B. (cell line) | SRR207115(GSM721077) XRN1&2 knockdown. (XRN1/XRN2 cell line) | GSM450608(GSM450608) miRNA sequencing raw reads from post-mortem s. (brain) | SRR330870(SRX091708) tissue: skin psoriatic involveddisease state:. (skin) | SRR330902(SRX091740) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330915(SRX091753) tissue: normal skindisease state: normal. (skin) | SRR363673(GSM830250) cell type: human foreskin fibroblasts (HFF)tr. (fibroblast) | SRR330893(SRX091731) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR342896(SRX096792) small RNA seq of Right atrial tissue. (heart) | SRR330921(SRX091759) tissue: normal skindisease state: normal. (skin) | SRR330873(SRX091711) tissue: skin psoriatic involveddisease state:. (skin) | SRR330879(SRX091717) tissue: skin psoriatic involveddisease state:. (skin) | SRR444045(SRX128893) Sample 6cDNABarcode: AF-PP-341: ACG CTC TTC C. (skin) | SRR553575(SRX182781) source: Kidney. (Kidney) | SRR189787 | GSM532883(GSM532883) G871N. (cervix) | SRR191607(GSM715717) 192genomic small RNA (size selected RNA from . (breast) | SRR029129(GSM416758) SW480. (cell line) | SRR330922(SRX091760) tissue: normal skindisease state: normal. (skin) | SRR191465(GSM715575) 113genomic small RNA (size selected RNA from . (breast) | SRR037943(GSM510481) 293DcrTN. (cell line) | SRR033724(GSM497069) L428 cell line (L428). (B cell) | SRR444049(SRX128897) Sample 9cDNABarcode: AF-PP-334: ACG CTC TTC C. (skin) | GSM416733(GSM416733) HEK293. (cell line) | SRR191408(GSM715518) 88genomic small RNA (size selected RNA from t. (breast) | SRR037931(GSM510469) 293GFP. (cell line) | SRR033727(GSM497072) HIV-positive DL (HIV412). (B cell) | SRR330884(SRX091722) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR040025(GSM532910) G613T. (cervix) | SRR015447(SRR015447) nuclear small RNAs. (breast) | SRR330899(SRX091737) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330861(SRX091699) tissue: skin psoriatic involveddisease state:. (skin) | DRR001486(DRX001040) "Hela long cytoplasmic cell fraction, LNA(+)". (hela) | DRR001489(DRX001043) "Hela short nuclear cell fraction, control". (hela) | SRR330868(SRX091706) tissue: skin psoriatic involveddisease state:. (skin) | GSM379265(GSM379265) Small RNA from endometrioid ovarian cancer tissue. (ovary) | SRR553576(SRX182782) source: Testis. (testes) | SRR330858(SRX091696) tissue: skin psoriatic involveddisease state:. (skin) | TAX577738(Rovira) total RNA. (breast) | SRR037944(GSM510482) 293DcrTN_cand5. (cell line) | SRR330876(SRX091714) tissue: skin psoriatic involveddisease state:. (skin) | SRR191615(GSM715725) 94genomic small RNA (size selected RNA from t. (breast) | SRR039637(GSM518474) THP1_total_sRNAs. (cell line) | SRR033729(GSM497074) splenic MZL (Splenic414). (B cell) | SRR553574(SRX182780) source: Heart. (Heart) | SRR039624(GSM531987) HBV(-) HCV(-) Adjacent Tissue Sample. (liver) | SRR330859(SRX091697) tissue: skin psoriatic involveddisease state:. (skin) | TAX577743(Rovira) total RNA. (breast) | SRR191479(GSM715589) 31genomic small RNA (size selected RNA from t. (breast) | SRR040016(GSM532901) G645N. (cervix) | SRR330898(SRX091736) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330897(SRX091735) tissue: skin psoriatic uninvolveddisease stat. (skin) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ......................................................................................................................................................................................ACTTTTAAAGGATAACAGA................................................. | 19 | 132.00 | 0.00 | - | 1.00 | 26.00 | 15.00 | 1.00 | 10.00 | 8.00 | - | 7.00 | 7.00 | 1.00 | - | 4.00 | - | 2.00 | 4.00 | 4.00 | - | - | 1.00 | 2.00 | 2.00 | - | - | - | 1.00 | - | 2.00 | 2.00 | - | - | 2.00 | 2.00 | - | 2.00 | 1.00 | 2.00 | 1.00 | 2.00 | 2.00 | 1.00 | - | 1.00 | 1.00 | 1.00 | - | 1.00 | - | - | - | - | 1.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | 1.00 | 1.00 | 1.00 | 1.00 | 1.00 | - | 1.00 | 1.00 | - | - | 1.00 | 1.00 | - | - | 1.00 | - | 1.00 | - | - | - | - | - | |
| ......................................................................................................................................................................................ACTTTTAAAGGATAACATC................................................. | 19 | 50.00 | 0.00 | 39.00 | 6.00 | - | - | - | - | - | 1.00 | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ......................................................................................................................................................................................ACTTTTAAAGGATAAAAG.................................................. | 18 | 28.00 | 0.00 | - | 8.00 | - | - | - | 1.00 | - | 2.00 | 1.00 | - | 2.00 | 3.00 | - | 3.00 | - | - | - | - | 1.00 | - | - | - | - | 1.00 | - | - | 1.00 | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | 1.00 | - | - | - | 1.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ......................................................................................................................................................................................ACTTTTAAAGGATAACAA.................................................. | 18 | 17.00 | 0.00 | - | 9.00 | - | - | - | - | - | 2.00 | - | - | - | 1.00 | - | 1.00 | 1.00 | 1.00 | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ......................................................................................................................................................................................ACTTTTAAAGGATAACAGT................................................. | 19 | 14.00 | 0.00 | - | - | - | - | 8.00 | - | - | 1.00 | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | |
| ......................................................................................................................................................................................ACTTTTAAAGGATAAAAGC................................................. | 19 | 7.00 | 0.00 | - | 1.00 | - | - | - | - | - | 1.00 | - | - | 1.00 | 1.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | |
| ......................................................................................................................................................................................ACTTTTAAAGGATAACAAC................................................. | 19 | 6.00 | 0.00 | - | 2.00 | - | - | - | - | - | - | - | - | 1.00 | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ......................................................................................................................................................................................ACTTTTAAAGGATAATAGCTAT.............................................. | 22 | 1 | 6.00 | 5.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | 1.00 | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ......................................................................................................................................................................................ACTTTTAAAGGATAATAGCT................................................ | 20 | 1 | 5.00 | 5.00 | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ......................................................................................................................................................................................ACTTTTAAAGGATAACACC................................................. | 19 | 4.00 | 0.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | 1.00 | - | - | 1.00 | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ......................................................................................................................................................................................ACTTTTAAAGGATAATAG.................................................. | 18 | 2 | 4.00 | 4.00 | - | - | - | - | 1.50 | - | - | - | - | - | 0.50 | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.50 | 0.50 |
| ......................................................................................................................................................................................ACTTTTAAAGGATAACCG.................................................. | 18 | 4.00 | 0.00 | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ......................................................................................................................................................................................ACTTTTAAAGGATAACAC.................................................. | 18 | 4.00 | 0.00 | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | 1.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ......................................................................................................................................................................................ACTTTTAAAGGATAACAGG................................................. | 19 | 4.00 | 0.00 | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | 1.00 | 1.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ......................................................................................................................................................................................ACTTTTAAAGGATAACCA.................................................. | 18 | 3.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | 1.00 | - | - | - | - | |
| ......................................................................................................................................................................................ACTTTTAAAGGATAACGG.................................................. | 18 | 3.00 | 0.00 | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ......................................................................................................................................................................................ACTTTTAAAGGATAATAGC................................................. | 19 | 1 | 2.00 | 2.00 | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ......................................................................................................................................................................................ACTTTTAAAGGATAACGGC................................................. | 19 | 2.00 | 0.00 | - | - | 1.00 | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...........ATGTTTAAATTTTTGTCTTTTCGTG...................................................................................................................................................................................................................... | 25 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ......................................................................................................................................................................................ACTTTTAAAGGATAACTG.................................................. | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .......................................................................................TTTAGTTGGAGCTAATC.................................................................................................................................................. | 17 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ......................................................................................................................................................................................ACTTTTAAAGGATAATTGG................................................. | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ....................................................................................................................................................................................GAACTTTTAAAGGATAACA................................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ......................................................................................................................................................................................ACTTTTAAAGGATAAAAAC................................................. | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ......................................................................................................................................................................................ACTTTTAAAGGATAATAGCTTT.............................................. | 22 | 1 | 1.00 | 5.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ......................................................................................................................................................................................ACTTTTAAAGGATAACAAA................................................. | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ......................................................................................................................................................................................ACTTTTAAAGGATAACGC.................................................. | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ......................................................................................................................................................................................ACTTTTAAAGGATAACCGC................................................. | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | |
| ......................................................................................................................................................................................ACTTTTAAAGGATAAGAGC................................................. | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | |
| ......................................................................................................................................................................................ACTTTTAAAGGATAACATG................................................. | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ......................................................................................................................................................................................ACTTTTAAAGGATAAAAGA................................................. | 19 | 1.00 | 0.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ......................................................................................................................................................................................ACTTTTAAAGGATAATAGCTTTAC............................................ | 24 | 1 | 1.00 | 5.00 | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..........................................................................................................................................................................TGTTTTGATAGAACTCTG.............................................................. | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ........................................................................................................................................................................................TTTTAAAGGATAATAGCT................................................ | 18 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ......................................................................................................................................................................................ACTTTTAAAGGATAATAGCTA............................................... | 21 | 1 | 1.00 | 5.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ......................................................................................................................................................................................ACTTTTAAAGGATAACATA................................................. | 19 | 1.00 | 0.00 | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ......................................................................................................................................................................................ACTTTTAAAGGATAACAAT................................................. | 19 | 1.00 | 0.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ......................................................................................................................................................................................ACTTTTAAAGGATAATAGAT................................................ | 20 | 2 | 0.50 | 4.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.50 | - | - |
| ......................................................................................................................................................................................ACTTTTAAAGGATAATA................................................... | 17 | 4 | 0.25 | 0.25 | - | - | - | - | - | - | 0.25 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .............GTTTAAATTTTTGTCTT............................................................................................................................................................................................................................ | 17 | 9 | 0.11 | 0.11 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.11 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| GTTTCGTAGCCATGTTTAAATTTTTGTCTTTTCGTGTTCGCTCTATACAGGTAAGCTCTGTTCAGCTTCTTTTATAGAATAAAATGTTTTAGTTGGAGCTAACTATAATTACAGTAATTAGTTATTTCGTTTTATATGTTCTTTAAAGCAGCTTTTCAAAATTCAAAACCTGTTTTGATAGAACTTTTAAAGGATAATAGCTCTGTTTACTAAAAGCCAGTTATGTGTATTATACATTTCAACTCTGTAT ....................................................................................(((..((((((....)))))).....))).......((((((...(((((...((((((((((((((.((((........)))).))))))))).)))))...))))))))))).................................................... ..................................................................................83...................................................................................................................200................................................ | Size | Perfect hit | Total Norm | Perfect Norm | SRR314796(SRX084354) "Total RNA, fractionated (15-30nt)". (cell line) | SRR037937(GSM510475) 293cand2. (cell line) | SRR207116(GSM721078) Nuclear RNA. (cell line) | SRR207110(GSM721072) Nuclear RNA. (cell line) | SRR444061(SRX128909) Sample 19cDNABarcode: AF-PP-341: ACG CTC TTC . (skin) | SRR326280(GSM769510) total cell content of unperturbed cells was s. (cell line) | SRR342894(SRX096790) small RNA seq of Right atrial tissue. (heart) | SRR029127(GSM416756) A549. (cell line) | SRR326282(GSM769512) "Dicer mRNA was knocked down using siDicer, t. (cell line) | SRR342898(SRX096794) small RNA seq of Right atrial tissue. (heart) | SRR029131(GSM416760) MCF7. (cell line) | SRR029124(GSM416753) HeLa. (hela) | SRR330865(SRX091703) tissue: skin psoriatic involveddisease state:. (skin) | SRR037941(GSM510479) 293DroshaTN. (cell line) | SRR342900(SRX096796) small RNA seq of Right atrial tissue. (heart) | SRR326279(GSM769509) cytoplasmic fraction was isolated using PARIS. (cell line) | SRR326281(GSM769511) "Dicer mRNA was knocked down using siDicer, c. (cell line) | SRR342895(SRX096791) small RNA seq of Left atrial tissue. (heart) | SRR342897(SRX096793) small RNA seq of Left atrial tissue. (heart) | SRR039623(GSM531986) HCV(+) HCC Tissue Sample. (liver) | SRR342899(SRX096795) small RNA seq of Left atrial tissue. (heart) | SRR330889(SRX091727) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR037936(GSM510474) 293cand1. (cell line) | SRR039625(GSM531988) HBV(-) HCV(-) HCC Tissue Sample. (liver) | SRR029132(GSM416761) MB-MDA231. (cell line) | SRR037934(GSM510472) 293cand4_rep3. (cell line) | SRR342901(SRX096797) small RNA seq of Left atrial tissue. (heart) | SRR330867(SRX091705) tissue: skin psoriatic involveddisease state:. (skin) | SRR330880(SRX091718) tissue: skin psoriatic involveddisease state:. (skin) | SRR189784 | SRR039621(GSM531984) HBV(+) HCC Tissue Sample 2. (liver) | SRR330888(SRX091726) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330919(SRX091757) tissue: normal skindisease state: normal. (skin) | SRR029126(GSM416755) 143B. (cell line) | SRR207115(GSM721077) XRN1&2 knockdown. (XRN1/XRN2 cell line) | GSM450608(GSM450608) miRNA sequencing raw reads from post-mortem s. (brain) | SRR330870(SRX091708) tissue: skin psoriatic involveddisease state:. (skin) | SRR330902(SRX091740) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330915(SRX091753) tissue: normal skindisease state: normal. (skin) | SRR363673(GSM830250) cell type: human foreskin fibroblasts (HFF)tr. (fibroblast) | SRR330893(SRX091731) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR342896(SRX096792) small RNA seq of Right atrial tissue. (heart) | SRR330921(SRX091759) tissue: normal skindisease state: normal. (skin) | SRR330873(SRX091711) tissue: skin psoriatic involveddisease state:. (skin) | SRR330879(SRX091717) tissue: skin psoriatic involveddisease state:. (skin) | SRR444045(SRX128893) Sample 6cDNABarcode: AF-PP-341: ACG CTC TTC C. (skin) | SRR553575(SRX182781) source: Kidney. (Kidney) | SRR189787 | GSM532883(GSM532883) G871N. (cervix) | SRR191607(GSM715717) 192genomic small RNA (size selected RNA from . (breast) | SRR029129(GSM416758) SW480. (cell line) | SRR330922(SRX091760) tissue: normal skindisease state: normal. (skin) | SRR191465(GSM715575) 113genomic small RNA (size selected RNA from . (breast) | SRR037943(GSM510481) 293DcrTN. (cell line) | SRR033724(GSM497069) L428 cell line (L428). (B cell) | SRR444049(SRX128897) Sample 9cDNABarcode: AF-PP-334: ACG CTC TTC C. (skin) | GSM416733(GSM416733) HEK293. (cell line) | SRR191408(GSM715518) 88genomic small RNA (size selected RNA from t. (breast) | SRR037931(GSM510469) 293GFP. (cell line) | SRR033727(GSM497072) HIV-positive DL (HIV412). (B cell) | SRR330884(SRX091722) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR040025(GSM532910) G613T. (cervix) | SRR015447(SRR015447) nuclear small RNAs. (breast) | SRR330899(SRX091737) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330861(SRX091699) tissue: skin psoriatic involveddisease state:. (skin) | DRR001486(DRX001040) "Hela long cytoplasmic cell fraction, LNA(+)". (hela) | DRR001489(DRX001043) "Hela short nuclear cell fraction, control". (hela) | SRR330868(SRX091706) tissue: skin psoriatic involveddisease state:. (skin) | GSM379265(GSM379265) Small RNA from endometrioid ovarian cancer tissue. (ovary) | SRR553576(SRX182782) source: Testis. (testes) | SRR330858(SRX091696) tissue: skin psoriatic involveddisease state:. (skin) | TAX577738(Rovira) total RNA. (breast) | SRR037944(GSM510482) 293DcrTN_cand5. (cell line) | SRR330876(SRX091714) tissue: skin psoriatic involveddisease state:. (skin) | SRR191615(GSM715725) 94genomic small RNA (size selected RNA from t. (breast) | SRR039637(GSM518474) THP1_total_sRNAs. (cell line) | SRR033729(GSM497074) splenic MZL (Splenic414). (B cell) | SRR553574(SRX182780) source: Heart. (Heart) | SRR039624(GSM531987) HBV(-) HCV(-) Adjacent Tissue Sample. (liver) | SRR330859(SRX091697) tissue: skin psoriatic involveddisease state:. (skin) | TAX577743(Rovira) total RNA. (breast) | SRR191479(GSM715589) 31genomic small RNA (size selected RNA from t. (breast) | SRR040016(GSM532901) G645N. (cervix) | SRR330898(SRX091736) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330897(SRX091735) tissue: skin psoriatic uninvolveddisease stat. (skin) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ................................................................................................................................................AAAGCAGCTTTTCAAAATG....................................................................................... | 19 | 2.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..................................................................................................................................TTTATATGTTCTTTAGCAG..................................................................................................... | 19 | 1.00 | 0.00 | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..................................................................................................................................................AGCAGCTTTTCAAAATTAAC.................................................................................... | 20 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |