| (5) B-CELL | (2) BRAIN | (3) BREAST | (15) CELL-LINE | (1) CERVIX | (1) FIBROBLAST | (3) HEART | (2) HELA | (3) LIVER | (4) OTHER | (19) SKIN | (1) XRN.ip |
| AGTTGTGGATAAAGGGTTGAGATGTGGGTTCAGAATTGGTGGTGAGCCTGTGCACTGGGGGCGCTGTCTTCCTGGGGTTGGGAGAGCCGTCTGGTGGGTCATTGTCCTTCCTGCAAGCCCTTCTTTGTGTCTCCACATGGTTTGCCAGGTGGTGGGAGGAAATGCGTCTCCCTAGGTTGTGAGCGTACTTTCTCCCCCAGGTTGAAGAGGAATGAGTCGTCCTCCTCAGTCCAGAATTACTTTCATTTGG .....................................................................................................................................................(((.((((((((.((((.(((..........))))))).)))))))))))................................................... ................................................................................................................................................145....................................................200................................................ | Size | Perfect hit | Total Norm | Perfect Norm | SRR189782 | SRR330880(SRX091718) tissue: skin psoriatic involveddisease state:. (skin) | SRR029128(GSM416757) H520. (cell line) | SRR342894(SRX096790) small RNA seq of Right atrial tissue. (heart) | SRR326280(GSM769510) total cell content of unperturbed cells was s. (cell line) | SRR189784 | SRR037935(GSM510473) 293cand3. (cell line) | SRR039625(GSM531988) HBV(-) HCV(-) HCC Tissue Sample. (liver) | SRR040028(GSM532913) G026N. (cervix) | SRR330917(SRX091755) tissue: normal skindisease state: normal. (skin) | SRR330896(SRX091734) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR038859(GSM458542) MM386. (cell line) | SRR330902(SRX091740) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR342895(SRX096791) small RNA seq of Left atrial tissue. (heart) | SRR060981(GSM569185) Human centroblast [09-001]. (cell line) | SRR189781(GSM714641) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | GSM359208(GSM359208) hepg2_bindASP_hl_2. (cell line) | SRR342899(SRX096795) small RNA seq of Left atrial tissue. (heart) | SRR330867(SRX091705) tissue: skin psoriatic involveddisease state:. (skin) | DRR001488(DRX001042) "Hela short nuclear cell fraction, LNA(+)". (hela) | SRR330905(SRX091743) tissue: normal skindisease state: normal. (skin) | SRR060983(GSM569187) Human pre-germinal center B cell [09-001]. (cell line) | SRR330873(SRX091711) tissue: skin psoriatic involveddisease state:. (skin) | SRR330900(SRX091738) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR107297(GSM677704) 18-30nt fraction of small RNA. (cell line) | SRR191542(GSM715652) 64genomic small RNA (size selected RNA from t. (breast) | SRR330907(SRX091745) tissue: normal skindisease state: normal. (skin) | SRR060985(GSM569189) Human naive B cell [09-001]. (cell line) | SRR330922(SRX091760) tissue: normal skindisease state: normal. (skin) | SRR330910(SRX091748) tissue: normal skindisease state: normal. (skin) | SRR330898(SRX091736) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330864(SRX091702) tissue: skin psoriatic involveddisease state:. (skin) | DRR000558(DRX000316) "THP-1 whole cell RNA, after 3 day treatment . (cell line) | SRR191606(GSM715716) 84genomic small RNA (size selected RNA from t. (breast) | SRR189785 | SRR033721(GSM497066) Ly3 cell line (Ly3). (B cell) | SRR363675(GSM830252) cell type: human foreskin fibroblasts (HFF)tr. (fibroblast) | SRR039612(GSM531975) Human Normal Liver Tissue Sample 2. (liver) | TAX577741(Rovira) total RNA. (breast) | SRR189779(GSM714639) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR033732(GSM497077) bjab cell line (bjab103). (B cell) | SRR330901(SRX091739) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR037941(GSM510479) 293DroshaTN. (cell line) | SRR033713(GSM497058) Burkitt Lymphoma (BL115). (B cell) | SRR207115(GSM721077) XRN1&2 knockdown. (XRN1/XRN2 cell line) | SRR029130(GSM416759) DLD2. (cell line) | SRR189786 | GSM450602(GSM450602) miRNA sequencing raw reads from post-mortem s. (brain) | SRR039622(GSM531985) HCV(+) Adjacent Tissue Sample. (liver) | SRR033730(GSM497075) Lymphoblastic (ALL411). (B cell) | GSM450605(GSM450605) miRNA sequencing raw reads from post-mortem s. (brain) | SRR330866(SRX091704) tissue: skin psoriatic involveddisease state:. (skin) | SRR330878(SRX091716) tissue: skin psoriatic involveddisease state:. (skin) | SRR033729(GSM497074) splenic MZL (Splenic414). (B cell) | DRR001487(DRX001041) "Hela long nuclear cell fraction, LNA(+)". (hela) | SRR330904(SRX091742) tissue: normal skindisease state: normal. (skin) | SRR330906(SRX091744) tissue: normal skindisease state: normal. (skin) | SRR330887(SRX091725) tissue: skin psoriatic uninvolveddisease stat. (skin) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ...................................................................................................................................................................................TGAGCGTACTTTCTCCCCCAGT................................................. | 22 | 8.00 | 0.00 | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | 1.00 | - | - | - | 1.00 | - | - | - | - | 1.00 | - | - | - | 1.00 | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | |
| .....................................................................................................................................................TGGTGGGAGGAAATGCGTCTCC............................................................................... | 22 | 1 | 6.00 | 6.00 | - | 2.00 | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | 1.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .....................................................................................................................................................TGGTGGGAGGAAATGCGTCTCCC.............................................................................. | 23 | 1 | 5.00 | 5.00 | - | - | - | - | - | - | - | - | 1.00 | - | - | - | 1.00 | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - |
| .....................................................................................................................................................TGGTGGGAGGAAATGCGTCT................................................................................. | 20 | 1 | 4.00 | 4.00 | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - |
| ................................................................................................................................................................................TTGTGAGCGTACTTTCTCCCCCAGT................................................. | 25 | 3.00 | 0.00 | - | - | 3.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ....................................................................................................................................................................................GAGCGTACTTTCTCCCCCAGA................................................. | 21 | 3.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...................................................................................................................................................................................TGAGCGTACTTTCTCCCCCA................................................... | 20 | 1 | 2.00 | 2.00 | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ............................................................................................................................................................................TAGGTTGTGAGCGTACTTTCTCCCCCAGA................................................. | 29 | 2.00 | 0.00 | - | - | - | - | - | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ............................................................................................................................................................................TAGGTTGTGAGCGTACTTTCT......................................................... | 21 | 1 | 2.00 | 2.00 | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - |
| ...................................................................................................................................................................................TGAGCGTACTTTCTCCCCCAGA................................................. | 22 | 2.00 | 0.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ....................................................................................................................................................GTGGTGGGAGGAAATGCGTCTCC............................................................................... | 23 | 1 | 2.00 | 2.00 | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .....................................................................................................................................................TGGTGGGAGGAAATGCGCCTC................................................................................ | 21 | 1.00 | 0.00 | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..........................................................................................................................................................GGAGGAAATGCGTCTCCCTAGGTTGTGAGCG................................................................. | 31 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .....................................................................................................................................................TGGTGGGAGGAAATGCGTCTC................................................................................ | 21 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .................................................................................................................................................................................................CCCCCAGGTTGAAGACGA....................................... | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .......................................................................................................................................................................CTCCCTAGGTTGTGAGCGTACTTT........................................................... | 24 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...................................................................................................................................................................................TGAGCGTACTTTCTCCCCTAG.................................................. | 21 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .....................................................................................................................................................TGGTGGGAGGAAATGCGAAAA................................................................................ | 21 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ....................................................................................................................................................................................GAGCGTACTTTCTCCCCCAGAT................................................ | 22 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | |
| .................................................................................................................................................................................TGTGAGCGTACTTTCTCCA...................................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ............................................................................................................................................................................TAGGTTGTGAGCGTACTTTCTCC....................................................... | 23 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..................................................................................................................................................................................................CCCCAGGTTGAAGAGGAATG.................................... | 20 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ............................................................................................................................................................................TAGGTTGTGAGCGTACTTTCTCCCT..................................................... | 25 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | |
| ........................................................GGGGGCGCTGTCTTCAGCA............................................................................................................................................................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ....................................................................................................................................................................................GAGCGTACTTTCTCCCCCAGT................................................. | 21 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | |
| ............................................................................................................................................................................................................AAGAGGAATGAGTCGTCG............................ | 18 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ....................................................................................................................................................................................................................TGAGTCGTCCTCCTCAGTCC.................. | 20 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - |
| .....................................................................................................................................................TGGTGGGAGGAAATGCGTCTCTTT............................................................................. | 24 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .....................................................................................................................................................................................AGCGTACTTTCTCCCCCAGT................................................. | 20 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ................................................................................................................................................................................TTGTGAGCGTACTTTCTCCCCCAGC................................................. | 25 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | |
| .....................................................................................................................................................TGGTGGGAGGAAATGCGTCTGA............................................................................... | 22 | 1 | 1.00 | 4.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ............AGGGTTGAGATGTGGGTTC........................................................................................................................................................................................................................... | 19 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - |
| .................................................................................................................................................................................................................GAATGAGTCGTCCTCCTCAGTCCAGAATTAC.......... | 31 | 1 | 1.00 | 1.00 | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...................................................................................................................................................................................TGAGCGTACTTTCTCCCCCAGTTAT.............................................. | 25 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ............................................................................................................................................................................TAGGTTGTGAGCGTACTTTCTCCCCCA................................................... | 27 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .................................................................................................................................................................................................................GAATGAGTCGTCCTCCTCAGTCCAGA............... | 26 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ............................................................................................................................................................................TAGGTTGTGAGCGTACTTTC.......................................................... | 20 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ............................................................................................................................................................................................................AAGAGGAATGAGTCGTC............................. | 17 | 1 | 1.00 | 1.00 | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .....................................................................................................................................................................................................CAGGTTGAAGAGGAATG.................................... | 17 | 2 | 0.50 | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.50 | - | - |
| ...............................................................................................................................................................................................................AGGAATGAGTCGTCC............................ | 15 | 3 | 0.33 | 0.33 | - | - | - | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...................................................................................................CATTGTCCTTCCTGCA....................................................................................................................................... | 16 | 5 | 0.20 | 0.20 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.20 | - |
| AGTTGTGGATAAAGGGTTGAGATGTGGGTTCAGAATTGGTGGTGAGCCTGTGCACTGGGGGCGCTGTCTTCCTGGGGTTGGGAGAGCCGTCTGGTGGGTCATTGTCCTTCCTGCAAGCCCTTCTTTGTGTCTCCACATGGTTTGCCAGGTGGTGGGAGGAAATGCGTCTCCCTAGGTTGTGAGCGTACTTTCTCCCCCAGGTTGAAGAGGAATGAGTCGTCCTCCTCAGTCCAGAATTACTTTCATTTGG .....................................................................................................................................................(((.((((((((.((((.(((..........))))))).)))))))))))................................................... ................................................................................................................................................145....................................................200................................................ | Size | Perfect hit | Total Norm | Perfect Norm | SRR189782 | SRR330880(SRX091718) tissue: skin psoriatic involveddisease state:. (skin) | SRR029128(GSM416757) H520. (cell line) | SRR342894(SRX096790) small RNA seq of Right atrial tissue. (heart) | SRR326280(GSM769510) total cell content of unperturbed cells was s. (cell line) | SRR189784 | SRR037935(GSM510473) 293cand3. (cell line) | SRR039625(GSM531988) HBV(-) HCV(-) HCC Tissue Sample. (liver) | SRR040028(GSM532913) G026N. (cervix) | SRR330917(SRX091755) tissue: normal skindisease state: normal. (skin) | SRR330896(SRX091734) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR038859(GSM458542) MM386. (cell line) | SRR330902(SRX091740) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR342895(SRX096791) small RNA seq of Left atrial tissue. (heart) | SRR060981(GSM569185) Human centroblast [09-001]. (cell line) | SRR189781(GSM714641) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | GSM359208(GSM359208) hepg2_bindASP_hl_2. (cell line) | SRR342899(SRX096795) small RNA seq of Left atrial tissue. (heart) | SRR330867(SRX091705) tissue: skin psoriatic involveddisease state:. (skin) | DRR001488(DRX001042) "Hela short nuclear cell fraction, LNA(+)". (hela) | SRR330905(SRX091743) tissue: normal skindisease state: normal. (skin) | SRR060983(GSM569187) Human pre-germinal center B cell [09-001]. (cell line) | SRR330873(SRX091711) tissue: skin psoriatic involveddisease state:. (skin) | SRR330900(SRX091738) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR107297(GSM677704) 18-30nt fraction of small RNA. (cell line) | SRR191542(GSM715652) 64genomic small RNA (size selected RNA from t. (breast) | SRR330907(SRX091745) tissue: normal skindisease state: normal. (skin) | SRR060985(GSM569189) Human naive B cell [09-001]. (cell line) | SRR330922(SRX091760) tissue: normal skindisease state: normal. (skin) | SRR330910(SRX091748) tissue: normal skindisease state: normal. (skin) | SRR330898(SRX091736) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330864(SRX091702) tissue: skin psoriatic involveddisease state:. (skin) | DRR000558(DRX000316) "THP-1 whole cell RNA, after 3 day treatment . (cell line) | SRR191606(GSM715716) 84genomic small RNA (size selected RNA from t. (breast) | SRR189785 | SRR033721(GSM497066) Ly3 cell line (Ly3). (B cell) | SRR363675(GSM830252) cell type: human foreskin fibroblasts (HFF)tr. (fibroblast) | SRR039612(GSM531975) Human Normal Liver Tissue Sample 2. (liver) | TAX577741(Rovira) total RNA. (breast) | SRR189779(GSM714639) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR033732(GSM497077) bjab cell line (bjab103). (B cell) | SRR330901(SRX091739) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR037941(GSM510479) 293DroshaTN. (cell line) | SRR033713(GSM497058) Burkitt Lymphoma (BL115). (B cell) | SRR207115(GSM721077) XRN1&2 knockdown. (XRN1/XRN2 cell line) | SRR029130(GSM416759) DLD2. (cell line) | SRR189786 | GSM450602(GSM450602) miRNA sequencing raw reads from post-mortem s. (brain) | SRR039622(GSM531985) HCV(+) Adjacent Tissue Sample. (liver) | SRR033730(GSM497075) Lymphoblastic (ALL411). (B cell) | GSM450605(GSM450605) miRNA sequencing raw reads from post-mortem s. (brain) | SRR330866(SRX091704) tissue: skin psoriatic involveddisease state:. (skin) | SRR330878(SRX091716) tissue: skin psoriatic involveddisease state:. (skin) | SRR033729(GSM497074) splenic MZL (Splenic414). (B cell) | DRR001487(DRX001041) "Hela long nuclear cell fraction, LNA(+)". (hela) | SRR330904(SRX091742) tissue: normal skindisease state: normal. (skin) | SRR330906(SRX091744) tissue: normal skindisease state: normal. (skin) | SRR330887(SRX091725) tissue: skin psoriatic uninvolveddisease stat. (skin) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ...........................GTTCAGAATTGGTGGTCTG............................................................................................................................................................................................................ | 19 | 2.00 | 0.00 | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ............................................................................................................TCCTGCAAGCCCTTCTCCC........................................................................................................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..................................................................................................................................................................TGCGTCTCCCTAGGTCAC...................................................................... | 18 | 1.00 | 0.00 | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ............................................................CAACCCCAGGAAGACAGCGC.......................................................................................................................................................................... | 20 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ............................................................................................................................................TTTGCCAGGTGGTGGTTT............................................................................................ | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .................................................GTGCACTGGGGGCGCGAAC...................................................................................................................................................................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..........................................................................................................................................................................................................................GTCCTCCTCAGTCCAGTCTG............ | 20 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .......GATAAAGGGTTGAGATA.................................................................................................................................................................................................................................. | 17 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..........................................................................................................................................................................................................................TGGACTGAGGAGGAC................. | 15 | 7 | 0.14 | 0.14 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.14 |
| ............................................................CCAGGAAGACAGCGC............................................................................................................................................................................... | 15 | 8 | 0.12 | 0.12 | - | - | - | - | 0.12 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |