| (1) AGO2.ip | (11) B-CELL | (5) BREAST | (17) CELL-LINE | (5) HEART | (1) KIDNEY | (1) OTHER | (1) RRP40.ip | (18) SKIN |
| AGATGATGCAGAAGAGATTCATTCTAAAACAAAGTCAAGAAAACAACTGGGTAAGGATAGAAGTGGTCTTACAGAATTCTAGAAATATTTTATTCACTTGCAGAATTCAGTGACCTGCAACTCAGTTCATGTTTGAATTTATTTTGCATTTGAGAAGTTATTATTCAGAGTAGTAGTACACTTTTGAAATCATCCTCTACTACTCACTCCTCACCACACTCCATTTTGGCTTCTCCACCCAGAGAGCTCT .............................................................................................(((..(((((((((((((((.(((.....))).))))...)))))))....))))..)))..............(((((((((........((....))....)))))))))............................................. .............................................................................................94..............................................................................................................206.......................................... | Size | Perfect hit | Total Norm | Perfect Norm | SRR189778(GSM714638) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR189783 | SRR189779(GSM714639) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR189784 | SRR189777(GSM714637) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR189785 | SRR343337 | SRR189776(GSM714636) cell line: HEK293clip variant: CLIPenzymatic . (cell line) | SRR189782 | SRR189775(GSM714635) cell line: HEK293clip variant: CLIPenzymatic . (cell line) | SRR343336 | SRR343335 | SRR189780(GSM714640) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR015362(GSM380327) NaÌøve B Cell (Naive138). (B cell) | SRR343334 | SRR342894(SRX096790) small RNA seq of Right atrial tissue. (heart) | SRR189781(GSM714641) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR189786 | SRR330922(SRX091760) tissue: normal skindisease state: normal. (skin) | SRR033726(GSM497071) Mututated CLL (CLLM633). (B cell) | SRR189787 | SRR387910(GSM843862) antibody for ip: Ago2. (ago2 cell line) | SRR342900(SRX096796) small RNA seq of Right atrial tissue. (heart) | SRR342897(SRX096793) small RNA seq of Left atrial tissue. (heart) | SRR037944(GSM510482) 293DcrTN_cand5. (cell line) | SRR033729(GSM497074) splenic MZL (Splenic414). (B cell) | SRR330908(SRX091746) tissue: normal skindisease state: normal. (skin) | SRR342899(SRX096795) small RNA seq of Left atrial tissue. (heart) | SRR033712(GSM497057) Burkitt Lymphoma (BL510). (B cell) | SRR330883(SRX091721) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330913(SRX091751) tissue: normal skindisease state: normal. (skin) | SRR553575(SRX182781) source: Kidney. (Kidney) | DRR000557(DRX000315) "THP-1 whole cell RNA, after 3 day treatment . (cell line) | SRR207112(GSM721074) RRP40 knockdown. (RRP40 cell line) | SRR330863(SRX091701) tissue: skin psoriatic involveddisease state:. (skin) | SRR060985(GSM569189) Human naive B cell [09-001]. (cell line) | SRR330898(SRX091736) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330891(SRX091729) tissue: skin psoriatic uninvolveddisease stat. (skin) | DRR000558(DRX000316) "THP-1 whole cell RNA, after 3 day treatment . (cell line) | SRR037937(GSM510475) 293cand2. (cell line) | SRR033716(GSM497061) Mentle Cell Lymphoma (MCL114). (B cell) | SRR330904(SRX091742) tissue: normal skindisease state: normal. (skin) | SRR015358(GSM380323) NaÌøve B Cell (Naive39). (B cell) | SRR033721(GSM497066) Ly3 cell line (Ly3). (B cell) | SRR033727(GSM497072) HIV-positive DL (HIV412). (B cell) | TAX577741(Rovira) total RNA. (breast) | SRR330896(SRX091734) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330899(SRX091737) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330861(SRX091699) tissue: skin psoriatic involveddisease state:. (skin) | SRR330919(SRX091757) tissue: normal skindisease state: normal. (skin) | SRR330901(SRX091739) tissue: skin psoriatic uninvolveddisease stat. (skin) | TAX577742(Rovira) total RNA. (breast) | SRR033713(GSM497058) Burkitt Lymphoma (BL115). (B cell) | SRR330902(SRX091740) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR444053(SRX128901) Sample 13cDNABarcode: AF-PP-341: ACG CTC TTC . (skin) | SRR191453(GSM715563) 179genomic small RNA (size selected RNA from . (breast) | SRR033728(GSM497073) MALT (MALT413). (B cell) | SRR033730(GSM497075) Lymphoblastic (ALL411). (B cell) | SRR207116(GSM721078) Nuclear RNA. (cell line) | SRR330893(SRX091731) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR342898(SRX096794) small RNA seq of Right atrial tissue. (heart) | SRR330905(SRX091743) tissue: normal skindisease state: normal. (skin) | TAX577590(Rovira) total RNA. (breast) | SRR037935(GSM510473) 293cand3. (cell line) | SRR330885(SRX091723) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR553573(SRX182779) source: Cerebellum. (Cerebellum) | SRR037936(GSM510474) 293cand1. (cell line) | SRR015448(SRR015448) cytoplasmic small RNAs. (breast) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ..................................................................................................TGCAGAATTCAGTGAATCA..................................................................................................................................... | 19 | 379.00 | 0.00 | 133.00 | 113.00 | 18.00 | 19.00 | 23.00 | 11.00 | 11.00 | 7.00 | 1.00 | 9.00 | 6.00 | 4.00 | 5.00 | 7.00 | 3.00 | - | 2.00 | 2.00 | - | - | 1.00 | 2.00 | - | 1.00 | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .................................................................................................TTGCAGAATTCAGTGAATCA..................................................................................................................................... | 20 | 348.00 | 0.00 | 114.00 | 89.00 | 37.00 | 33.00 | 9.00 | 10.00 | 3.00 | 8.00 | 10.00 | 3.00 | 1.00 | 5.00 | 3.00 | - | 3.00 | 1.00 | 2.00 | 2.00 | - | 3.00 | 1.00 | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | 1.00 | - | 1.00 | 1.00 | 1.00 | - | - | - | - | 1.00 | - | - | 1.00 | - | - | - | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | |
| .................................................................................................TTGCAGAATTCAGTGAATC...................................................................................................................................... | 19 | 15.00 | 0.00 | - | - | - | - | - | 1.00 | 4.00 | - | - | - | 2.00 | - | - | - | - | 1.00 | - | - | 2.00 | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..................................................................................................TGCAGAATTCAGTGAATC...................................................................................................................................... | 18 | 14.00 | 0.00 | - | - | - | - | - | 1.00 | 1.00 | - | - | - | 1.00 | - | - | - | - | 2.00 | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | 1.00 | - | - | - | - | - | 1.00 | 1.00 | - | - | - | 1.00 | - | - | - | - | - | - | 1.00 | - | 1.00 | - | - | - | - | - | - | - | - | 1.00 | 1.00 | - | - | - | - | - | - | - | |
| .................................................................................................TTGCAGAATTCAGTGAACCA..................................................................................................................................... | 20 | 4.00 | 0.00 | - | - | - | 1.00 | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...............................................................................................ACTTGCAGAATTCAGTGAATCA..................................................................................................................................... | 22 | 3.00 | 0.00 | - | - | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .................................................................................................TTGCAGAATTCAGTG.......................................................................................................................................... | 15 | 0 | 2.00 | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ................................................................................................CTTGCAGAATTCAGTGAATCA..................................................................................................................................... | 21 | 2.00 | 0.00 | 1.00 | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...............................................................................................................................................................................................................................TTTTGGCTTCTCCACCCAGAG...... | 21 | 1 | 2.00 | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .................................................................................................TTGCAGAATTCAGTGAATTA..................................................................................................................................... | 20 | 1.00 | 0.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..................................................................................................TGCAGAATTCAGTGAATCT..................................................................................................................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..........................................................................................................................................................................................................CTCACTCCTCACCACTGA.............................. | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .......................................................................................................................................................................................TTGAAATCATCCTCTGCTA................................................ | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...........................................................GAAGTGGTCTTACAGAATTCTAGAAA..................................................................................................................................................................... | 26 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - |
| ............................................................................................................................................................................................ATCATCCTCTACTACCA............................................. | 17 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..................................................................................................TGCAGAATTCAGTGAATCC..................................................................................................................................... | 19 | 1.00 | 0.00 | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..................................................................................................TGCAGAATTCAGTGAATAA..................................................................................................................................... | 19 | 1.00 | 0.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..............................................................................................CACTTGCAGAATTCACTA.......................................................................................................................................... | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ................................................................................................CTTGCAGAATTCAGTGACTCAT.................................................................................................................................... | 22 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .............................................................................................TCACTTGCAGAATTCAGT........................................................................................................................................... | 18 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...............................................................TGGTCTTACAGAATTCTG......................................................................................................................................................................... | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .................................................................................................TTGCAGAATTCAGTGATTCA..................................................................................................................................... | 20 | 1.00 | 0.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..................................................................................................TGCAGAATTCAGTGACTCA..................................................................................................................................... | 19 | 1.00 | 0.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..................................................................................................TGCAGAATTCAGTGAATTT..................................................................................................................................... | 19 | 1.00 | 0.00 | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..................................................................................................TGCAGAATTCAGTGAATTA..................................................................................................................................... | 19 | 1.00 | 0.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ........................................................................................................................................................................................TGAAATCATCCTCTACTGGAA............................................. | 21 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...........................AACAAAGTCAAGAAAACAACTGGGA...................................................................................................................................................................................................... | 25 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...........................................................................................................CAGTGACCTGCAACTCAGTTCACG....................................................................................................................... | 24 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..................................................................................................TGCAGAATTCAGTGAATAC..................................................................................................................................... | 19 | 1.00 | 0.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .................................................................................................TTGCAGAATTCAGTGACTCA..................................................................................................................................... | 20 | 1.00 | 0.00 | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .................................................................................................TTGCAGAATTCAGTGAATCG..................................................................................................................................... | 20 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .................................................................................................TTGCAGAATTCAGTGAATGA..................................................................................................................................... | 20 | 1.00 | 0.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ................ATTCATTCTAAAACAAAGTCAAG................................................................................................................................................................................................................... | 23 | 7 | 0.43 | 0.43 | - | - | - | - | - | - | - | - | 0.43 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...............................................................................................ACTTGCAGAATTCAGTG.......................................................................................................................................... | 17 | 3 | 0.33 | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.33 | - | - | - | - | - |
| .................................GTCAAGAAAACAACTGGG....................................................................................................................................................................................................... | 18 | 7 | 0.29 | 0.29 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.14 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.14 |
| ................ATTCATTCTAAAACAAAG........................................................................................................................................................................................................................ | 18 | 8 | 0.25 | 0.25 | - | - | - | - | - | - | - | - | - | - | - | 0.12 | - | - | 0.12 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ............AGAGATTCATTCTAAAACAAAGTCAAGAAAA............................................................................................................................................................................................................... | 31 | 5 | 0.20 | 0.20 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.20 | - | - | - | - |
| ..........GAAGAGATTCATTCTAAAACA........................................................................................................................................................................................................................... | 21 | 7 | 0.14 | 0.14 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.14 | - |
| AGATGATGCAGAAGAGATTCATTCTAAAACAAAGTCAAGAAAACAACTGGGTAAGGATAGAAGTGGTCTTACAGAATTCTAGAAATATTTTATTCACTTGCAGAATTCAGTGACCTGCAACTCAGTTCATGTTTGAATTTATTTTGCATTTGAGAAGTTATTATTCAGAGTAGTAGTACACTTTTGAAATCATCCTCTACTACTCACTCCTCACCACACTCCATTTTGGCTTCTCCACCCAGAGAGCTCT .............................................................................................(((..(((((((((((((((.(((.....))).))))...)))))))....))))..)))..............(((((((((........((....))....)))))))))............................................. .............................................................................................94..............................................................................................................206.......................................... | Size | Perfect hit | Total Norm | Perfect Norm | SRR189778(GSM714638) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR189783 | SRR189779(GSM714639) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR189784 | SRR189777(GSM714637) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR189785 | SRR343337 | SRR189776(GSM714636) cell line: HEK293clip variant: CLIPenzymatic . (cell line) | SRR189782 | SRR189775(GSM714635) cell line: HEK293clip variant: CLIPenzymatic . (cell line) | SRR343336 | SRR343335 | SRR189780(GSM714640) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR015362(GSM380327) NaÌøve B Cell (Naive138). (B cell) | SRR343334 | SRR342894(SRX096790) small RNA seq of Right atrial tissue. (heart) | SRR189781(GSM714641) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR189786 | SRR330922(SRX091760) tissue: normal skindisease state: normal. (skin) | SRR033726(GSM497071) Mututated CLL (CLLM633). (B cell) | SRR189787 | SRR387910(GSM843862) antibody for ip: Ago2. (ago2 cell line) | SRR342900(SRX096796) small RNA seq of Right atrial tissue. (heart) | SRR342897(SRX096793) small RNA seq of Left atrial tissue. (heart) | SRR037944(GSM510482) 293DcrTN_cand5. (cell line) | SRR033729(GSM497074) splenic MZL (Splenic414). (B cell) | SRR330908(SRX091746) tissue: normal skindisease state: normal. (skin) | SRR342899(SRX096795) small RNA seq of Left atrial tissue. (heart) | SRR033712(GSM497057) Burkitt Lymphoma (BL510). (B cell) | SRR330883(SRX091721) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330913(SRX091751) tissue: normal skindisease state: normal. (skin) | SRR553575(SRX182781) source: Kidney. (Kidney) | DRR000557(DRX000315) "THP-1 whole cell RNA, after 3 day treatment . (cell line) | SRR207112(GSM721074) RRP40 knockdown. (RRP40 cell line) | SRR330863(SRX091701) tissue: skin psoriatic involveddisease state:. (skin) | SRR060985(GSM569189) Human naive B cell [09-001]. (cell line) | SRR330898(SRX091736) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330891(SRX091729) tissue: skin psoriatic uninvolveddisease stat. (skin) | DRR000558(DRX000316) "THP-1 whole cell RNA, after 3 day treatment . (cell line) | SRR037937(GSM510475) 293cand2. (cell line) | SRR033716(GSM497061) Mentle Cell Lymphoma (MCL114). (B cell) | SRR330904(SRX091742) tissue: normal skindisease state: normal. (skin) | SRR015358(GSM380323) NaÌøve B Cell (Naive39). (B cell) | SRR033721(GSM497066) Ly3 cell line (Ly3). (B cell) | SRR033727(GSM497072) HIV-positive DL (HIV412). (B cell) | TAX577741(Rovira) total RNA. (breast) | SRR330896(SRX091734) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330899(SRX091737) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330861(SRX091699) tissue: skin psoriatic involveddisease state:. (skin) | SRR330919(SRX091757) tissue: normal skindisease state: normal. (skin) | SRR330901(SRX091739) tissue: skin psoriatic uninvolveddisease stat. (skin) | TAX577742(Rovira) total RNA. (breast) | SRR033713(GSM497058) Burkitt Lymphoma (BL115). (B cell) | SRR330902(SRX091740) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR444053(SRX128901) Sample 13cDNABarcode: AF-PP-341: ACG CTC TTC . (skin) | SRR191453(GSM715563) 179genomic small RNA (size selected RNA from . (breast) | SRR033728(GSM497073) MALT (MALT413). (B cell) | SRR033730(GSM497075) Lymphoblastic (ALL411). (B cell) | SRR207116(GSM721078) Nuclear RNA. (cell line) | SRR330893(SRX091731) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR342898(SRX096794) small RNA seq of Right atrial tissue. (heart) | SRR330905(SRX091743) tissue: normal skindisease state: normal. (skin) | TAX577590(Rovira) total RNA. (breast) | SRR037935(GSM510473) 293cand3. (cell line) | SRR330885(SRX091723) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR553573(SRX182779) source: Cerebellum. (Cerebellum) | SRR037936(GSM510474) 293cand1. (cell line) | SRR015448(SRR015448) cytoplasmic small RNAs. (breast) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ...................................................................................................................................................................TTCAGAGTAGTAGTAATGC.................................................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...................................................................................................................................TTTGAATTTATTTTGCACAT................................................................................................... | 20 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...................................................................................................................................................................................................................CAAAATGGAGTGTGGTG...................... | 17 | 2 | 0.50 | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.50 | - | - | - | - | - | - |
| ....................................................................................................................................................................TGTACTACTACTCTGA...................................................................... | 16 | 5 | 0.40 | 0.40 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.20 | 0.20 | - | - |
| .............................ACCCAGTTGTTTTCTTGACTTTG...................................................................................................................................................................................................... | 23 | 7 | 0.14 | 0.14 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.14 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |