| (1) AGO2.ip | (7) B-CELL | (2) BRAIN | (4) BREAST | (17) CELL-LINE | (1) FIBROBLAST | (2) HELA | (1) KIDNEY | (3) LIVER | (2) OTHER | (1) RRP40.ip | (14) SKIN | (1) TESTES | (1) UTERUS | (1) XRN.ip |
| GGGCCTGATGCCCTATGGTCAGCCCCGGCCCCCGATCTTGGGCTATGGAGGTAAGTACAGGAGGGAGATGAAGGGGCTTGGTGAGTGTGTGGCTTTGGGAGAAGAAAACAGAGGATGGAATTGAGGACATAGTTTTGCAACTCAACACTGATCTCTGTCATAGCTGGTGCTGTCCGCCCTGCAGTCCCCACAGGAGGCCCTCCATACCCCCAT ...........................................................................................................(((((((.(((..(((((..((......))...)))))..))).)))))))....................................................... ..........................................................................................................107.....................................................163................................................ | Size | Perfect hit | Total Norm | Perfect Norm | SRR207115(GSM721077) XRN1&2 knockdown. (XRN1/XRN2 cell line) | SRR207116(GSM721078) Nuclear RNA. (cell line) | GSM450601(GSM450601) miRNA sequencing raw reads from post-mortem s. (brain) | SRR029128(GSM416757) H520. (cell line) | SRR330870(SRX091708) tissue: skin psoriatic involveddisease state:. (skin) | SRR033715(GSM497060) Mantle Cell Lymphoma (Mino122). (B cell) | SRR094129(GSM651905) small RNA(18-35nt)small RNA deep sequencing o. (uterus) | DRR000555(DRX000313) "THP-1 whole cell RNA, no treatment". (cell line) | SRR033722(GSM497067) KMS12 cell line (KMS12). (B cell) | SRR330888(SRX091726) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR207112(GSM721074) RRP40 knockdown. (RRP40 cell line) | SRR330890(SRX091728) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR037876(GSM522374) fibroblasts_cell_culture. (fibroblast) | SRR444067(SRX128915) Sample 24cDNABarcode: AF-PP-340: ACG CTC TTC . (cell line) | SRR029127(GSM416756) A549. (cell line) | SRR553576(SRX182782) source: Testis. (testes) | SRR326282(GSM769512) "Dicer mRNA was knocked down using siDicer, t. (cell line) | SRR326281(GSM769511) "Dicer mRNA was knocked down using siDicer, c. (cell line) | SRR207111(GSM721073) Whole cell RNA. (cell line) | SRR033721(GSM497066) Ly3 cell line (Ly3). (B cell) | SRR189780(GSM714640) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | RoviraIPAgo2(Rovira) total RNA. (ago2 breast) | SRR330867(SRX091705) tissue: skin psoriatic involveddisease state:. (skin) | DRR001488(DRX001042) "Hela short nuclear cell fraction, LNA(+)". (hela) | SRR330872(SRX091710) tissue: skin psoriatic involveddisease state:. (skin) | SRR039621(GSM531984) HBV(+) HCC Tissue Sample 2. (liver) | SRR330879(SRX091717) tissue: skin psoriatic involveddisease state:. (skin) | SRR553572(SRX182778) source: Frontal Cortex. (Frontal Cortex) | SRR330892(SRX091730) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR553575(SRX182781) source: Kidney. (Kidney) | SRR039190(GSM494809) PBMCs were isolated by ficoll gradient from t. (blood) | SRR191592(GSM715702) 59genomic small RNA (size selected RNA from t. (breast) | SRR330903(SRX091741) tissue: skin psoriatic uninvolveddisease stat. (skin) | GSM1105753INPUT(GSM1105753) small RNA sequencing data. (hela) | DRR000558(DRX000316) "THP-1 whole cell RNA, after 3 day treatment . (cell line) | SRR191475(GSM715585) 18genomic small RNA (size selected RNA from t. (breast) | SRR015358(GSM380323) NaÌøve B Cell (Naive39). (B cell) | SRR039192(GSM494811) K562 cell line is derived from a CML patient . (cell line) | TAX577741(Rovira) total RNA. (breast) | SRR189779(GSM714639) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR038859(GSM458542) MM386. (cell line) | SRR330868(SRX091706) tissue: skin psoriatic involveddisease state:. (skin) | SRR330877(SRX091715) tissue: skin psoriatic involveddisease state:. (skin) | SRR039622(GSM531985) HCV(+) Adjacent Tissue Sample. (liver) | SRR033730(GSM497075) Lymphoblastic (ALL411). (B cell) | SRR033714(GSM497059) Burkitt Lymphoma (BL134). (B cell) | GSM450605(GSM450605) miRNA sequencing raw reads from post-mortem s. (brain) | SRR038862(GSM458545) MM472. (cell line) | SRR326280(GSM769510) total cell content of unperturbed cells was s. (cell line) | SRR330878(SRX091716) tissue: skin psoriatic involveddisease state:. (skin) | SRR330920(SRX091758) tissue: normal skindisease state: normal. (skin) | SRR330886(SRX091724) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR039623(GSM531986) HCV(+) HCC Tissue Sample. (liver) | SRR033711(GSM497056) GCB DLBCL (GCB110). (B cell) | SRR330859(SRX091697) tissue: skin psoriatic involveddisease state:. (skin) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ...............................................................................................................................................AACACTGATCTCTGTCATAGA................................................. | 21 | 1 | 16.00 | 9.00 | 2.00 | 5.00 | - | - | 1.00 | - | - | - | - | 1.00 | - | 2.00 | - | - | - | - | 1.00 | - | - | - | - | - | 1.00 | - | - | - | - | - | - | 1.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - |
| ...............................................................................................................................................AACACTGATCTCTGTCATAG.................................................. | 20 | 1 | 9.00 | 9.00 | - | - | - | - | - | - | - | 1.00 | - | 1.00 | - | - | - | - | - | - | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | 1.00 | - | - | - | 1.00 | - | - | 1.00 | 1.00 | - | - | - | - | - |
| ..............................................................................................................................................CAACACTGATCTCTGTCATAGAA................................................ | 23 | 1 | 5.00 | 4.00 | - | 2.00 | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 |
| ..............................................................................................................................................CAACACTGATCTCTGTCATAG.................................................. | 21 | 1 | 4.00 | 4.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - |
| ..............................................................................................................................................CAACACTGATCTCTGTCATAGA................................................. | 22 | 1 | 4.00 | 4.00 | - | 1.00 | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - |
| .................................GATCTTGGGCTATGGAG................................................................................................................................................................... | 17 | 1 | 3.00 | 3.00 | 3.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...............................................................................................................................................AACACTGATCTCTGTCATAGT................................................. | 21 | 1 | 3.00 | 9.00 | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..........................................................................................................AACAGAGGATGGAATTGAG........................................................................................ | 19 | 1 | 2.00 | 2.00 | - | - | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...............................................................................................................AGGATGGAATTGAGGTAGG................................................................................... | 19 | 2.00 | 0.00 | - | - | - | - | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ......................................................................................................................AATTGAGGACATAGTTTTGCAACTCAAC................................................................... | 28 | 1 | 2.00 | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..............................................................................................................................................CAACACTGATCTCTGTCATAGAT................................................ | 23 | 1 | 2.00 | 4.00 | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..........................................................................................................................................AACTCAACACTGATCTCTGTCATA................................................... | 24 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...................................................................................................AGAAGAAAACAGAGGATG................................................................................................ | 18 | 2 | 1.00 | 1.00 | - | - | - | - | - | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .................................................................................TGAGTGTGTGGCTTTGGGAGAAGAAAAC........................................................................................................ | 28 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - |
| .............................................................AGGGAGATGAAGGGGATAG..................................................................................................................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | |
| .................................................................................................................GATGGAATTGAGGACATAGGGGT............................................................................. | 23 | 1.00 | 0.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ........................................................................................................AAAACAGAGGATGGACA............................................................................................ | 17 | 1.00 | 0.00 | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .............................................................................................................AGAGGATGGAATTGAGGACATAGTT............................................................................... | 25 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - |
| .......................................................................................TGTGGCTTTGGGAGAAGTCAT......................................................................................................... | 21 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...............................................................................................................................................AACACTGATCTCTGTCATAGCTG............................................... | 23 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ......................................................................................................AGAAAACAGAGGATGAGCA............................................................................................ | 19 | 1.00 | 0.00 | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...............................CCGATCTTGGGCTATGGAG................................................................................................................................................................... | 19 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..................TCAGCCCCGGCCCCCGATC................................................................................................................................................................................ | 19 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .....................................................................................................AAGAAAACAGAGGATGAACT............................................................................................ | 20 | 1.00 | 0.00 | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..............................................................................................................................................CAACACTGATCTCTGTCATAT.................................................. | 21 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .......................................................TACAGGAGGGAGATGAATGAA......................................................................................................................................... | 21 | 1.00 | 0.00 | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...................................................................................AGTGTGTGGCTTTGGGAGAAGAAAACAGAA.................................................................................................... | 30 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...............................................................................................................................................AACACTGATCTCTGTCATATT................................................. | 21 | 1.00 | 0.00 | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .............................................................................................................AGAGGATGGAATTGAGGACATAGTTT.............................................................................. | 26 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - |
| .....................................................................................................AAGAAAACAGAGGATGACCA............................................................................................ | 20 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..................................................GTAAGTACAGGAGGGAGATGAAG............................................................................................................................................ | 23 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ........................................................................GGGGCTTGGTGAGTGTGTGGCTT...................................................................................................................... | 23 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .............................................................................................................AGAGGATGGAATTGAGGA...................................................................................... | 18 | 2 | 0.50 | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...........CCTATGGTCAGCCCC........................................................................................................................................................................................... | 15 | 7 | 0.14 | 0.14 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.14 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| GGGCCTGATGCCCTATGGTCAGCCCCGGCCCCCGATCTTGGGCTATGGAGGTAAGTACAGGAGGGAGATGAAGGGGCTTGGTGAGTGTGTGGCTTTGGGAGAAGAAAACAGAGGATGGAATTGAGGACATAGTTTTGCAACTCAACACTGATCTCTGTCATAGCTGGTGCTGTCCGCCCTGCAGTCCCCACAGGAGGCCCTCCATACCCCCAT ...........................................................................................................(((((((.(((..(((((..((......))...)))))..))).)))))))....................................................... ..........................................................................................................107.....................................................163................................................ | Size | Perfect hit | Total Norm | Perfect Norm | SRR207115(GSM721077) XRN1&2 knockdown. (XRN1/XRN2 cell line) | SRR207116(GSM721078) Nuclear RNA. (cell line) | GSM450601(GSM450601) miRNA sequencing raw reads from post-mortem s. (brain) | SRR029128(GSM416757) H520. (cell line) | SRR330870(SRX091708) tissue: skin psoriatic involveddisease state:. (skin) | SRR033715(GSM497060) Mantle Cell Lymphoma (Mino122). (B cell) | SRR094129(GSM651905) small RNA(18-35nt)small RNA deep sequencing o. (uterus) | DRR000555(DRX000313) "THP-1 whole cell RNA, no treatment". (cell line) | SRR033722(GSM497067) KMS12 cell line (KMS12). (B cell) | SRR330888(SRX091726) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR207112(GSM721074) RRP40 knockdown. (RRP40 cell line) | SRR330890(SRX091728) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR037876(GSM522374) fibroblasts_cell_culture. (fibroblast) | SRR444067(SRX128915) Sample 24cDNABarcode: AF-PP-340: ACG CTC TTC . (cell line) | SRR029127(GSM416756) A549. (cell line) | SRR553576(SRX182782) source: Testis. (testes) | SRR326282(GSM769512) "Dicer mRNA was knocked down using siDicer, t. (cell line) | SRR326281(GSM769511) "Dicer mRNA was knocked down using siDicer, c. (cell line) | SRR207111(GSM721073) Whole cell RNA. (cell line) | SRR033721(GSM497066) Ly3 cell line (Ly3). (B cell) | SRR189780(GSM714640) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | RoviraIPAgo2(Rovira) total RNA. (ago2 breast) | SRR330867(SRX091705) tissue: skin psoriatic involveddisease state:. (skin) | DRR001488(DRX001042) "Hela short nuclear cell fraction, LNA(+)". (hela) | SRR330872(SRX091710) tissue: skin psoriatic involveddisease state:. (skin) | SRR039621(GSM531984) HBV(+) HCC Tissue Sample 2. (liver) | SRR330879(SRX091717) tissue: skin psoriatic involveddisease state:. (skin) | SRR553572(SRX182778) source: Frontal Cortex. (Frontal Cortex) | SRR330892(SRX091730) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR553575(SRX182781) source: Kidney. (Kidney) | SRR039190(GSM494809) PBMCs were isolated by ficoll gradient from t. (blood) | SRR191592(GSM715702) 59genomic small RNA (size selected RNA from t. (breast) | SRR330903(SRX091741) tissue: skin psoriatic uninvolveddisease stat. (skin) | GSM1105753INPUT(GSM1105753) small RNA sequencing data. (hela) | DRR000558(DRX000316) "THP-1 whole cell RNA, after 3 day treatment . (cell line) | SRR191475(GSM715585) 18genomic small RNA (size selected RNA from t. (breast) | SRR015358(GSM380323) NaÌøve B Cell (Naive39). (B cell) | SRR039192(GSM494811) K562 cell line is derived from a CML patient . (cell line) | TAX577741(Rovira) total RNA. (breast) | SRR189779(GSM714639) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR038859(GSM458542) MM386. (cell line) | SRR330868(SRX091706) tissue: skin psoriatic involveddisease state:. (skin) | SRR330877(SRX091715) tissue: skin psoriatic involveddisease state:. (skin) | SRR039622(GSM531985) HCV(+) Adjacent Tissue Sample. (liver) | SRR033730(GSM497075) Lymphoblastic (ALL411). (B cell) | SRR033714(GSM497059) Burkitt Lymphoma (BL134). (B cell) | GSM450605(GSM450605) miRNA sequencing raw reads from post-mortem s. (brain) | SRR038862(GSM458545) MM472. (cell line) | SRR326280(GSM769510) total cell content of unperturbed cells was s. (cell line) | SRR330878(SRX091716) tissue: skin psoriatic involveddisease state:. (skin) | SRR330920(SRX091758) tissue: normal skindisease state: normal. (skin) | SRR330886(SRX091724) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR039623(GSM531986) HCV(+) HCC Tissue Sample. (liver) | SRR033711(GSM497056) GCB DLBCL (GCB110). (B cell) | SRR330859(SRX091697) tissue: skin psoriatic involveddisease state:. (skin) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ...........................GCCCAAGATCGGGGGC.......................................................................................................................................................................... | 16 | 1 | 2.00 | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...................................................................................................................................................CTGATCTCTGTCATAGCTGGTGCTGTCCGCCG.................................. | 32 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..................................................................................................................................................................GCTGGTGCTGTCCGCCCTGCAGTCCCCACATG................... | 32 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ................................................................................................................................................................ACTGCAGGGCGGACAGCACCAGCTA............................ | 25 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ................................................................................................................................................................GGGCGGACAGCACCAGCTA.................................. | 19 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ............................................................................................................................................................................TCCGCCCTGCAGTCCCT........................ | 17 | 1.00 | 0.00 | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...............................TACTTACCTCCATAGCCCAAGATCGG............................................................................................................................................................ | 26 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .................................................................................................................................................GCGGACAGCACCAGCTATGACAGAGATCAGTG.................................... | 32 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .....................TAGCCCAAGATCGGGGGCCGGGGC........................................................................................................................................................................ | 24 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..................TCAGCCCCGGCCCCCAAG................................................................................................................................................................................. | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .......................................................................................................................................................................TCCTGTGGGGACTGCAGGGCGGACAGCA.................. | 28 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - |
| ......GCCGGGGCTGACCATAGGGCATC........................................................................................................................................................................................ | 23 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .........................................................CAGGAGGGAGATGAAGATG......................................................................................................................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | |
| .........GCCGGGGCTGACCATAGGGC........................................................................................................................................................................................ | 20 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .............................................................................................................................................................................CCGCCCTGCAGTCCCGGCG..................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...............CAAGATCGGGGGCCGGGGCTGACCA............................................................................................................................................................................. | 25 | 1 | 1.00 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |