| (2) AGO2.ip | (2) B-CELL | (4) BRAIN | (2) BREAST | (14) CELL-LINE | (1) CERVIX | (2) HEART | (7) LIVER | (2) OTHER | (10) SKIN |
| ACACAACAAAGGAGGTTTTCCGGAAGAACTTCTTCAATGACTGGCGAAAGGTAGGTACCCTGGGCGGCCGCCACAGCTGTCCTGGACCTGGCTGGCTAGGCGTCTGCGGTTCTGCAGTGCTGCCTCTGAACGCCCCTCGCAAGTTCTCGGTGGCCCCTGTGTGACCACTCACAGGTGCCGTCATGGCTCTTTGCAGCTTCGAGCTCCTGGGCTCAAGCCATCCTCCTGTCTCGGCCTCCTGAGTAGCTGG ....................................................................................((...(((.(((..((((.(((((....)))))))))))).......)))..))................................................................................................................ ..................................................................................83......................................................139............................................................................................................. | Size | Perfect hit | Total Norm | Perfect Norm | SRR189779(GSM714639) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR387909(GSM843861) specific-host: Homo sapienshost cell line: Su. (cell line) | SRR039616(GSM531979) HBV(+) Distal Tissue Sample 1. (liver) | SRR189780(GSM714640) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR039621(GSM531984) HBV(+) HCC Tissue Sample 2. (liver) | SRR039622(GSM531985) HCV(+) Adjacent Tissue Sample. (liver) | SRR039620(GSM531983) HBV(+) Adjacent Tissue Sample 2. (liver) | GSM450605(GSM450605) miRNA sequencing raw reads from post-mortem s. (brain) | RoviraIPAgo2(Rovira) total RNA. (ago2 breast) | SRR326279(GSM769509) cytoplasmic fraction was isolated using PARIS. (cell line) | SRR330885(SRX091723) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR040008(GSM532893) G727N. (cervix) | GSM450608(GSM450608) miRNA sequencing raw reads from post-mortem s. (brain) | SRR039623(GSM531986) HCV(+) HCC Tissue Sample. (liver) | SRR189787 | SRR330905(SRX091743) tissue: normal skindisease state: normal. (skin) | SRR060983(GSM569187) Human pre-germinal center B cell [09-001]. (cell line) | DRR000555(DRX000313) "THP-1 whole cell RNA, no treatment". (cell line) | TAX577588(Rovira) total RNA. (breast) | SRR330913(SRX091751) tissue: normal skindisease state: normal. (skin) | SRR039190(GSM494809) PBMCs were isolated by ficoll gradient from t. (blood) | GSM450601(GSM450601) miRNA sequencing raw reads from post-mortem s. (brain) | SRR189783 | SRR039618(GSM531981) HBV(+) Side Tissue Sample 1. (liver) | SRR033710(GSM497055) GCB DLBCL (GCB385). (B cell) | SRR553573(SRX182779) source: Cerebellum. (Cerebellum) | DRR000558(DRX000316) "THP-1 whole cell RNA, after 3 day treatment . (cell line) | SRR039617(GSM531980) HBV(+) Adjacent Tissue Sample 1. (liver) | SRR189785 | SRR039192(GSM494811) K562 cell line is derived from a CML patient . (cell line) | SRR033727(GSM497072) HIV-positive DL (HIV412). (B cell) | SRR039636(GSM518473) THP1_cyto_sRNAs. (cell line) | SRR330861(SRX091699) tissue: skin psoriatic involveddisease state:. (skin) | SRR330901(SRX091739) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR390723(GSM850202) total small RNA. (cell line) | SRR039635(GSM518472) THP1_nuc_sRNAs. (cell line) | SRR330874(SRX091712) tissue: skin psoriatic involveddisease state:. (skin) | SRR330894(SRX091732) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR107296(GSM677703) 18-30nt fraction of small RNA. (cell line) | GSM450602(GSM450602) miRNA sequencing raw reads from post-mortem s. (brain) | GSM956925Ago2PAZ(GSM956925) "cell line: HEK293 cell linepassages: 15-20ip. (ago2 cell line) | SRR342896(SRX096792) small RNA seq of Right atrial tissue. (heart) | SRR330886(SRX091724) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR326281(GSM769511) "Dicer mRNA was knocked down using siDicer, c. (cell line) | SRR330859(SRX091697) tissue: skin psoriatic involveddisease state:. (skin) | SRR342894(SRX096790) small RNA seq of Right atrial tissue. (heart) | SRR330877(SRX091715) tissue: skin psoriatic involveddisease state:. (skin) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| .......................................................................................CTGGCTGGCTAGGCGGGGG................................................................................................................................................ | 19 | 27.00 | 0.00 | - | 9.00 | 1.00 | 1.00 | 2.00 | 3.00 | 3.00 | - | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | 1.00 | - | - | - | - | - | 1.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | - | 1.00 | 1.00 | - | - | - | |
| .......................................................................................CTGGCTGGCTAGGCGGGG................................................................................................................................................. | 18 | 17.00 | 0.00 | - | 1.00 | 1.00 | - | 2.00 | 1.00 | - | - | 1.00 | 1.00 | 1.00 | 1.00 | - | 1.00 | - | - | - | - | - | 1.00 | - | - | - | - | 1.00 | - | - | 1.00 | - | - | - | - | - | 1.00 | - | 1.00 | - | 1.00 | - | - | - | 1.00 | - | - | - | - | - | |
| .......................................................................................CTGGCTGGCTAGGCGGGC................................................................................................................................................. | 18 | 2.00 | 0.00 | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .......................................................................................CTGGCTGGCTAGGCGGGGT................................................................................................................................................ | 19 | 2.00 | 0.00 | - | - | 1.00 | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .......................................................................................CTGGCTGGCTAGGCGGGTT................................................................................................................................................ | 19 | 2.00 | 0.00 | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ....................................ATGACTGGCGAAAGGTAGGTACCC.............................................................................................................................................................................................. | 24 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - |
| ....................................................................................GACCTGGCTGGCTAGGCGGGGT................................................................................................................................................ | 22 | 1.00 | 0.00 | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ....................................................................................................................GTGCTGCCTCTGAACTCTG................................................................................................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | |
| ...................................AATGACTGGCGAAAGGAAAT................................................................................................................................................................................................... | 20 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | |
| .......................................................................................CTGGCTGGCTAGGCGGG.................................................................................................................................................. | 17 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | |
| ....................................................................................................................................................................................................................................TCTCGGCCTCCTGAGTAGCTGGTAC | 25 | 1.00 | 0.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...................................AATGACTGGCGAAAGGAA..................................................................................................................................................................................................... | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .....................................................................................ACCTGGCTGGCTAGGCGGGGG................................................................................................................................................ | 21 | 1.00 | 0.00 | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .......AAAGGAGGTTTTCCGGAAGAA.............................................................................................................................................................................................................................. | 21 | 1 | 1.00 | 1.00 | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ......................................................................................................................................................................................................................................TCGGCCTCCTGAGTAGCTGG | 20 | 0 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ............................................................TGGGCGGCCGCCACACGTC........................................................................................................................................................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..............................................................................................................................................................................................................................CTCCTGTCTCGGCCTCCTGAGTAGCCGGG | 29 | 1.00 | 0.00 | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .............................................................................................................................................................................................................CCTGGGCTCAAGCCATCCTCCTAGCC................... | 26 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .......................................................................................CTGGCTGGCTAGGCGGAA................................................................................................................................................. | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ....................................................................................................................................................................................................CTTCGAGCTCCTGGGT...................................... | 16 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .................................................................................CTGGACCTGGCTGGCTA........................................................................................................................................................ | 17 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...........................................................................GCTGTCCTGGACCTGAAAA............................................................................................................................................................ | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ................................................................................................................TGCAGTGCTGCCTCTCTGT....................................................................................................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .......................................................................................CTGGCTGGCTAGGCGGT.................................................................................................................................................. | 17 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .......................AAGAACTTCTTCAATGACTGGC............................................................................................................................................................................................................. | 22 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .......................................................................................CTGGCTGGCTAGGCGGGCG................................................................................................................................................ | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .......................AAGAACTTCTTCAATGACTGGCGAAAGG....................................................................................................................................................................................................... | 28 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - |
| ........................................................................................................................................................................................................................................GGCCTCCTGAGTAGCTGGA | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | |
| .......................................................................................CTGGCTGGCTAGGCGAG.................................................................................................................................................. | 17 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ......................................................................................CCTGGCTGGCTAGGCGGC.................................................................................................................................................. | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...........................................................................GCTGTCCTGGACCTGG............................................................................................................................................................... | 16 | 4 | 0.25 | 0.25 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.25 | - |
| .................................................................................................................................................................................................CAGCTTCGAGCTCCTGGGC...................................... | 19 | 5 | 0.20 | 0.20 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.20 |
| ACACAACAAAGGAGGTTTTCCGGAAGAACTTCTTCAATGACTGGCGAAAGGTAGGTACCCTGGGCGGCCGCCACAGCTGTCCTGGACCTGGCTGGCTAGGCGTCTGCGGTTCTGCAGTGCTGCCTCTGAACGCCCCTCGCAAGTTCTCGGTGGCCCCTGTGTGACCACTCACAGGTGCCGTCATGGCTCTTTGCAGCTTCGAGCTCCTGGGCTCAAGCCATCCTCCTGTCTCGGCCTCCTGAGTAGCTGG ....................................................................................((...(((.(((..((((.(((((....)))))))))))).......)))..))................................................................................................................ ..................................................................................83......................................................139............................................................................................................. | Size | Perfect hit | Total Norm | Perfect Norm | SRR189779(GSM714639) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR387909(GSM843861) specific-host: Homo sapienshost cell line: Su. (cell line) | SRR039616(GSM531979) HBV(+) Distal Tissue Sample 1. (liver) | SRR189780(GSM714640) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR039621(GSM531984) HBV(+) HCC Tissue Sample 2. (liver) | SRR039622(GSM531985) HCV(+) Adjacent Tissue Sample. (liver) | SRR039620(GSM531983) HBV(+) Adjacent Tissue Sample 2. (liver) | GSM450605(GSM450605) miRNA sequencing raw reads from post-mortem s. (brain) | RoviraIPAgo2(Rovira) total RNA. (ago2 breast) | SRR326279(GSM769509) cytoplasmic fraction was isolated using PARIS. (cell line) | SRR330885(SRX091723) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR040008(GSM532893) G727N. (cervix) | GSM450608(GSM450608) miRNA sequencing raw reads from post-mortem s. (brain) | SRR039623(GSM531986) HCV(+) HCC Tissue Sample. (liver) | SRR189787 | SRR330905(SRX091743) tissue: normal skindisease state: normal. (skin) | SRR060983(GSM569187) Human pre-germinal center B cell [09-001]. (cell line) | DRR000555(DRX000313) "THP-1 whole cell RNA, no treatment". (cell line) | TAX577588(Rovira) total RNA. (breast) | SRR330913(SRX091751) tissue: normal skindisease state: normal. (skin) | SRR039190(GSM494809) PBMCs were isolated by ficoll gradient from t. (blood) | GSM450601(GSM450601) miRNA sequencing raw reads from post-mortem s. (brain) | SRR189783 | SRR039618(GSM531981) HBV(+) Side Tissue Sample 1. (liver) | SRR033710(GSM497055) GCB DLBCL (GCB385). (B cell) | SRR553573(SRX182779) source: Cerebellum. (Cerebellum) | DRR000558(DRX000316) "THP-1 whole cell RNA, after 3 day treatment . (cell line) | SRR039617(GSM531980) HBV(+) Adjacent Tissue Sample 1. (liver) | SRR189785 | SRR039192(GSM494811) K562 cell line is derived from a CML patient . (cell line) | SRR033727(GSM497072) HIV-positive DL (HIV412). (B cell) | SRR039636(GSM518473) THP1_cyto_sRNAs. (cell line) | SRR330861(SRX091699) tissue: skin psoriatic involveddisease state:. (skin) | SRR330901(SRX091739) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR390723(GSM850202) total small RNA. (cell line) | SRR039635(GSM518472) THP1_nuc_sRNAs. (cell line) | SRR330874(SRX091712) tissue: skin psoriatic involveddisease state:. (skin) | SRR330894(SRX091732) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR107296(GSM677703) 18-30nt fraction of small RNA. (cell line) | GSM450602(GSM450602) miRNA sequencing raw reads from post-mortem s. (brain) | GSM956925Ago2PAZ(GSM956925) "cell line: HEK293 cell linepassages: 15-20ip. (ago2 cell line) | SRR342896(SRX096792) small RNA seq of Right atrial tissue. (heart) | SRR330886(SRX091724) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR326281(GSM769511) "Dicer mRNA was knocked down using siDicer, c. (cell line) | SRR330859(SRX091697) tissue: skin psoriatic involveddisease state:. (skin) | SRR342894(SRX096790) small RNA seq of Right atrial tissue. (heart) | SRR330877(SRX091715) tissue: skin psoriatic involveddisease state:. (skin) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ...............................................................................................................................................................................................................................TCCTGTCTCGGCCTCCTGAGTAG.... | 23 | 2.00 | 0.00 | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...............................................................................................................................................................................................................................TCCTGTCTCGGCCTCCTGAC....... | 20 | 1.00 | 0.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .........................................................................................................................................................................................................AGCTCCTGGGCTCAAGCCATCCTCCAAAG.................... | 29 | 1.00 | 0.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...........................................................................................................................................................................................................................ATCCTCCTGTCTCGGCCTCCTGAGTAGCTCAC | 32 | 1.00 | 0.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .....................................................................................................................................................................................................................................TACTCAGGAGGCCGAG..... | 16 | 0 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..............................................................................................................................................................................................................................CTCCTGTCTCGGCCTCCTGAGTAGT... | 25 | 1.00 | 0.00 | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .............................................................................................................................................................................................................CCTGGGCTCAAGCCATCCTCCTTGC.................... | 25 | 1.00 | 0.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ................................................................................................................................................................................................................GGGCTCAAGCCATCCTCTGCA..................... | 21 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..............................................................................................................................................................................................................................CTCCTGTCTCGGCCTCCTGAGTAACC.. | 26 | 1.00 | 0.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..........................................................................................................CGGTTCTGCAGTGCTG................................................................................................................................ | 16 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..........................................................................................................................................................................................................GCTCCTGGGCTCAAGCCATCCTCCTGGG.................... | 28 | 1.00 | 0.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ................................................................................................................................................................................................................................CCTGTCTCGGCCTCCTGAGTGG.... | 22 | 1.00 | 0.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ................................................................................................................................................................................................................................CCTGTCTCGGCCTCCTGAGTGAG... | 23 | 1.00 | 0.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..............................................................................................................................................................................................................................CTCCTGTCTCGGCCTCCTGAGTAAACG. | 27 | 1.00 | 0.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .....................................................................................................................................................................................................ATGGCTTGAGCCCAGGAGCTCGAA............................. | 24 | 3 | 0.33 | 0.33 | - | - | - | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .................................................................................................................................................................................................TGAGCCCAGGAGCTCGAAGCTG................................... | 22 | 4 | 0.25 | 0.25 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.25 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .............................................................................................................................................................................................................................ACTCAGGAGGCCGAGACAGGAGG...... | 23 | 9 | 0.22 | 0.22 | - | - | - | 0.22 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .............................................................................................................................................................................................................................AGCTACTCAGGAGGCCGAGACAGGAGG.. | 27 | 7 | 0.14 | 0.14 | - | - | - | 0.14 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ........................................................................................................................................................................................................AGGAGGATGGCTTGAGCCCAGGAGCTC....................... | 27 | 8 | 0.12 | 0.12 | 0.12 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ........................................................................................................................................................................................................................AGGCCGAGACAGGAGGATGGC............. | 21 | 9 | 0.11 | 0.11 | 0.11 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |