| (5) B-CELL | (1) BRAIN | (15) BREAST | (21) CELL-LINE | (5) CERVIX | (1) FIBROBLAST | (3) HEART | (2) HELA | (3) LIVER | (1) OTHER | (26) SKIN | (1) TESTES | (1) UTERUS |
| TATTGGATCCCGAGACAAAGAAACCTTGCACAAGATCCCTCACCTGCAAGGTATTTCTCTTTCCATAAAAAATACTTCCTGCTCTCGCTGGGGCCTTTGTCGAAATGTTTGCATGCCACTCTCTGCACACGGCAGGGTGTGGAACCTCGACATGACCCCCAGCTGTTCTTTGTAAGGGAAATGCTTTCTTCTCGTCCATGGTAGCAGAGTGCCTGCCTCAAGCTGGCTGGCTTTTTAAGAAGGAGAAAAA ............................................................................((((((....(((((((....((((((.(((....))).((((.((((((.....)))))).))))....))))))....)))))))........))).)))........................................................................ ............................................................................77......................................................................................................181................................................................... | Size | Perfect hit | Total Norm | Perfect Norm | SRR095854(SRX039177) "miRNA were isolated from FirstChoice Human B. (brain) | SRR037940(GSM510478) 293cand5_rep2. (cell line) | SRR037944(GSM510482) 293DcrTN_cand5. (cell line) | SRR330879(SRX091717) tissue: skin psoriatic involveddisease state:. (skin) | SRR037942(GSM510480) 293DroshaTN_cand5. (cell line) | SRR037939(GSM510477) 293cand5_rep1. (cell line) | DRR001488(DRX001042) "Hela short nuclear cell fraction, LNA(+)". (hela) | SRR094129(GSM651905) small RNA(18-35nt)small RNA deep sequencing o. (uterus) | SRR189782 | SRR189779(GSM714639) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR037943(GSM510481) 293DcrTN. (cell line) | SRR060984(GSM569188) Human plasma cell [09-001]. (cell line) | SRR444049(SRX128897) Sample 9cDNABarcode: AF-PP-334: ACG CTC TTC C. (skin) | SRR330884(SRX091722) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330919(SRX091757) tissue: normal skindisease state: normal. (skin) | SRR330901(SRX091739) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR444061(SRX128909) Sample 19cDNABarcode: AF-PP-341: ACG CTC TTC . (skin) | SRR189784 | SRR039621(GSM531984) HBV(+) HCC Tissue Sample 2. (liver) | SRR040040(GSM532925) G612N. (cervix) | SRR330900(SRX091738) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR553572(SRX182778) source: Frontal Cortex. (Frontal Cortex) | SRR444059(SRX128907) Sample 17cDNABarcode: AF-PP-339: ACG CTC TTC . (skin) | SRR330903(SRX091741) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330891(SRX091729) tissue: skin psoriatic uninvolveddisease stat. (skin) | GSM416733(GSM416733) HEK293. (cell line) | TAX577740(Rovira) total RNA. (breast) | SRR037937(GSM510475) 293cand2. (cell line) | SRR037931(GSM510469) 293GFP. (cell line) | SRR444048(SRX128896) Sample 8cDNABarcode: AF-PP-333: ACG CTC TTC C. (skin) | TAX577739(Rovira) total RNA. (breast) | SRR191597(GSM715707) 75genomic small RNA (size selected RNA from t. (breast) | SRR330899(SRX091737) tissue: skin psoriatic uninvolveddisease stat. (skin) | TAX577744(Rovira) total RNA. (breast) | SRR033723(GSM497068) L1236 cell line (L1236). (B cell) | SRR330916(SRX091754) tissue: normal skindisease state: normal. (skin) | SRR330895(SRX091733) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR326281(GSM769511) "Dicer mRNA was knocked down using siDicer, c. (cell line) | SRR330861(SRX091699) tissue: skin psoriatic involveddisease state:. (skin) | SRR330914(SRX091752) tissue: normal skindisease state: normal. (skin) | SRR040037(GSM532922) G243T. (cervix) | SRR038861(GSM458544) MM466. (cell line) | SRR037938(GSM510476) 293Red. (cell line) | SRR444057(SRX128905) Sample 15cDNABarcode: AF-PP-334: ACG CTC TTC . (skin) | SRR038857(GSM458540) D20. (cell line) | SRR060986(GSM569190) Human memory B cell [09-001]. (cell line) | SRR060981(GSM569185) Human centroblast [09-001]. (cell line) | SRR330889(SRX091727) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR191605(GSM715715) 76genomic small RNA (size selected RNA from t. (breast) | SRR191451(GSM715561) 177genomic small RNA (size selected RNA from . (breast) | SRR330865(SRX091703) tissue: skin psoriatic involveddisease state:. (skin) | SRR029124(GSM416753) HeLa. (hela) | SRR037936(GSM510474) 293cand1. (cell line) | SRR330881(SRX091719) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR015363(GSM380328) Germinal Center B cell (GC40). (B cell) | SRR191603(GSM715713) 71genomic small RNA (size selected RNA from t. (breast) | SRR342894(SRX096790) small RNA seq of Right atrial tissue. (heart) | SRR040028(GSM532913) G026N. (cervix) | SRR029129(GSM416758) SW480. (cell line) | SRR191606(GSM715716) 84genomic small RNA (size selected RNA from t. (breast) | SRR444055(SRX128903) Sample 27_2cDNABarcode: AF-PP-343: ACG CTC TT. (skin) | SRR191565(GSM715675) 92genomic small RNA (size selected RNA from t. (breast) | SRR037876(GSM522374) fibroblasts_cell_culture. (fibroblast) | SRR330904(SRX091742) tissue: normal skindisease state: normal. (skin) | SRR015358(GSM380323) NaÌøve B Cell (Naive39). (B cell) | SRR039617(GSM531980) HBV(+) Adjacent Tissue Sample 1. (liver) | SRR191535(GSM715645) 181genomic small RNA (size selected RNA from . (breast) | SRR033726(GSM497071) Mututated CLL (CLLM633). (B cell) | SRR038858(GSM458541) MEL202. (cell line) | SRR330887(SRX091725) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR040022(GSM532907) G575N. (cervix) | TAX577590(Rovira) total RNA. (breast) | SRR040006(GSM532891) G601N. (cervix) | SRR553576(SRX182782) source: Testis. (testes) | SRR029130(GSM416759) DLD2. (cell line) | SRR330915(SRX091753) tissue: normal skindisease state: normal. (skin) | SRR015360(GSM380325) Plasma B cells (PC137). (B cell) | SRR342898(SRX096794) small RNA seq of Right atrial tissue. (heart) | SRR330920(SRX091758) tissue: normal skindisease state: normal. (skin) | SRR342896(SRX096792) small RNA seq of Right atrial tissue. (heart) | TAX577745(Rovira) total RNA. (breast) | SRR039637(GSM518474) THP1_total_sRNAs. (cell line) | SRR191497(GSM715607) 17genomic small RNA (size selected RNA from t. (breast) | SRR039611(GSM531974) Human Normal Liver Tissue Sample 1. (liver) | SRR343335 | SRR330896(SRX091734) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR015448(SRR015448) cytoplasmic small RNAs. (breast) | TAX577589(Rovira) total RNA. (breast) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| .................................................................................CTCTCGCTGGGGCCTCCA....................................................................................................................................................... | 18 | 3 | 61.67 | 0.67 | 30.33 | 4.67 | 1.67 | 0.67 | 2.33 | 2.33 | - | - | - | - | 1.00 | 0.33 | 0.33 | 0.33 | 0.33 | 0.33 | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | 0.33 | 0.67 | - | 0.67 | - | 0.67 | 0.33 | 0.67 | 0.67 | 0.67 | 0.33 | 0.33 | 0.33 | 0.33 | 0.33 | 0.33 | 0.33 | 0.33 | 0.33 | 0.33 | 0.33 | 0.33 | 0.33 | 0.33 | - | 0.33 | 0.33 | 0.33 | 0.33 | 0.33 | 0.33 | 0.33 | 0.33 | 0.33 | 0.33 | 0.33 | - | - | 0.33 | 0.33 | 0.33 | 0.33 | 0.33 | 0.33 | 0.33 | 0.33 | 0.33 | - | - | - | - |
| .................................................................................CTCTCGCTGGGGCCTCC........................................................................................................................................................ | 17 | 3 | 11.67 | 0.67 | 10.67 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.67 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ................................................................................GCTCTCGCTGGGGCCTCCA....................................................................................................................................................... | 19 | 7.00 | 0.00 | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | 1.00 | - | 1.00 | - | - | - | - | 1.00 | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...................................................................................CTCGCTGGGGCCTTTA....................................................................................................................................................... | 16 | 3.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | 1.00 | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..................................................................................TCTCGCTGGGGCCTTTTTT..................................................................................................................................................... | 19 | 2.00 | 0.00 | - | - | - | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..................................................................................TCTCGCTGGGGCCTTTT....................................................................................................................................................... | 17 | 2.00 | 0.00 | - | - | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .................................................................................CTCTCGCTGGGGCCTCCC....................................................................................................................................................... | 18 | 3 | 1.33 | 0.67 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.67 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .........................................................................................................................................................................................................................................TTTAAGAAGGAGAAACAGA | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .............................................................................................................................................................................................................................GCTGGCTGGCTTTTTCAC........... | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ................................................................................GCTCTCGCTGGGGCCTCC........................................................................................................................................................ | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..................................................................................TCTCGCTGGGGCCTTTTT...................................................................................................................................................... | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ........CCCGAGACAAAGAAACCTT............................................................................................................................................................................................................................... | 19 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ................................................................................GCTCTCGCTGGGGCCTCCG....................................................................................................................................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .................................................................................CTCTCGCTGGGGCCTC......................................................................................................................................................... | 16 | 3 | 1.00 | 0.67 | 0.67 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .....................................................................................................................................................................................................ATGGTAGCAGAGTGCCTG................................... | 18 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..................................................................................TCTCGCTGGGGCCTTTATTT.................................................................................................................................................... | 20 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..................................................................................TCTCGCTGGGGCCTTTA....................................................................................................................................................... | 17 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ............................................................................................................................................................CCCCAGCTGTTCTTTGTAGAG......................................................................... | 21 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...................................................................................................................CCACTCTCTGCACACAAG..................................................................................................................... | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..............................................................CCATAAAAAATACTTCCTG......................................................................................................................................................................... | 19 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...........................................................................................................................................................................................CTTCTCGTCCATGGTAGCAG........................................... | 20 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..................................................................................TCTCGCTGGGGCCTTTGGAC.................................................................................................................................................... | 20 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...............................................................................................................................CACGGCAGGGTGTGGAACCTC...................................................................................................... | 21 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ............................................................................................................................................................................................................................AGCTGGCTGGCTTTTTTGC........... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ................................................................................GCTCTCGCTGGGGCCTCCT....................................................................................................................................................... | 19 | 1.00 | 0.00 | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .................................................................................CTCTCGCTGGGGCCTACA....................................................................................................................................................... | 18 | 3 | 0.67 | 0.67 | 0.33 | - | - | - | - | - | - | - | - | - | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .................................................................................CTCTCGCTGGGGCCT.......................................................................................................................................................... | 15 | 3 | 0.67 | 0.67 | 0.67 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...............................................................................................................................CACGGCAGGGTGTGGA........................................................................................................... | 16 | 2 | 0.50 | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .................................................................................CTCTCGCTGGGGCCTCCAA...................................................................................................................................................... | 19 | 3 | 0.33 | 0.67 | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..................................................................................TCTCGCTGGGGCCTT......................................................................................................................................................... | 15 | 9 | 0.22 | 0.22 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.11 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.11 | - | - |
| ....................AAACCTTGCACAAGA....................................................................................................................................................................................................................... | 15 | 8 | 0.12 | 0.12 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.12 | - | - | - |
| ..................................................................................TCTCGCTGGGGCCTTATTT..................................................................................................................................................... | 19 | 9 | 0.11 | 0.22 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.11 |
| ..................................................................................TCTCGCTGGGGCCTTAA....................................................................................................................................................... | 17 | 9 | 0.11 | 0.22 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.11 | - |
| TATTGGATCCCGAGACAAAGAAACCTTGCACAAGATCCCTCACCTGCAAGGTATTTCTCTTTCCATAAAAAATACTTCCTGCTCTCGCTGGGGCCTTTGTCGAAATGTTTGCATGCCACTCTCTGCACACGGCAGGGTGTGGAACCTCGACATGACCCCCAGCTGTTCTTTGTAAGGGAAATGCTTTCTTCTCGTCCATGGTAGCAGAGTGCCTGCCTCAAGCTGGCTGGCTTTTTAAGAAGGAGAAAAA ............................................................................((((((....(((((((....((((((.(((....))).((((.((((((.....)))))).))))....))))))....)))))))........))).)))........................................................................ ............................................................................77......................................................................................................181................................................................... | Size | Perfect hit | Total Norm | Perfect Norm | SRR095854(SRX039177) "miRNA were isolated from FirstChoice Human B. (brain) | SRR037940(GSM510478) 293cand5_rep2. (cell line) | SRR037944(GSM510482) 293DcrTN_cand5. (cell line) | SRR330879(SRX091717) tissue: skin psoriatic involveddisease state:. (skin) | SRR037942(GSM510480) 293DroshaTN_cand5. (cell line) | SRR037939(GSM510477) 293cand5_rep1. (cell line) | DRR001488(DRX001042) "Hela short nuclear cell fraction, LNA(+)". (hela) | SRR094129(GSM651905) small RNA(18-35nt)small RNA deep sequencing o. (uterus) | SRR189782 | SRR189779(GSM714639) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR037943(GSM510481) 293DcrTN. (cell line) | SRR060984(GSM569188) Human plasma cell [09-001]. (cell line) | SRR444049(SRX128897) Sample 9cDNABarcode: AF-PP-334: ACG CTC TTC C. (skin) | SRR330884(SRX091722) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330919(SRX091757) tissue: normal skindisease state: normal. (skin) | SRR330901(SRX091739) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR444061(SRX128909) Sample 19cDNABarcode: AF-PP-341: ACG CTC TTC . (skin) | SRR189784 | SRR039621(GSM531984) HBV(+) HCC Tissue Sample 2. (liver) | SRR040040(GSM532925) G612N. (cervix) | SRR330900(SRX091738) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR553572(SRX182778) source: Frontal Cortex. (Frontal Cortex) | SRR444059(SRX128907) Sample 17cDNABarcode: AF-PP-339: ACG CTC TTC . (skin) | SRR330903(SRX091741) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330891(SRX091729) tissue: skin psoriatic uninvolveddisease stat. (skin) | GSM416733(GSM416733) HEK293. (cell line) | TAX577740(Rovira) total RNA. (breast) | SRR037937(GSM510475) 293cand2. (cell line) | SRR037931(GSM510469) 293GFP. (cell line) | SRR444048(SRX128896) Sample 8cDNABarcode: AF-PP-333: ACG CTC TTC C. (skin) | TAX577739(Rovira) total RNA. (breast) | SRR191597(GSM715707) 75genomic small RNA (size selected RNA from t. (breast) | SRR330899(SRX091737) tissue: skin psoriatic uninvolveddisease stat. (skin) | TAX577744(Rovira) total RNA. (breast) | SRR033723(GSM497068) L1236 cell line (L1236). (B cell) | SRR330916(SRX091754) tissue: normal skindisease state: normal. (skin) | SRR330895(SRX091733) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR326281(GSM769511) "Dicer mRNA was knocked down using siDicer, c. (cell line) | SRR330861(SRX091699) tissue: skin psoriatic involveddisease state:. (skin) | SRR330914(SRX091752) tissue: normal skindisease state: normal. (skin) | SRR040037(GSM532922) G243T. (cervix) | SRR038861(GSM458544) MM466. (cell line) | SRR037938(GSM510476) 293Red. (cell line) | SRR444057(SRX128905) Sample 15cDNABarcode: AF-PP-334: ACG CTC TTC . (skin) | SRR038857(GSM458540) D20. (cell line) | SRR060986(GSM569190) Human memory B cell [09-001]. (cell line) | SRR060981(GSM569185) Human centroblast [09-001]. (cell line) | SRR330889(SRX091727) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR191605(GSM715715) 76genomic small RNA (size selected RNA from t. (breast) | SRR191451(GSM715561) 177genomic small RNA (size selected RNA from . (breast) | SRR330865(SRX091703) tissue: skin psoriatic involveddisease state:. (skin) | SRR029124(GSM416753) HeLa. (hela) | SRR037936(GSM510474) 293cand1. (cell line) | SRR330881(SRX091719) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR015363(GSM380328) Germinal Center B cell (GC40). (B cell) | SRR191603(GSM715713) 71genomic small RNA (size selected RNA from t. (breast) | SRR342894(SRX096790) small RNA seq of Right atrial tissue. (heart) | SRR040028(GSM532913) G026N. (cervix) | SRR029129(GSM416758) SW480. (cell line) | SRR191606(GSM715716) 84genomic small RNA (size selected RNA from t. (breast) | SRR444055(SRX128903) Sample 27_2cDNABarcode: AF-PP-343: ACG CTC TT. (skin) | SRR191565(GSM715675) 92genomic small RNA (size selected RNA from t. (breast) | SRR037876(GSM522374) fibroblasts_cell_culture. (fibroblast) | SRR330904(SRX091742) tissue: normal skindisease state: normal. (skin) | SRR015358(GSM380323) NaÌøve B Cell (Naive39). (B cell) | SRR039617(GSM531980) HBV(+) Adjacent Tissue Sample 1. (liver) | SRR191535(GSM715645) 181genomic small RNA (size selected RNA from . (breast) | SRR033726(GSM497071) Mututated CLL (CLLM633). (B cell) | SRR038858(GSM458541) MEL202. (cell line) | SRR330887(SRX091725) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR040022(GSM532907) G575N. (cervix) | TAX577590(Rovira) total RNA. (breast) | SRR040006(GSM532891) G601N. (cervix) | SRR553576(SRX182782) source: Testis. (testes) | SRR029130(GSM416759) DLD2. (cell line) | SRR330915(SRX091753) tissue: normal skindisease state: normal. (skin) | SRR015360(GSM380325) Plasma B cells (PC137). (B cell) | SRR342898(SRX096794) small RNA seq of Right atrial tissue. (heart) | SRR330920(SRX091758) tissue: normal skindisease state: normal. (skin) | SRR342896(SRX096792) small RNA seq of Right atrial tissue. (heart) | TAX577745(Rovira) total RNA. (breast) | SRR039637(GSM518474) THP1_total_sRNAs. (cell line) | SRR191497(GSM715607) 17genomic small RNA (size selected RNA from t. (breast) | SRR039611(GSM531974) Human Normal Liver Tissue Sample 1. (liver) | SRR343335 | SRR330896(SRX091734) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR015448(SRR015448) cytoplasmic small RNAs. (breast) | TAX577589(Rovira) total RNA. (breast) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ................................................................................................................................................................................................CGTCCATGGTAGCAGAGT........................................ | 18 | 2.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ......ATCCCGAGACAAAGAAAAAG................................................................................................................................................................................................................................ | 20 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ................AAAGAAACCTTGCACAAGATTT.................................................................................................................................................................................................................... | 22 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..................................................................................................GTCGAAATGTTTGCATGA...................................................................................................................................... | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |