| (24)  B-CELL  | (1)  BRAIN  | (6)  BREAST  | (17)  CELL-LINE  | (8)  CERVIX  | (1)  FIBROBLAST  | (2)  HEART  | (9)  LIVER  | (1)  OTHER  | (16)  SKIN  | (4)  UTERUS  | 
| TTTTAAAATAACCCTGAAAAGAAATGCTAAGTTTTTGCCAATGATATTTGGAGATACAAAAAGAGAATCCAGGATAACAACTTGCATAGTTGGCAGAAGTTGTAAAACTGAAGAGTTTGAACTGAATTTTTGATAAGGTTAGGTTTAATTAATAGGTTAGAGGAAGAAAAGAGCACTCTAATGCTTCTTGCTTTTTGCAGAATTCAAGGAGGCATTTCTCCTGTTTGACAGAACAGGTGATTCCAAGATC .............................................................................................................((((...(((((((.((((((....)))))).))))))).......(((((((.............))))))).))))............................................................... ...................................................................................................100........................................................................................190..........................................................  | Size | Perfect hit | Total Norm | Perfect Norm | SRR015360(GSM380325) Plasma B cells (PC137). (B cell)  | SRR207110(GSM721072) Nuclear RNA. (cell line)  | SRR015365(GSM380330) Memory B cells (MM139). (B cell)  | SRR015363(GSM380328) Germinal Center B cell (GC40). (B cell)  | SRR015359(GSM380324) Germinal Center B cell (GC136). (B cell)  | SRR033719(GSM497064) 6hr Activated B cell line (ABC158). (B cell)  | SRR033720(GSM497065) EBV activated B cell line (EBV159). (B cell)  | SRR015361(GSM380326) Memory B cells (MM55). (B cell)  | SRR191581(GSM715691) 104genomic small RNA (size selected RNA from . (breast)  | SRR189785 | SRR015358(GSM380323) NaÌøve B Cell (Naive39). (B cell)  | SRR191617(GSM715727) 104genomic small RNA (size selected RNA from . (breast)  | SRR343336 | SRR343337 | SRR033727(GSM497072) HIV-positive DL (HIV412). (B cell)  | SRR343335 | SRR094130(GSM651906) small RNA(18-35nt)small RNA deep sequencing o. (uterus)  | SRR015364(GSM380329) Plasma B cells (PC44). (B cell)  | SRR033714(GSM497059) Burkitt Lymphoma (BL134). (B cell)  | SRR033723(GSM497068) L1236 cell line (L1236). (B cell)  | SRR033722(GSM497067) KMS12 cell line (KMS12). (B cell)  | SRR343334 | SRR107297(GSM677704) 18-30nt fraction of small RNA. (cell line)  | SRR039623(GSM531986) HCV(+) HCC Tissue Sample. (liver)  | SRR033711(GSM497056) GCB DLBCL (GCB110). (B cell)  | SRR033712(GSM497057) Burkitt Lymphoma (BL510). (B cell)  | SRR094132(GSM651908) small RNA(18-35nt)small RNA deep sequencing o. (uterus)  | SRR033713(GSM497058) Burkitt Lymphoma (BL115). (B cell)  | SRR107296(GSM677703) 18-30nt fraction of small RNA. (cell line)  | SRR033716(GSM497061) Mentle Cell Lymphoma (MCL114). (B cell)  | SRR314796(SRX084354) "Total RNA, fractionated (15-30nt)". (cell line)  | SRR033728(GSM497073) MALT (MALT413). (B cell)  | SRR033730(GSM497075) Lymphoblastic (ALL411). (B cell)  | SRR330905(SRX091743) tissue: normal skindisease state: normal. (skin)  | SRR033710(GSM497055) GCB DLBCL (GCB385). (B cell)  | SRR033724(GSM497069) L428 cell line (L428). (B cell)  | SRR330904(SRX091742) tissue: normal skindisease state: normal. (skin)  | SRR039617(GSM531980) HBV(+) Adjacent Tissue Sample 1. (liver)  | SRR330884(SRX091722) tissue: skin psoriatic uninvolveddisease stat. (skin)  | SRR060169(GSM565979) 5-8F_cytoplasm. (cell line)  | SRR390724(GSM850203) small rna immunoprecipitated. (cell line)  | SRR039621(GSM531984) HBV(+) HCC Tissue Sample 2. (liver)  | SRR330883(SRX091721) tissue: skin psoriatic uninvolveddisease stat. (skin)  | SRR330913(SRX091751) tissue: normal skindisease state: normal. (skin)  | SRR039192(GSM494811) K562 cell line is derived from a CML patient . (cell line)  | SRR039612(GSM531975) Human Normal Liver Tissue Sample 2. (liver)  | SRR444052(SRX128900) Sample 12cDNABarcode: AF-PP-340: ACG CTC TTC . (skin)  | SRR040032(GSM532917) G603N. (cervix)  | SRR060168(GSM565978) 5-8F_nucleus. (cell line)  | SRR039622(GSM531985) HCV(+) Adjacent Tissue Sample. (liver)  | SRR040024(GSM532909) G613N. (cervix)  | SRR033729(GSM497074) splenic MZL (Splenic414). (B cell)  | SRR039611(GSM531974) Human Normal Liver Tissue Sample 1. (liver)  | SRR330880(SRX091718) tissue: skin psoriatic involveddisease state:. (skin)  | SRR094129(GSM651905) small RNA(18-35nt)small RNA deep sequencing o. (uterus)  | SRR040010(GSM532895) G529N. (cervix)  | SRR207111(GSM721073) Whole cell RNA. (cell line)  | SRR330907(SRX091745) tissue: normal skindisease state: normal. (skin)  | SRR039190(GSM494809) PBMCs were isolated by ficoll gradient from t. (blood)  | SRR040028(GSM532913) G026N. (cervix)  | SRR033717(GSM497062) Mentle Cell Lymphoma (MCL112). (B cell)  | SRR040016(GSM532901) G645N. (cervix)  | SRR039618(GSM531981) HBV(+) Side Tissue Sample 1. (liver)  | SRR330903(SRX091741) tissue: skin psoriatic uninvolveddisease stat. (skin)  | SRR330885(SRX091723) tissue: skin psoriatic uninvolveddisease stat. (skin)  | SRR094131(GSM651907) small RNA(18-35nt)small RNA deep sequencing o. (uterus)  | DRR000558(DRX000316) "THP-1 whole cell RNA, after 3 day treatment . (cell line)  | SRR037876(GSM522374) fibroblasts_cell_culture. (fibroblast)  | SRR189782 | SRR037937(GSM510475) 293cand2. (cell line)  | SRR444067(SRX128915) Sample 24cDNABarcode: AF-PP-340: ACG CTC TTC . (cell line)  | SRR033721(GSM497066) Ly3 cell line (Ly3). (B cell)  | SRR330896(SRX091734) tissue: skin psoriatic uninvolveddisease stat. (skin)  | SRR191583(GSM715693) 97genomic small RNA (size selected RNA from t. (breast)  | SRR040014(GSM532899) G623N. (cervix)  | SRR330861(SRX091699) tissue: skin psoriatic involveddisease state:. (skin)  | SRR330919(SRX091757) tissue: normal skindisease state: normal. (skin)  | SRR038859(GSM458542) MM386. (cell line)  | SRR039193(GSM494812) HL60 cell line is derived from acute promyelo. (cell line)  | SRR040006(GSM532891) G601N. (cervix)  | SRR015448(SRR015448) cytoplasmic small RNAs. (breast)  | SRR330874(SRX091712) tissue: skin psoriatic involveddisease state:. (skin)  | SRR040038(GSM532923) G531N. (cervix)  | GSM450608(GSM450608) miRNA sequencing raw reads from post-mortem s. (brain)  | SRR330858(SRX091696) tissue: skin psoriatic involveddisease state:. (skin)  | SRR330902(SRX091740) tissue: skin psoriatic uninvolveddisease stat. (skin)  | SRR039613(GSM531976) Human Normal Liver Tissue Sample 3. (liver)  | SRR191585(GSM715695) 196genomic small RNA (size selected RNA from . (breast)  | SRR342895(SRX096791) small RNA seq of Left atrial tissue. (heart)  | SRR342897(SRX096793) small RNA seq of Left atrial tissue. (heart)  | SRR207116(GSM721078) Nuclear RNA. (cell line)  | SRR191579(GSM715689) 102genomic small RNA (size selected RNA from . (breast)  | SRR039619(GSM531982) HBV(+) HCC Tissue Sample 1. (liver)  | SRR326281(GSM769511) "Dicer mRNA was knocked down using siDicer, c. (cell line)  | SRR189781(GSM714641) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line)  | 
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ........................................................................................................AAACTGAAGAGTTTGATCAT.............................................................................................................................. | 20 | 164.00 | 0.00 | 13.00 | - | 11.00 | 10.00 | 13.00 | 10.00 | 10.00 | 10.00 | - | 7.00 | 13.00 | - | 1.00 | - | 10.00 | 1.00 | 3.00 | 2.00 | 5.00 | 4.00 | 4.00 | - | - | 4.00 | 2.00 | - | - | 2.00 | 1.00 | 3.00 | - | - | 4.00 | - | 2.00 | 1.00 | - | 3.00 | - | 1.00 | - | 1.00 | - | - | - | 1.00 | - | - | 1.00 | - | - | 2.00 | 1.00 | - | - | - | 1.00 | - | - | - | - | - | 1.00 | - | - | 1.00 | - | 1.00 | - | - | - | 1.00 | - | - | - | - | - | 1.00 | 1.00 | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | |
| ........................................................................................................AAACTGAAGAGTTTGATC................................................................................................................................ | 18 | 126.00 | 0.00 | 2.00 | 11.00 | 3.00 | - | 2.00 | 4.00 | 4.00 | 3.00 | 21.00 | - | 2.00 | 20.00 | 7.00 | 8.00 | - | 1.00 | - | 2.00 | - | - | 2.00 | - | 1.00 | - | - | - | - | 1.00 | 1.00 | - | 4.00 | - | - | 1.00 | - | - | 2.00 | - | 3.00 | 1.00 | - | - | 2.00 | 2.00 | - | - | - | 1.00 | - | - | 2.00 | - | - | 1.00 | - | - | - | 1.00 | - | - | - | 1.00 | - | - | - | - | 1.00 | - | - | - | - | - | - | 1.00 | 1.00 | 1.00 | 1.00 | - | - | 1.00 | - | - | - | - | 1.00 | - | - | - | - | - | 1.00 | 1.00 | - | 1.00 | - | |
| .........................................................................................................AACTGAAGAGTTTGATCAT.............................................................................................................................. | 19 | 0 | 84.00 | 2.00 | 9.00 | - | 9.00 | 8.00 | 8.00 | 2.00 | 2.00 | 4.00 | 1.00 | - | 5.00 | - | 6.00 | 3.00 | 3.00 | - | - | 1.00 | 1.00 | 2.00 | 1.00 | - | 1.00 | - | 3.00 | - | 2.00 | - | 1.00 | - | - | 2.00 | - | - | - | 1.00 | - | - | - | - | - | 1.00 | - | - | 1.00 | - | - | - | 1.00 | - | - | - | - | - | 1.00 | 1.00 | - | - | 1.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | 
| ........................................................................................................AAACTGAAGAGTTTGATCA............................................................................................................................... | 19 | 70.00 | 0.00 | 5.00 | 9.00 | 7.00 | 11.00 | 2.00 | 3.00 | 3.00 | 5.00 | 1.00 | 1.00 | - | - | 2.00 | - | 2.00 | - | 2.00 | 3.00 | 1.00 | - | - | - | - | - | - | - | 3.00 | - | - | 1.00 | - | 2.00 | - | - | - | 1.00 | 1.00 | - | - | 1.00 | - | - | - | - | - | 1.00 | - | 1.00 | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | |
| .........................................................................................................AACTGAAGAGTTTGATCA............................................................................................................................... | 18 | 0 | 45.00 | 2.00 | 5.00 | 12.00 | - | - | - | 6.00 | 6.00 | - | - | - | - | - | - | - | 1.00 | - | - | - | - | 1.00 | - | - | - | 2.00 | 1.00 | 5.00 | - | 1.00 | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | 1.00 | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | 
| ........................................................................................................AAACTGAAGAGTTTGATCCT.............................................................................................................................. | 20 | 31.00 | 0.00 | - | - | 1.00 | - | - | - | - | - | - | 6.00 | 1.00 | - | 3.00 | 5.00 | - | 6.00 | - | - | - | 1.00 | - | 4.00 | 3.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ........................................................................................................AAACTGAAGAGTTTGATCC............................................................................................................................... | 19 | 17.00 | 0.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | 3.00 | - | 1.00 | - | - | - | 2.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | 1.00 | 1.00 | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | 1.00 | 1.00 | - | - | 1.00 | - | - | - | - | - | - | - | - | - | |
| .........................................................................................................AACTGAAGAGTTTGATCCT.............................................................................................................................. | 19 | 0 | 16.00 | 2.00 | - | 1.00 | - | - | - | - | - | - | - | 9.00 | - | - | - | 1.00 | - | 1.00 | 3.00 | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 
| .........................................................................................................AACTGAAGAGTTTGATCT............................................................................................................................... | 18 | 0 | 3.00 | 2.00 | - | - | - | - | - | - | - | 3.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 
| ............................................................................................................TGAAGAGTTTGAACTCTG............................................................................................................................ | 18 | 2.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | 1.00 | - | - | - | - | - | |
| .........................................................................................................AACTGAAGAGTTTGA.................................................................................................................................. | 15 | 0 | 2.00 | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 
| ........................................................................................................AAACTGAAGAGTTTGATTAT.............................................................................................................................. | 20 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .........................................................................................................AACTGAAGAGTTTGATAAT.............................................................................................................................. | 19 | 0 | 1.00 | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 
| ........................................................................................................AAACTGAAGAGTTTGATCG............................................................................................................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ........................................................................................................AAACTGAAGAGTTTGATAA............................................................................................................................... | 19 | 1.00 | 0.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ........................................................................................................AAACTGAAGAGTTTGAGCCT.............................................................................................................................. | 20 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ........................................................................................................AAACTGAAGAGTTTGCTC................................................................................................................................ | 18 | 1.00 | 0.00 | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ........................................................................................................AAACTGAAGAGTTTGAAA................................................................................................................................ | 18 | 1.00 | 0.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .....................AAATGCTAAGTTTTTTT.................................................................................................................................................................................................................... | 17 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | |
| .........................................................................................................AACTGAAGAGTTTGATAA............................................................................................................................... | 18 | 0 | 1.00 | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 
| ........................................................................................................AAACTGAAGAGTTTGACC................................................................................................................................ | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ........................................................................................................AAACTGAAGAGTTTGATGT............................................................................................................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ........................................................................................................AAACTGAAGAGTTTGATAAT.............................................................................................................................. | 20 | 1.00 | 0.00 | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ........................................................................................................................................................................AAGAGCACTCTAATG................................................................... | 15 | 6 | 0.50 | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | 0.17 | - | - | 0.17 | - | - | - | - | - | 0.17 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 
| ........................................................................................................................................................................AAGAGCACTCTAATGAGA................................................................ | 18 | 6 | 0.17 | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.17 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 
| TTTTAAAATAACCCTGAAAAGAAATGCTAAGTTTTTGCCAATGATATTTGGAGATACAAAAAGAGAATCCAGGATAACAACTTGCATAGTTGGCAGAAGTTGTAAAACTGAAGAGTTTGAACTGAATTTTTGATAAGGTTAGGTTTAATTAATAGGTTAGAGGAAGAAAAGAGCACTCTAATGCTTCTTGCTTTTTGCAGAATTCAAGGAGGCATTTCTCCTGTTTGACAGAACAGGTGATTCCAAGATC .............................................................................................................((((...(((((((.((((((....)))))).))))))).......(((((((.............))))))).))))............................................................... ...................................................................................................100........................................................................................190..........................................................  | Size | Perfect hit | Total Norm | Perfect Norm | SRR015360(GSM380325) Plasma B cells (PC137). (B cell)  | SRR207110(GSM721072) Nuclear RNA. (cell line)  | SRR015365(GSM380330) Memory B cells (MM139). (B cell)  | SRR015363(GSM380328) Germinal Center B cell (GC40). (B cell)  | SRR015359(GSM380324) Germinal Center B cell (GC136). (B cell)  | SRR033719(GSM497064) 6hr Activated B cell line (ABC158). (B cell)  | SRR033720(GSM497065) EBV activated B cell line (EBV159). (B cell)  | SRR015361(GSM380326) Memory B cells (MM55). (B cell)  | SRR191581(GSM715691) 104genomic small RNA (size selected RNA from . (breast)  | SRR189785 | SRR015358(GSM380323) NaÌøve B Cell (Naive39). (B cell)  | SRR191617(GSM715727) 104genomic small RNA (size selected RNA from . (breast)  | SRR343336 | SRR343337 | SRR033727(GSM497072) HIV-positive DL (HIV412). (B cell)  | SRR343335 | SRR094130(GSM651906) small RNA(18-35nt)small RNA deep sequencing o. (uterus)  | SRR015364(GSM380329) Plasma B cells (PC44). (B cell)  | SRR033714(GSM497059) Burkitt Lymphoma (BL134). (B cell)  | SRR033723(GSM497068) L1236 cell line (L1236). (B cell)  | SRR033722(GSM497067) KMS12 cell line (KMS12). (B cell)  | SRR343334 | SRR107297(GSM677704) 18-30nt fraction of small RNA. (cell line)  | SRR039623(GSM531986) HCV(+) HCC Tissue Sample. (liver)  | SRR033711(GSM497056) GCB DLBCL (GCB110). (B cell)  | SRR033712(GSM497057) Burkitt Lymphoma (BL510). (B cell)  | SRR094132(GSM651908) small RNA(18-35nt)small RNA deep sequencing o. (uterus)  | SRR033713(GSM497058) Burkitt Lymphoma (BL115). (B cell)  | SRR107296(GSM677703) 18-30nt fraction of small RNA. (cell line)  | SRR033716(GSM497061) Mentle Cell Lymphoma (MCL114). (B cell)  | SRR314796(SRX084354) "Total RNA, fractionated (15-30nt)". (cell line)  | SRR033728(GSM497073) MALT (MALT413). (B cell)  | SRR033730(GSM497075) Lymphoblastic (ALL411). (B cell)  | SRR330905(SRX091743) tissue: normal skindisease state: normal. (skin)  | SRR033710(GSM497055) GCB DLBCL (GCB385). (B cell)  | SRR033724(GSM497069) L428 cell line (L428). (B cell)  | SRR330904(SRX091742) tissue: normal skindisease state: normal. (skin)  | SRR039617(GSM531980) HBV(+) Adjacent Tissue Sample 1. (liver)  | SRR330884(SRX091722) tissue: skin psoriatic uninvolveddisease stat. (skin)  | SRR060169(GSM565979) 5-8F_cytoplasm. (cell line)  | SRR390724(GSM850203) small rna immunoprecipitated. (cell line)  | SRR039621(GSM531984) HBV(+) HCC Tissue Sample 2. (liver)  | SRR330883(SRX091721) tissue: skin psoriatic uninvolveddisease stat. (skin)  | SRR330913(SRX091751) tissue: normal skindisease state: normal. (skin)  | SRR039192(GSM494811) K562 cell line is derived from a CML patient . (cell line)  | SRR039612(GSM531975) Human Normal Liver Tissue Sample 2. (liver)  | SRR444052(SRX128900) Sample 12cDNABarcode: AF-PP-340: ACG CTC TTC . (skin)  | SRR040032(GSM532917) G603N. (cervix)  | SRR060168(GSM565978) 5-8F_nucleus. (cell line)  | SRR039622(GSM531985) HCV(+) Adjacent Tissue Sample. (liver)  | SRR040024(GSM532909) G613N. (cervix)  | SRR033729(GSM497074) splenic MZL (Splenic414). (B cell)  | SRR039611(GSM531974) Human Normal Liver Tissue Sample 1. (liver)  | SRR330880(SRX091718) tissue: skin psoriatic involveddisease state:. (skin)  | SRR094129(GSM651905) small RNA(18-35nt)small RNA deep sequencing o. (uterus)  | SRR040010(GSM532895) G529N. (cervix)  | SRR207111(GSM721073) Whole cell RNA. (cell line)  | SRR330907(SRX091745) tissue: normal skindisease state: normal. (skin)  | SRR039190(GSM494809) PBMCs were isolated by ficoll gradient from t. (blood)  | SRR040028(GSM532913) G026N. (cervix)  | SRR033717(GSM497062) Mentle Cell Lymphoma (MCL112). (B cell)  | SRR040016(GSM532901) G645N. (cervix)  | SRR039618(GSM531981) HBV(+) Side Tissue Sample 1. (liver)  | SRR330903(SRX091741) tissue: skin psoriatic uninvolveddisease stat. (skin)  | SRR330885(SRX091723) tissue: skin psoriatic uninvolveddisease stat. (skin)  | SRR094131(GSM651907) small RNA(18-35nt)small RNA deep sequencing o. (uterus)  | DRR000558(DRX000316) "THP-1 whole cell RNA, after 3 day treatment . (cell line)  | SRR037876(GSM522374) fibroblasts_cell_culture. (fibroblast)  | SRR189782 | SRR037937(GSM510475) 293cand2. (cell line)  | SRR444067(SRX128915) Sample 24cDNABarcode: AF-PP-340: ACG CTC TTC . (cell line)  | SRR033721(GSM497066) Ly3 cell line (Ly3). (B cell)  | SRR330896(SRX091734) tissue: skin psoriatic uninvolveddisease stat. (skin)  | SRR191583(GSM715693) 97genomic small RNA (size selected RNA from t. (breast)  | SRR040014(GSM532899) G623N. (cervix)  | SRR330861(SRX091699) tissue: skin psoriatic involveddisease state:. (skin)  | SRR330919(SRX091757) tissue: normal skindisease state: normal. (skin)  | SRR038859(GSM458542) MM386. (cell line)  | SRR039193(GSM494812) HL60 cell line is derived from acute promyelo. (cell line)  | SRR040006(GSM532891) G601N. (cervix)  | SRR015448(SRR015448) cytoplasmic small RNAs. (breast)  | SRR330874(SRX091712) tissue: skin psoriatic involveddisease state:. (skin)  | SRR040038(GSM532923) G531N. (cervix)  | GSM450608(GSM450608) miRNA sequencing raw reads from post-mortem s. (brain)  | SRR330858(SRX091696) tissue: skin psoriatic involveddisease state:. (skin)  | SRR330902(SRX091740) tissue: skin psoriatic uninvolveddisease stat. (skin)  | SRR039613(GSM531976) Human Normal Liver Tissue Sample 3. (liver)  | SRR191585(GSM715695) 196genomic small RNA (size selected RNA from . (breast)  | SRR342895(SRX096791) small RNA seq of Left atrial tissue. (heart)  | SRR342897(SRX096793) small RNA seq of Left atrial tissue. (heart)  | SRR207116(GSM721078) Nuclear RNA. (cell line)  | SRR191579(GSM715689) 102genomic small RNA (size selected RNA from . (breast)  | SRR039619(GSM531982) HBV(+) HCC Tissue Sample 1. (liver)  | SRR326281(GSM769511) "Dicer mRNA was knocked down using siDicer, c. (cell line)  | SRR189781(GSM714641) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line)  | 
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| .......................................AATGATATTTGGAGAATAA................................................................................................................................................................................................ | 19 | 2.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ............................................................................................................................................................................GCACTCTAATGCTTCTAAAG.......................................................... | 20 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |