| (2) B-CELL | (3) BRAIN | (23) CELL-LINE | (2) CERVIX | (2) FIBROBLAST | (3) HELA | (1) OTHER | (1) RRP40.ip | (17) SKIN | (1) UTERUS | (1) XRN.ip |
| GTGCGGCGTGGCCCATGGATGCACCAGAAAACTGGGGCTCAAGATCTGCGGTAAGTGACAGGACCCACTGGGGCCCGGCTGGGTGGCGCGGCGGGCGGACCTTTGGGGCTTGGGAGACTGGGACGCAAGCGGAGGGGGATCCGGGCTCATGGGTCTGATTTTCTAATGTAATTACAGCCAGGACAGCCAGCGACCACGCTCCCCTACAGGCCCTGACCCTCCTCTGCCCGCCCCAGACCTGGTCCCCAGG ...............................................................((((..((.((((.((((.......))))))))...))..))))............................................................................................................................................... ..............................................................63..............................................111......................................................................................................................................... | Size | Perfect hit | Total Norm | Perfect Norm | SRR207115(GSM721077) XRN1&2 knockdown. (XRN1/XRN2 cell line) | DRR000555(DRX000313) "THP-1 whole cell RNA, no treatment". (cell line) | DRR000558(DRX000316) "THP-1 whole cell RNA, after 3 day treatment . (cell line) | DRR000557(DRX000315) "THP-1 whole cell RNA, after 3 day treatment . (cell line) | DRR000556(DRX000314) "THP-1 whole cell RNA, after 3 day treatment . (cell line) | SRR326280(GSM769510) total cell content of unperturbed cells was s. (cell line) | SRR326282(GSM769512) "Dicer mRNA was knocked down using siDicer, t. (cell line) | SRR363675(GSM830252) cell type: human foreskin fibroblasts (HFF)tr. (fibroblast) | SRR207110(GSM721072) Nuclear RNA. (cell line) | SRR207116(GSM721078) Nuclear RNA. (cell line) | DRR001488(DRX001042) "Hela short nuclear cell fraction, LNA(+)". (hela) | SRR207112(GSM721074) RRP40 knockdown. (RRP40 cell line) | SRR330861(SRX091699) tissue: skin psoriatic involveddisease state:. (skin) | SRR326279(GSM769509) cytoplasmic fraction was isolated using PARIS. (cell line) | SRR107296(GSM677703) 18-30nt fraction of small RNA. (cell line) | DRR000559(DRX000317) "THP-1 whole cell RNA, no treatment". (cell line) | SRR363673(GSM830250) cell type: human foreskin fibroblasts (HFF)tr. (fibroblast) | SRR330878(SRX091716) tissue: skin psoriatic involveddisease state:. (skin) | DRR001482(DRX001036) "Hela long total cell fraction, control". (hela) | SRR330921(SRX091759) tissue: normal skindisease state: normal. (skin) | SRR330880(SRX091718) tissue: skin psoriatic involveddisease state:. (skin) | SRR330879(SRX091717) tissue: skin psoriatic involveddisease state:. (skin) | SRR107297(GSM677704) 18-30nt fraction of small RNA. (cell line) | SRR029128(GSM416757) H520. (cell line) | SRR330868(SRX091706) tissue: skin psoriatic involveddisease state:. (skin) | SRR039637(GSM518474) THP1_total_sRNAs. (cell line) | SRR033711(GSM497056) GCB DLBCL (GCB110). (B cell) | SRR330867(SRX091705) tissue: skin psoriatic involveddisease state:. (skin) | SRR330865(SRX091703) tissue: skin psoriatic involveddisease state:. (skin) | GSM450606(GSM450606) miRNA sequencing raw reads from post-mortem s. (brain) | SRR330873(SRX091711) tissue: skin psoriatic involveddisease state:. (skin) | SRR330883(SRX091721) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR207117(GSM721079) Whole cell RNA. (cell line) | SRR553572(SRX182778) source: Frontal Cortex. (Frontal Cortex) | SRR207111(GSM721073) Whole cell RNA. (cell line) | GSM450604(GSM450604) miRNA sequencing raw reads from post-mortem s. (brain) | SRR330863(SRX091701) tissue: skin psoriatic involveddisease state:. (skin) | GSM532880(GSM532880) G659T. (cervix) | SRR330903(SRX091741) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR094131(GSM651907) small RNA(18-35nt)small RNA deep sequencing o. (uterus) | SRR033724(GSM497069) L428 cell line (L428). (B cell) | SRR330923(SRX091761) tissue: normal skindisease state: normal. (skin) | SRR037937(GSM510475) 293cand2. (cell line) | SRR444048(SRX128896) Sample 8cDNABarcode: AF-PP-333: ACG CTC TTC C. (skin) | SRR444069(SRX128917) Sample 26cDNABarcode: AF-PP-342: ACG CTC TTC . (skin) | SRR189779(GSM714639) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR040039(GSM532924) G531T. (cervix) | SRR039635(GSM518472) THP1_nuc_sRNAs. (cell line) | DRR001489(DRX001043) "Hela short nuclear cell fraction, control". (hela) | GSM450608(GSM450608) miRNA sequencing raw reads from post-mortem s. (brain) | SRR330877(SRX091715) tissue: skin psoriatic involveddisease state:. (skin) | SRR037944(GSM510482) 293DcrTN_cand5. (cell line) | SRR330876(SRX091714) tissue: skin psoriatic involveddisease state:. (skin) | SRR037933(GSM510471) 293cand4_rep2. (cell line) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ..........................................................................................GCGGGCGGACCTTTG................................................................................................................................................. | 15 | 1 | 331.00 | 331.00 | - | 107.00 | 72.00 | 70.00 | 31.00 | 9.00 | 4.00 | 5.00 | - | - | 6.00 | - | 5.00 | 3.00 | 4.00 | 1.00 | 2.00 | 1.00 | 2.00 | 2.00 | 1.00 | 1.00 | 2.00 | - | 1.00 | - | - | - | 1.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..........................................................................................GCGGGCGGACCTTTGA................................................................................................................................................ | 16 | 1 | 114.00 | 331.00 | - | 32.00 | 36.00 | 18.00 | 4.00 | 4.00 | 2.00 | 5.00 | - | - | 2.00 | - | 1.00 | - | - | 2.00 | - | 1.00 | - | - | 1.00 | 1.00 | - | - | 1.00 | - | - | - | - | - | - | 1.00 | - | - | - | - | 1.00 | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | 1.00 | - |
| ..........................................................................................GCGGGCGGACCTTTGAA............................................................................................................................................... | 17 | 1 | 101.00 | 331.00 | 64.00 | 10.00 | 8.00 | 2.00 | 3.00 | - | 1.00 | 1.00 | 3.00 | 2.00 | 1.00 | 2.00 | 1.00 | 1.00 | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - |
| ..........................................................................................GCGGGCGGACCTTTGAAA.............................................................................................................................................. | 18 | 1 | 87.00 | 331.00 | 67.00 | - | - | - | - | 2.00 | 4.00 | - | 7.00 | 3.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | 1.00 | - | - | - |
| ..........................................................................................GCGGGCGGACCTTTGAAAA............................................................................................................................................. | 19 | 1 | 48.00 | 331.00 | 35.00 | - | - | - | - | 1.00 | 1.00 | - | 1.00 | 3.00 | - | - | 1.00 | - | - | - | - | 1.00 | - | - | - | - | - | - | - | 1.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | 1.00 | - | - | - | - | - | - | - | - | 1.00 | - | - |
| ..........................................................................................GCGGGCGGACCTTTGAG............................................................................................................................................... | 17 | 1 | 20.00 | 331.00 | 17.00 | - | - | - | - | 1.00 | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..........................................................................................GCGGGCGGACCTTTGAAG.............................................................................................................................................. | 18 | 1 | 17.00 | 331.00 | 16.00 | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..........................................................................................GCGGGCGGACCTTTGAAGA............................................................................................................................................. | 19 | 1 | 16.00 | 331.00 | 15.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..........................................................................................GCGGGCGGACCTTTGAAAG............................................................................................................................................. | 19 | 1 | 7.00 | 331.00 | 6.00 | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..........................................................................................GCGGGCGGACCTTTGAT............................................................................................................................................... | 17 | 1 | 7.00 | 331.00 | 4.00 | 1.00 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..........................................................................................GCGGGCGGACCTTTGAATA............................................................................................................................................. | 19 | 1 | 7.00 | 331.00 | 7.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..........................................................................................GCGGGCGGACCTTTGGA............................................................................................................................................... | 17 | 1 | 5.00 | 3.00 | - | - | 1.00 | - | - | - | - | - | - | - | - | 4.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..........................................................................................GCGGGCGGACCTTTGGAAG............................................................................................................................................. | 19 | 1 | 5.00 | 3.00 | 5.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..........................................................................................GCGGGCGGACCTTTGAAT.............................................................................................................................................. | 18 | 1 | 4.00 | 331.00 | 4.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..........................................................................................GCGGGCGGACCTTTGTA............................................................................................................................................... | 17 | 1 | 4.00 | 331.00 | 2.00 | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..........................................................................................GCGGGCGGACCTTTGG................................................................................................................................................ | 16 | 1 | 3.00 | 3.00 | - | - | 1.00 | - | 1.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..........................................................................................GCGGGCGGACCTTTGTAA.............................................................................................................................................. | 18 | 1 | 3.00 | 331.00 | 2.00 | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..........................................................................................GCGGGCGGACCTTTGTATA............................................................................................................................................. | 19 | 1 | 2.00 | 331.00 | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..........................................................................................GCGGGCGGACCTTTGGAAA............................................................................................................................................. | 19 | 1 | 2.00 | 3.00 | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..........................................................................................GCGGGCGGACCTTTGATAA............................................................................................................................................. | 19 | 1 | 2.00 | 331.00 | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..........................................................................................GCGGGCGGACCTTTGAGA.............................................................................................................................................. | 18 | 1 | 2.00 | 331.00 | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...................................................................................................CCTTTGGGGCTTGGGAAATT................................................................................................................................... | 20 | 2.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .........................................................................................GGCGGGCGGACCTTTT................................................................................................................................................. | 16 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - |
| ..........................................................................................GCGGGCGGACCTTTGAACA............................................................................................................................................. | 19 | 1 | 1.00 | 331.00 | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...............................................................................TGGGTGGCGCGGCGGGCCG........................................................................................................................................................ | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | |
| ..........................................................................................GCGGGCGGACCTTTGTTG.............................................................................................................................................. | 18 | 1 | 1.00 | 331.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..........................................................................................GCGGGCGGACCTTTGAAC.............................................................................................................................................. | 18 | 1 | 1.00 | 331.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..........................................................................................GCGGGCGGACCTTTGAAGT............................................................................................................................................. | 19 | 1 | 1.00 | 331.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .........................AGAAAACTGGGGCTCAAGATCT........................................................................................................................................................................................................... | 22 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ........TGGCCCATGGATGCACC................................................................................................................................................................................................................................. | 17 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .................................GGGGCTCAAGATCTGCGGC...................................................................................................................................................................................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .........................................................................................GGCGGGCGGACCTTT.................................................................................................................................................. | 15 | 1 | 1.00 | 1.00 | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..........................................................................................GCGGGCGGACCTTTGATA.............................................................................................................................................. | 18 | 1 | 1.00 | 331.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..........................................................................................GCGGGCGGACCTTTGAGGA............................................................................................................................................. | 19 | 1 | 1.00 | 331.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..........................................................................................GCGGGCGGACCTTTGGGCGG............................................................................................................................................ | 20 | 1.00 | 0.00 | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .................................GGGGCTCAAGATCTGCGGCT..................................................................................................................................................................................................... | 20 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | |
| ................................................................................GGGTGGCGCGGCGGGCTCGA...................................................................................................................................................... | 20 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...................................................................CTGGGGCCCGGCTGGGGGCT................................................................................................................................................................... | 20 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | |
| ..........................................................................................GCGGGCGGACCTTTGTAT.............................................................................................................................................. | 18 | 1 | 1.00 | 331.00 | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..........................................................................................GCGGGCGGACCTTTGTGA.............................................................................................................................................. | 18 | 1 | 1.00 | 331.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..........................................................................................GCGGGCGGACCTTTGCG............................................................................................................................................... | 17 | 1 | 1.00 | 331.00 | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..........................................................................................GCGGGCGGACCTTTGGGGGTGG.......................................................................................................................................... | 22 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | |
| ..........................................................................................GCGGGCGGACCTTTGGATA............................................................................................................................................. | 19 | 1 | 1.00 | 3.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..........................................................................................GCGGGCGGACCTTTGTG............................................................................................................................................... | 17 | 1 | 1.00 | 331.00 | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..........................................................................................GCGGGCGGACCTTTGT................................................................................................................................................ | 16 | 1 | 1.00 | 331.00 | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| GTGCGGCGTGGCCCATGGATGCACCAGAAAACTGGGGCTCAAGATCTGCGGTAAGTGACAGGACCCACTGGGGCCCGGCTGGGTGGCGCGGCGGGCGGACCTTTGGGGCTTGGGAGACTGGGACGCAAGCGGAGGGGGATCCGGGCTCATGGGTCTGATTTTCTAATGTAATTACAGCCAGGACAGCCAGCGACCACGCTCCCCTACAGGCCCTGACCCTCCTCTGCCCGCCCCAGACCTGGTCCCCAGG ...............................................................((((..((.((((.((((.......))))))))...))..))))............................................................................................................................................... ..............................................................63..............................................111......................................................................................................................................... | Size | Perfect hit | Total Norm | Perfect Norm | SRR207115(GSM721077) XRN1&2 knockdown. (XRN1/XRN2 cell line) | DRR000555(DRX000313) "THP-1 whole cell RNA, no treatment". (cell line) | DRR000558(DRX000316) "THP-1 whole cell RNA, after 3 day treatment . (cell line) | DRR000557(DRX000315) "THP-1 whole cell RNA, after 3 day treatment . (cell line) | DRR000556(DRX000314) "THP-1 whole cell RNA, after 3 day treatment . (cell line) | SRR326280(GSM769510) total cell content of unperturbed cells was s. (cell line) | SRR326282(GSM769512) "Dicer mRNA was knocked down using siDicer, t. (cell line) | SRR363675(GSM830252) cell type: human foreskin fibroblasts (HFF)tr. (fibroblast) | SRR207110(GSM721072) Nuclear RNA. (cell line) | SRR207116(GSM721078) Nuclear RNA. (cell line) | DRR001488(DRX001042) "Hela short nuclear cell fraction, LNA(+)". (hela) | SRR207112(GSM721074) RRP40 knockdown. (RRP40 cell line) | SRR330861(SRX091699) tissue: skin psoriatic involveddisease state:. (skin) | SRR326279(GSM769509) cytoplasmic fraction was isolated using PARIS. (cell line) | SRR107296(GSM677703) 18-30nt fraction of small RNA. (cell line) | DRR000559(DRX000317) "THP-1 whole cell RNA, no treatment". (cell line) | SRR363673(GSM830250) cell type: human foreskin fibroblasts (HFF)tr. (fibroblast) | SRR330878(SRX091716) tissue: skin psoriatic involveddisease state:. (skin) | DRR001482(DRX001036) "Hela long total cell fraction, control". (hela) | SRR330921(SRX091759) tissue: normal skindisease state: normal. (skin) | SRR330880(SRX091718) tissue: skin psoriatic involveddisease state:. (skin) | SRR330879(SRX091717) tissue: skin psoriatic involveddisease state:. (skin) | SRR107297(GSM677704) 18-30nt fraction of small RNA. (cell line) | SRR029128(GSM416757) H520. (cell line) | SRR330868(SRX091706) tissue: skin psoriatic involveddisease state:. (skin) | SRR039637(GSM518474) THP1_total_sRNAs. (cell line) | SRR033711(GSM497056) GCB DLBCL (GCB110). (B cell) | SRR330867(SRX091705) tissue: skin psoriatic involveddisease state:. (skin) | SRR330865(SRX091703) tissue: skin psoriatic involveddisease state:. (skin) | GSM450606(GSM450606) miRNA sequencing raw reads from post-mortem s. (brain) | SRR330873(SRX091711) tissue: skin psoriatic involveddisease state:. (skin) | SRR330883(SRX091721) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR207117(GSM721079) Whole cell RNA. (cell line) | SRR553572(SRX182778) source: Frontal Cortex. (Frontal Cortex) | SRR207111(GSM721073) Whole cell RNA. (cell line) | GSM450604(GSM450604) miRNA sequencing raw reads from post-mortem s. (brain) | SRR330863(SRX091701) tissue: skin psoriatic involveddisease state:. (skin) | GSM532880(GSM532880) G659T. (cervix) | SRR330903(SRX091741) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR094131(GSM651907) small RNA(18-35nt)small RNA deep sequencing o. (uterus) | SRR033724(GSM497069) L428 cell line (L428). (B cell) | SRR330923(SRX091761) tissue: normal skindisease state: normal. (skin) | SRR037937(GSM510475) 293cand2. (cell line) | SRR444048(SRX128896) Sample 8cDNABarcode: AF-PP-333: ACG CTC TTC C. (skin) | SRR444069(SRX128917) Sample 26cDNABarcode: AF-PP-342: ACG CTC TTC . (skin) | SRR189779(GSM714639) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR040039(GSM532924) G531T. (cervix) | SRR039635(GSM518472) THP1_nuc_sRNAs. (cell line) | DRR001489(DRX001043) "Hela short nuclear cell fraction, control". (hela) | GSM450608(GSM450608) miRNA sequencing raw reads from post-mortem s. (brain) | SRR330877(SRX091715) tissue: skin psoriatic involveddisease state:. (skin) | SRR037944(GSM510482) 293DcrTN_cand5. (cell line) | SRR330876(SRX091714) tissue: skin psoriatic involveddisease state:. (skin) | SRR037933(GSM510471) 293cand4_rep2. (cell line) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| .......................................................................................................................................................................................CGTGGTCGCTGGCTG.................................................... | 15 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - |
| ....................................................................................GGCGCGGCGGGCGGACGGGG.................................................................................................................................................. | 20 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ................................................................................CGCCCGCCGCGCCACCC......................................................................................................................................................... | 17 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |