| (2) AGO1.ip | (1) AGO1.ip OTHER.mut | (2) AGO2.ip | (1) B-CELL | (6) BREAST | (23) CELL-LINE | (1) CERVIX | (3) HEART | (4) HELA | (3) LIVER | (1) OTHER | (10) SKIN |
| GTGGAGAAGACCCGGCGCTTTCTGCTCGAGTGGCTGTCCTTCCTGTGCCGGTGGGCACCGGGGCTGGCTGGGGTGGGCGGCGCGTGGGCCGCGGCTGGTTAGAGCTGACTCAAGCCTGTCCTGCCCGCCCACCCGCCGCAGGTACGTGCCCGTGGGGCTGCTGGAGCGGCTCCCACAGAGGATCAACGAGC .............................................................................(((((.(((((.((.(((.((.(((.(((......)))))).)).)))))))))).)))))..................................................... .............................................................................78.............................................................141................................................ | Size | Perfect hit | Total Norm | Perfect Norm | DRR001486(DRX001040) "Hela long cytoplasmic cell fraction, LNA(+)". (hela) | DRR001485(DRX001039) "Hela long total cell fraction, LNA(+)". (hela) | SRR330896(SRX091734) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR189784 | DRR000561(DRX000319) Isolation of RNA following immunoprecipitatio. (ago2 cell line) | SRR039625(GSM531988) HBV(-) HCV(-) HCC Tissue Sample. (liver) | SRR330890(SRX091728) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR326279(GSM769509) cytoplasmic fraction was isolated using PARIS. (cell line) | SRR343333(GSM796036) KSHV (HHV8). (cell line) | SRR039617(GSM531980) HBV(+) Adjacent Tissue Sample 1. (liver) | SRR189785 | SRR387910(GSM843862) antibody for ip: Ago2. (ago2 cell line) | TAX577589(Rovira) total RNA. (breast) | SRR326282(GSM769512) "Dicer mRNA was knocked down using siDicer, t. (cell line) | SRR342899(SRX096795) small RNA seq of Left atrial tissue. (heart) | DRR001488(DRX001042) "Hela short nuclear cell fraction, LNA(+)". (hela) | SRR037942(GSM510480) 293DroshaTN_cand5. (cell line) | SRR330880(SRX091718) tissue: skin psoriatic involveddisease state:. (skin) | SRR033718(GSM497063) Multiple Myeloma (U266). (B cell) | DRR000555(DRX000313) "THP-1 whole cell RNA, no treatment". (cell line) | TAX577746(Rovira) total RNA. (breast) | SRR330888(SRX091726) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330913(SRX091751) tissue: normal skindisease state: normal. (skin) | SRR553572(SRX182778) source: Frontal Cortex. (Frontal Cortex) | SRR342894(SRX096790) small RNA seq of Right atrial tissue. (heart) | SRR207111(GSM721073) Whole cell RNA. (cell line) | GSM532883(GSM532883) G871N. (cervix) | SRR444041(SRX128889) Sample 2cDNABarcode: AF-PP-334: ACG CTC TTC C. (skin) | SRR207113(GSM721075) IP against AGO 1 & 2. (ago1/2 cell line) | DRR000557(DRX000315) "THP-1 whole cell RNA, after 3 day treatment . (cell line) | DRR000556(DRX000314) "THP-1 whole cell RNA, after 3 day treatment . (cell line) | SRR330910(SRX091748) tissue: normal skindisease state: normal. (skin) | SRR330898(SRX091736) tissue: skin psoriatic uninvolveddisease stat. (skin) | DRR000558(DRX000316) "THP-1 whole cell RNA, after 3 day treatment . (cell line) | SRR039636(GSM518473) THP1_cyto_sRNAs. (cell line) | SRR330884(SRX091722) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR189779(GSM714639) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR015447(SRR015447) nuclear small RNAs. (breast) | SRR207114(GSM721076) "IP against AGO 1 & 2, RRP40 knockdown". (ago1/2 RRP40 cell line) | SRR189780(GSM714640) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR038859(GSM458542) MM386. (cell line) | SRR039193(GSM494812) HL60 cell line is derived from acute promyelo. (cell line) | DRR000559(DRX000317) "THP-1 whole cell RNA, no treatment". (cell line) | DRR001483(DRX001037) "Hela long cytoplasmic cell fraction, control. (hela) | SRR189786 | SRR191443(GSM715553) 108genomic small RNA (size selected RNA from . (breast) | SRR039622(GSM531985) HCV(+) Adjacent Tissue Sample. (liver) | SRR038863(GSM458546) MM603. (cell line) | SRR037944(GSM510482) 293DcrTN_cand5. (cell line) | DRR000560(DRX000318) Isolation of RNA following immunoprecipitatio. (ago1 cell line) | SRR342896(SRX096792) small RNA seq of Right atrial tissue. (heart) | TAX577745(Rovira) total RNA. (breast) | SRR326281(GSM769511) "Dicer mRNA was knocked down using siDicer, c. (cell line) | SRR330859(SRX091697) tissue: skin psoriatic involveddisease state:. (skin) | TAX577743(Rovira) total RNA. (breast) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ....................................................................TGGGGTGGGCGGCGCGTGGGCCGCGGCTGGTTAGAGCTGACTCAAGCCTGTCCTGCCCGCCCACCCGCCG..................................................... | 70 | 1 | 15.00 | 15.00 | 9.00 | 6.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .........................................................................................................................TGCCCGCCCACCCGCCGCAGT................................................. | 21 | 13.00 | 0.00 | - | - | - | - | 1.00 | - | 1.00 | - | - | - | - | 1.00 | - | - | - | - | 1.00 | - | - | - | 1.00 | - | - | 1.00 | - | - | 1.00 | - | 1.00 | - | 1.00 | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | 1.00 | 1.00 | - | - | - | 1.00 | |
| .........................................................................................................................TGCCCGCCCACCCGCCGCAGA................................................. | 21 | 9.00 | 0.00 | - | - | - | - | - | - | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | 1.00 | - | 1.00 | - | - | - | - | - | - | 1.00 | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | 1.00 | 1.00 | - | - | - | - | - | - | - | - | |
| .........................................................................................................................TGCCCGCCCACCCGCCGCAGTAT............................................... | 23 | 3.00 | 0.00 | - | - | 2.00 | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .........................................................................................................................TGCCCGCCCACCCGCCGCAGAA................................................ | 22 | 2.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | |
| ..................................................................................CGTGGGCCGCGGCTGGTTAG......................................................................................... | 20 | 1 | 2.00 | 2.00 | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .........................................................................................................................TGCCCGCCCACCCGCCGCAGTA................................................ | 22 | 2.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | 1.00 | - | - | - | |
| ................................................................................CGCGTGGGCCGCGGCCGCT............................................................................................ | 19 | 2.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .........................................................................................................................TGCCCGCCCACCCGCCGCCGA................................................. | 21 | 1 | 1.00 | 1.00 | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ................................................................................................................................................................CTGGAGCGGCTCCCACAGAGGC......... | 22 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .................................................................................................................................................GTGCCCGTGGGGCTGCTGGAG......................... | 21 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .........................................................................................................................TGCCCGCCCACCCGCCGCAGAGA............................................... | 23 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .........................................................................................................................TGCCCGCCCACCCGCCGC.................................................... | 18 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ........................................................................................................................CTGCCCGCCCACCCGCCGCAG.................................................. | 21 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .............................................................................CGGCGCGTGGGCCGCGT................................................................................................. | 17 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .........................................................................TGGGCGGCGCGTGGGCCGCGGCTGGTTT.......................................................................................... | 28 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ........................................................................................................................CTGCCCGCCCACCCGCCGCAGAA................................................ | 23 | 1 | 1.00 | 1.00 | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .........................................................................................................................TGCCCGCCCACCCGCCGATAG................................................. | 21 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...GAGAAGACCCGGCGCTTT.......................................................................................................................................................................... | 18 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ........................................................................................................................CTGCCCGCCCACCCGCCGCAGA................................................. | 22 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ........................................................................................................................CTGCCCGCCCACCCGCCGCAGT................................................. | 22 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .................................................................................GCGTGGGCCGCGGCTGGAAGA......................................................................................... | 21 | 1.00 | 0.00 | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .........................................................................................................................TGCCCGCCCACCCGCCGCAGCAA............................................... | 23 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | |
| ....................TCTGCTCGAGTGGCTGTCC........................................................................................................................................................ | 19 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .......................GCTCGAGTGGCTGTCCTTC..................................................................................................................................................... | 19 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...................................................................CTGGGGTGGGCGGCGCGTGGGCCGCGGCTGGTTAGAGCTGACTCAAGCCTGTCCTGCCCGCCCACCCGCCG..................................................... | 71 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - |
| ..............................................................................GGCGCGTGGGCCGCGT................................................................................................. | 16 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .........................................................................................................................................................................CTCCCACAGAGGATCAAC.... | 18 | 1 | 1.00 | 1.00 | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ....................................................................................................................................................CCCGTGGGGCTGCTGTTA......................... | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .............................................................................................GCTGGTTAGAGCTGACTCAAGC............................................................................ | 22 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .........................................................................................................................TGCCCGCCCACCCGCCGCAGAT................................................ | 22 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ....................................................................TGGGGTGGGCGGCGCGTGGGCCGCGGCCG.............................................................................................. | 29 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | |
| ............................................................................................................................CCGCCCACCCGCCGCTCC................................................. | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..........................CGAGTGGCTGTCCTTCCTGT................................................................................................................................................. | 20 | 1 | 1.00 | 1.00 | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .........................................................................................................................TGCCCGCCCACCCGCCGCAATT................................................ | 22 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | |
| ..................................................................................CGTGGGCCGCGGCTGGTTAGA........................................................................................ | 21 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - |
| ....................................................................................TGGGCCGCGGCTGGTTAGAG....................................................................................... | 20 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .................................................................................GCGTGGGCCGCGGCTGGTTTGCG....................................................................................... | 23 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| GTGGAGAAGACCCGGCGCTTTCTGCTCGAGTGGCTGTCCTTCCTGTGCCGGTGGGCACCGGGGCTGGCTGGGGTGGGCGGCGCGTGGGCCGCGGCTGGTTAGAGCTGACTCAAGCCTGTCCTGCCCGCCCACCCGCCGCAGGTACGTGCCCGTGGGGCTGCTGGAGCGGCTCCCACAGAGGATCAACGAGC .............................................................................(((((.(((((.((.(((.((.(((.(((......)))))).)).)))))))))).)))))..................................................... .............................................................................78.............................................................141................................................ | Size | Perfect hit | Total Norm | Perfect Norm | DRR001486(DRX001040) "Hela long cytoplasmic cell fraction, LNA(+)". (hela) | DRR001485(DRX001039) "Hela long total cell fraction, LNA(+)". (hela) | SRR330896(SRX091734) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR189784 | DRR000561(DRX000319) Isolation of RNA following immunoprecipitatio. (ago2 cell line) | SRR039625(GSM531988) HBV(-) HCV(-) HCC Tissue Sample. (liver) | SRR330890(SRX091728) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR326279(GSM769509) cytoplasmic fraction was isolated using PARIS. (cell line) | SRR343333(GSM796036) KSHV (HHV8). (cell line) | SRR039617(GSM531980) HBV(+) Adjacent Tissue Sample 1. (liver) | SRR189785 | SRR387910(GSM843862) antibody for ip: Ago2. (ago2 cell line) | TAX577589(Rovira) total RNA. (breast) | SRR326282(GSM769512) "Dicer mRNA was knocked down using siDicer, t. (cell line) | SRR342899(SRX096795) small RNA seq of Left atrial tissue. (heart) | DRR001488(DRX001042) "Hela short nuclear cell fraction, LNA(+)". (hela) | SRR037942(GSM510480) 293DroshaTN_cand5. (cell line) | SRR330880(SRX091718) tissue: skin psoriatic involveddisease state:. (skin) | SRR033718(GSM497063) Multiple Myeloma (U266). (B cell) | DRR000555(DRX000313) "THP-1 whole cell RNA, no treatment". (cell line) | TAX577746(Rovira) total RNA. (breast) | SRR330888(SRX091726) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330913(SRX091751) tissue: normal skindisease state: normal. (skin) | SRR553572(SRX182778) source: Frontal Cortex. (Frontal Cortex) | SRR342894(SRX096790) small RNA seq of Right atrial tissue. (heart) | SRR207111(GSM721073) Whole cell RNA. (cell line) | GSM532883(GSM532883) G871N. (cervix) | SRR444041(SRX128889) Sample 2cDNABarcode: AF-PP-334: ACG CTC TTC C. (skin) | SRR207113(GSM721075) IP against AGO 1 & 2. (ago1/2 cell line) | DRR000557(DRX000315) "THP-1 whole cell RNA, after 3 day treatment . (cell line) | DRR000556(DRX000314) "THP-1 whole cell RNA, after 3 day treatment . (cell line) | SRR330910(SRX091748) tissue: normal skindisease state: normal. (skin) | SRR330898(SRX091736) tissue: skin psoriatic uninvolveddisease stat. (skin) | DRR000558(DRX000316) "THP-1 whole cell RNA, after 3 day treatment . (cell line) | SRR039636(GSM518473) THP1_cyto_sRNAs. (cell line) | SRR330884(SRX091722) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR189779(GSM714639) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR015447(SRR015447) nuclear small RNAs. (breast) | SRR207114(GSM721076) "IP against AGO 1 & 2, RRP40 knockdown". (ago1/2 RRP40 cell line) | SRR189780(GSM714640) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR038859(GSM458542) MM386. (cell line) | SRR039193(GSM494812) HL60 cell line is derived from acute promyelo. (cell line) | DRR000559(DRX000317) "THP-1 whole cell RNA, no treatment". (cell line) | DRR001483(DRX001037) "Hela long cytoplasmic cell fraction, control. (hela) | SRR189786 | SRR191443(GSM715553) 108genomic small RNA (size selected RNA from . (breast) | SRR039622(GSM531985) HCV(+) Adjacent Tissue Sample. (liver) | SRR038863(GSM458546) MM603. (cell line) | SRR037944(GSM510482) 293DcrTN_cand5. (cell line) | DRR000560(DRX000318) Isolation of RNA following immunoprecipitatio. (ago1 cell line) | SRR342896(SRX096792) small RNA seq of Right atrial tissue. (heart) | TAX577745(Rovira) total RNA. (breast) | SRR326281(GSM769511) "Dicer mRNA was knocked down using siDicer, c. (cell line) | SRR330859(SRX091697) tissue: skin psoriatic involveddisease state:. (skin) | TAX577743(Rovira) total RNA. (breast) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ....................................................................TGGGGTGGGCGGCGCCG.......................................................................................................... | 17 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ....................................................................................................AGAGCTGACTCAAGCGGAC........................................................................ | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .................................................................GGCTGGGGTGGGCGGCGC............................................................................................................ | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .............................GTGGCTGTCCTTCCTCGGA............................................................................................................................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |