| (1) AGO1.ip | (1) AGO1.ip OTHER.mut | (2) AGO2.ip | (1) AGO3.ip | (3) B-CELL | (6) BREAST | (20) CELL-LINE | (1) HEART | (2) HELA | (1) LIVER | (4) OTHER | (28) SKIN | (1) TESTES | (1) XRN.ip |
| GAAGGCTCTGGTGGAGAACCTGTGCATGAAGGCCGTCAACCAGTCCATAGGTGAGCCTGGCTGCCTCCAGCTGGGTGGACAGATGGGAGCTGGAGAAGGGGAGAACAGGAAAGAGGGGTTGCCTGCCCTGTTTCCTATATAAGTCTGAGGAAGGTGAGGGGGGGTCGCCATGGGAATGTGCTGTAGGGGGAGGCAGGTGTTGCTCGGAGCGCCAGCCTCTGTTCCTATGCAGGCAGGGCCATCAGGCACCAGAAGGATTTTGCCAGCATAGTGCTCCTGGAC ......................................................................................................................................................................((.((((((((...........((((((.((((((......)))))).)))))))))))))))).................................................... ......................................................................................................................................................................167..............................................................232................................................ | Size | Perfect hit | Total Norm | Perfect Norm | SRR387910(GSM843862) antibody for ip: Ago2. (ago2 cell line) | SRR387909(GSM843861) specific-host: Homo sapienshost cell line: Su. (cell line) | SRR553576(SRX182782) source: Testis. (testes) | SRR207115(GSM721077) XRN1&2 knockdown. (XRN1/XRN2 cell line) | SRR189783 | SRR033728(GSM497073) MALT (MALT413). (B cell) | SRR330866(SRX091704) tissue: skin psoriatic involveddisease state:. (skin) | SRR330916(SRX091754) tissue: normal skindisease state: normal. (skin) | SRR029125(GSM416754) U2OS. (cell line) | SRR330867(SRX091705) tissue: skin psoriatic involveddisease state:. (skin) | SRR330889(SRX091727) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330921(SRX091759) tissue: normal skindisease state: normal. (skin) | SRR033712(GSM497057) Burkitt Lymphoma (BL510). (B cell) | SRR207113(GSM721075) IP against AGO 1 & 2. (ago1/2 cell line) | SRR330863(SRX091701) tissue: skin psoriatic involveddisease state:. (skin) | TAX577740(Rovira) total RNA. (breast) | SRR033725(GSM497070) Unmutated CLL (CLLU626). (B cell) | SRR330870(SRX091708) tissue: skin psoriatic involveddisease state:. (skin) | SRR189786 | SRR330886(SRX091724) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330912(SRX091750) tissue: normal skindisease state: normal. (skin) | SRR207114(GSM721076) "IP against AGO 1 & 2, RRP40 knockdown". (ago1/2 RRP40 cell line) | SRR330868(SRX091706) tissue: skin psoriatic involveddisease state:. (skin) | SRR207116(GSM721078) Nuclear RNA. (cell line) | SRR191614(GSM715724) 92genomic small RNA (size selected RNA from t. (breast) | SRR037942(GSM510480) 293DroshaTN_cand5. (cell line) | SRR330880(SRX091718) tissue: skin psoriatic involveddisease state:. (skin) | SRR189784 | SRR029054(GSM402329) MCF7_smallRNAseq. (cell line) | SRR330908(SRX091746) tissue: normal skindisease state: normal. (skin) | SRR330900(SRX091738) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330914(SRX091752) tissue: normal skindisease state: normal. (skin) | SRR342894(SRX096790) small RNA seq of Right atrial tissue. (heart) | SRR330903(SRX091741) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330891(SRX091729) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330864(SRX091702) tissue: skin psoriatic involveddisease state:. (skin) | GSM416733(GSM416733) HEK293. (cell line) | SRR330923(SRX091761) tissue: normal skindisease state: normal. (skin) | SRR330911(SRX091749) tissue: normal skindisease state: normal. (skin) | SRR037931(GSM510469) 293GFP. (cell line) | SRR189779(GSM714639) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR330917(SRX091755) tissue: normal skindisease state: normal. (skin) | SRR039193(GSM494812) HL60 cell line is derived from acute promyelo. (cell line) | SRR037934(GSM510472) 293cand4_rep3. (cell line) | TAX577744(Rovira) total RNA. (breast) | SRR037944(GSM510482) 293DcrTN_cand5. (cell line) | SRR330876(SRX091714) tissue: skin psoriatic involveddisease state:. (skin) | SRR191615(GSM715725) 94genomic small RNA (size selected RNA from t. (breast) | SRR037933(GSM510471) 293cand4_rep2. (cell line) | SRR037937(GSM510475) 293cand2. (cell line) | SRR039615(GSM531978) Severe Chronic Hepatitis B Liver Tissue. (liver) | GSM1105753INPUT(GSM1105753) small RNA sequencing data. (hela) | SRR330899(SRX091737) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330869(SRX091707) tissue: skin psoriatic involveddisease state:. (skin) | SRR189782 | SRR039635(GSM518472) THP1_nuc_sRNAs. (cell line) | SRR444061(SRX128909) Sample 19cDNABarcode: AF-PP-341: ACG CTC TTC . (skin) | SRR330906(SRX091744) tissue: normal skindisease state: normal. (skin) | SRR191590(GSM715700) 48genomic small RNA (size selected RNA from t. (breast) | SRR330909(SRX091747) tissue: normal skindisease state: normal. (skin) | SRR039192(GSM494811) K562 cell line is derived from a CML patient . (cell line) | TAX577739(Rovira) total RNA. (breast) | SRR330884(SRX091722) tissue: skin psoriatic uninvolveddisease stat. (skin) | GSM1105750AGO3(GSM1105750) small RNA sequencing data. (ago3 hela) | GSM956925Ago2PAZ(GSM956925) "cell line: HEK293 cell linepassages: 15-20ip. (ago2 cell line) | SRR330858(SRX091696) tissue: skin psoriatic involveddisease state:. (skin) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ...................................................................................................................................................................................................................CCAGCCTCTGTTCCTATGCAGT................................................. | 22 | 3 | 29.67 | 3.00 | 9.00 | - | - | 2.00 | - | - | - | - | 3.00 | - | - | 2.00 | - | - | - | 1.00 | 2.00 | - | 2.00 | - | - | - | - | - | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | 1.00 | - | - | - | 1.00 | - | 1.00 | - | 1.00 | 1.00 | - | - | 0.33 | - | - | - | - | - | - | - | - | - | - | - | 0.33 | - | - |
| ...................................................................................................................................................................................................................CCAGCCTCTGTTCCTATGCAGA................................................. | 22 | 3 | 14.33 | 3.00 | 4.00 | 10.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...........................................................................................................................................................................GGGAATGTGCTGTAGGCTTT........................................................................................... | 20 | 7.00 | 0.00 | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | 1.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | - | 1.00 | 1.00 | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ............................................................................................................................................................................GGAATGTGCTGTAGGCTT............................................................................................ | 18 | 6.00 | 0.00 | - | - | - | - | - | - | 1.00 | 1.00 | - | - | - | - | - | - | 1.00 | - | - | 1.00 | - | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ............................................................................................................................................................................GGAATGTGCTGTAGGCTTT........................................................................................... | 19 | 5.00 | 0.00 | - | - | - | - | - | - | - | 2.00 | - | - | 1.00 | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...........................................................................................................................................................................GGGAATGTGCTGTAGGCTT............................................................................................ | 19 | 3.00 | 0.00 | - | - | - | - | - | - | 1.00 | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...................................................................................................................................................................................................................CCAGCCTCTGTTCCTATGTAG.................................................. | 21 | 4 | 3.00 | 0.50 | - | - | - | - | 3.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...................................................................................................................................................................................................................CCAGCCTCTGTTCCTATGCAG.................................................. | 21 | 3 | 3.00 | 3.00 | 0.67 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.33 | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.67 | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...................................................................................................................................................................................................................CCAGCCTCTGTTCCTATGCAGAT................................................ | 23 | 3 | 2.00 | 3.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..........................................................................................................................................................................TGGGAATGTGCTGTAGGCTTT........................................................................................... | 21 | 2.00 | 0.00 | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...................................................................................................................................................................................................................CCAGCCTCTGTTCCTATGCAGTTT............................................... | 24 | 3 | 2.00 | 3.00 | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ........................................................................................................................................ATATAAGTCTGAGGAAGGTGAG............................................................................................................................ | 22 | 1 | 1.00 | 1.00 | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .....................................................................................................................................CCTATATAAGTCTGAGGAAGGTGAG............................................................................................................................ | 25 | 1 | 1.00 | 1.00 | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..........................................................................................................................................................................TGGGAATGTGCTGTAGGC.............................................................................................. | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .........................................................................................................................................TATAAGTCTGAGGAAGGTGAG............................................................................................................................ | 21 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ........TGGTGGAGAACCTGTGCATGAAGGCC........................................................................................................................................................................................................................................................ | 26 | 3 | 1.00 | 1.00 | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ........................................................................................................................................ATATAAGTCTGAGGAAGGTGA............................................................................................................................. | 21 | 1 | 1.00 | 1.00 | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .......................................................................................................................................................................................................................................................ACCAGAAGGATTTTGCCAGCATAGTGCTCCAA... | 32 | 1.00 | 0.00 | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .................................................................................................................................................................................GTGCTGTAGGGGGAGGCAGGTGTTG................................................................................ | 25 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...........................................................................................................................................................................GGGAATGTGCTGTAGGCTA............................................................................................ | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..........................................................................................................................................................................TGGGAATGTGCTGTAGGCTT............................................................................................ | 20 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..........................TGAAGGCCGTCAACCAGTCCATAGGC...................................................................................................................................................................................................................................... | 26 | 1.00 | 0.00 | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ................................................................................................................................................................................TGTGCTGTAGGGGGAGGCAGGT.................................................................................... | 22 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .........................................................................................................................................................................................GGGGGAGGCAGGTGTTCTTT............................................................................. | 20 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...........................................................................................................................................................................GGGAATGTGCTGTAGGCTTA........................................................................................... | 20 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .......................................................................................................................................TATATAAGTCTGAGGAAG................................................................................................................................. | 18 | 4 | 0.75 | 0.75 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.75 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...........................GAAGGCCGTCAACCAGTCCATAG........................................................................................................................................................................................................................................ | 23 | 3 | 0.67 | 0.67 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.67 | - | - | - | - | - | - | - | - | - | - | - | - |
| ....................................................................................................................................................................TCGCCATGGGAATGTGCTGTAGG............................................................................................... | 23 | 2 | 0.50 | 0.50 | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...................................................................................................................................................................................................................CCAGCCTCTGTTCCTATG..................................................... | 18 | 4 | 0.50 | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.50 | - | - | - | - | - | - | - | - | - | - | - |
| ..............................................ATAGGTGAGCCTGGCTGCCT........................................................................................................................................................................................................................ | 20 | 3 | 0.33 | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.33 | - | - | - | - | - | - | - | - | - |
| ..........................................GTCCATAGGTGAGCCT................................................................................................................................................................................................................................ | 16 | 3 | 0.33 | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.33 | - | - | - | - | - | - | - | - |
| .................................................................................................................................................................................................................................................TCAGGCACCAGAAGGATTTT..................... | 20 | 3 | 0.33 | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.33 | - | - | - | - | - |
| ........TGGTGGAGAACCTGTGCATGAAGGCCGT...................................................................................................................................................................................................................................................... | 28 | 3 | 0.33 | 0.33 | - | - | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ........TGGTGGAGAACCTGTGCATGAAGGCCGTC..................................................................................................................................................................................................................................................... | 29 | 3 | 0.33 | 0.33 | - | - | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...................................................................................................................................................................................................................CCAGCCTCTGTTCCTATGCA................................................... | 20 | 3 | 0.33 | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.33 | - | - | - | - | - | - | - |
| .....................................................................................................................................CCTATATAAGTCTGAGGAA.................................................................................................................................. | 19 | 3 | 0.33 | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.33 | - |
| ...............GAACCTGTGCATGAAGGCCGTC..................................................................................................................................................................................................................................................... | 22 | 3 | 0.33 | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...........TGGAGAACCTGTGCATGAAGGCCGTC..................................................................................................................................................................................................................................................... | 26 | 3 | 0.33 | 0.33 | - | - | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ........................................................................................................................................................................................................................................................CCAGAAGGATTTTGCCA................. | 17 | 3 | 0.33 | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ......TCTGGTGGAGAACCTGTGCATGAAGGCCGTC..................................................................................................................................................................................................................................................... | 31 | 3 | 0.33 | 0.33 | - | - | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ......................................................................................GAGCTGGAGAAGGGGAGA.................................................................................................................................................................................. | 18 | 5 | 0.20 | 0.20 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.20 |
| GAAGGCTCTGGTGGAGAACCTGTGCATGAAGGCCGTCAACCAGTCCATAGGTGAGCCTGGCTGCCTCCAGCTGGGTGGACAGATGGGAGCTGGAGAAGGGGAGAACAGGAAAGAGGGGTTGCCTGCCCTGTTTCCTATATAAGTCTGAGGAAGGTGAGGGGGGGTCGCCATGGGAATGTGCTGTAGGGGGAGGCAGGTGTTGCTCGGAGCGCCAGCCTCTGTTCCTATGCAGGCAGGGCCATCAGGCACCAGAAGGATTTTGCCAGCATAGTGCTCCTGGAC ......................................................................................................................................................................((.((((((((...........((((((.((((((......)))))).)))))))))))))))).................................................... ......................................................................................................................................................................167..............................................................232................................................ | Size | Perfect hit | Total Norm | Perfect Norm | SRR387910(GSM843862) antibody for ip: Ago2. (ago2 cell line) | SRR387909(GSM843861) specific-host: Homo sapienshost cell line: Su. (cell line) | SRR553576(SRX182782) source: Testis. (testes) | SRR207115(GSM721077) XRN1&2 knockdown. (XRN1/XRN2 cell line) | SRR189783 | SRR033728(GSM497073) MALT (MALT413). (B cell) | SRR330866(SRX091704) tissue: skin psoriatic involveddisease state:. (skin) | SRR330916(SRX091754) tissue: normal skindisease state: normal. (skin) | SRR029125(GSM416754) U2OS. (cell line) | SRR330867(SRX091705) tissue: skin psoriatic involveddisease state:. (skin) | SRR330889(SRX091727) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330921(SRX091759) tissue: normal skindisease state: normal. (skin) | SRR033712(GSM497057) Burkitt Lymphoma (BL510). (B cell) | SRR207113(GSM721075) IP against AGO 1 & 2. (ago1/2 cell line) | SRR330863(SRX091701) tissue: skin psoriatic involveddisease state:. (skin) | TAX577740(Rovira) total RNA. (breast) | SRR033725(GSM497070) Unmutated CLL (CLLU626). (B cell) | SRR330870(SRX091708) tissue: skin psoriatic involveddisease state:. (skin) | SRR189786 | SRR330886(SRX091724) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330912(SRX091750) tissue: normal skindisease state: normal. (skin) | SRR207114(GSM721076) "IP against AGO 1 & 2, RRP40 knockdown". (ago1/2 RRP40 cell line) | SRR330868(SRX091706) tissue: skin psoriatic involveddisease state:. (skin) | SRR207116(GSM721078) Nuclear RNA. (cell line) | SRR191614(GSM715724) 92genomic small RNA (size selected RNA from t. (breast) | SRR037942(GSM510480) 293DroshaTN_cand5. (cell line) | SRR330880(SRX091718) tissue: skin psoriatic involveddisease state:. (skin) | SRR189784 | SRR029054(GSM402329) MCF7_smallRNAseq. (cell line) | SRR330908(SRX091746) tissue: normal skindisease state: normal. (skin) | SRR330900(SRX091738) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330914(SRX091752) tissue: normal skindisease state: normal. (skin) | SRR342894(SRX096790) small RNA seq of Right atrial tissue. (heart) | SRR330903(SRX091741) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330891(SRX091729) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330864(SRX091702) tissue: skin psoriatic involveddisease state:. (skin) | GSM416733(GSM416733) HEK293. (cell line) | SRR330923(SRX091761) tissue: normal skindisease state: normal. (skin) | SRR330911(SRX091749) tissue: normal skindisease state: normal. (skin) | SRR037931(GSM510469) 293GFP. (cell line) | SRR189779(GSM714639) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR330917(SRX091755) tissue: normal skindisease state: normal. (skin) | SRR039193(GSM494812) HL60 cell line is derived from acute promyelo. (cell line) | SRR037934(GSM510472) 293cand4_rep3. (cell line) | TAX577744(Rovira) total RNA. (breast) | SRR037944(GSM510482) 293DcrTN_cand5. (cell line) | SRR330876(SRX091714) tissue: skin psoriatic involveddisease state:. (skin) | SRR191615(GSM715725) 94genomic small RNA (size selected RNA from t. (breast) | SRR037933(GSM510471) 293cand4_rep2. (cell line) | SRR037937(GSM510475) 293cand2. (cell line) | SRR039615(GSM531978) Severe Chronic Hepatitis B Liver Tissue. (liver) | GSM1105753INPUT(GSM1105753) small RNA sequencing data. (hela) | SRR330899(SRX091737) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330869(SRX091707) tissue: skin psoriatic involveddisease state:. (skin) | SRR189782 | SRR039635(GSM518472) THP1_nuc_sRNAs. (cell line) | SRR444061(SRX128909) Sample 19cDNABarcode: AF-PP-341: ACG CTC TTC . (skin) | SRR330906(SRX091744) tissue: normal skindisease state: normal. (skin) | SRR191590(GSM715700) 48genomic small RNA (size selected RNA from t. (breast) | SRR330909(SRX091747) tissue: normal skindisease state: normal. (skin) | SRR039192(GSM494811) K562 cell line is derived from a CML patient . (cell line) | TAX577739(Rovira) total RNA. (breast) | SRR330884(SRX091722) tissue: skin psoriatic uninvolveddisease stat. (skin) | GSM1105750AGO3(GSM1105750) small RNA sequencing data. (ago3 hela) | GSM956925Ago2PAZ(GSM956925) "cell line: HEK293 cell linepassages: 15-20ip. (ago2 cell line) | SRR330858(SRX091696) tissue: skin psoriatic involveddisease state:. (skin) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ................................................................................................................................................................................................................AGGAACAGAGGCTGGCGC........................................................ | 18 | 2 | 4.50 | 4.50 | - | - | - | - | - | 3.00 | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.50 | - | - | - | - | - | - | - | - | - | - |
| ........................................................................................................................................................GGTGAGGGGGGGTCGCCAC............................................................................................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...............................................................................................................................................................GGGGGTCGCCATGGGAATGTGCTGTAGGGGGA........................................................................................... | 32 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ........................................................................................................................................................................................AGGGGGAGGCAGGTGCGCC............................................................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .......................................................................................................................................................................CCATGGGAATGTGCTAA.................................................................................................. | 17 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .................................................................................................................................................................................................................CGCCAGCCTCTGTTCCTG....................................................... | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ....................................................................................GGGAGCTGGAGAAGGGTT.................................................................................................................................................................................... | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .................................................................................................................................................................................GTGCTGTAGGGGGAGGTTAG..................................................................................... | 20 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..........................CCTATGGACTGGTTGACGGCCTTCA....................................................................................................................................................................................................................................... | 25 | 3 | 0.67 | 0.67 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.67 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...............................TATGGACTGGTTGACGGC......................................................................................................................................................................................................................................... | 18 | 3 | 0.67 | 0.67 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.33 | - | - | 0.33 | - | - | - |
| ................................ATGGACTGGTTGACGG.......................................................................................................................................................................................................................................... | 16 | 3 | 0.33 | 0.33 | - | - | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ................TGGACTGGTTGACGGCCTTCATGCACAGGTT........................................................................................................................................................................................................................................... | 31 | 3 | 0.33 | 0.33 | - | - | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .....................TGGACTGGTTGACGGCCTTCATGCAC........................................................................................................................................................................................................................................... | 26 | 3 | 0.33 | 0.33 | - | - | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .......................CACCTATGGACTGGTTGACGGCCTTCATGC..................................................................................................................................................................................................................................... | 30 | 3 | 0.33 | 0.33 | - | - | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...............................CACCTATGGACTGGTTGACGGC..................................................................................................................................................................................................................................... | 22 | 3 | 0.33 | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.33 | - | - | - | - |