| (5)  AGO2.ip  | (2)  B-CELL  | (9)  BREAST  | (23)  CELL-LINE  | (6)  CERVIX  | (1)  FIBROBLAST  | (2)  HEART  | (1)  OTHER  | (32)  SKIN  | 
| TGGGCTCAGCTGAGCCTCAGGGCTGGAATGGGTGTAGGCCAGGCCACTGGGTCAGTGGTGACTGTTGGCGGGGAGAGCAGGGGGAGCCGTGTGCAGGGCGGGGGCTTTGCTGGCTGACCAGGCCGGAGGACCGTGAGCCACCTGCACGCCCTTGGGCCGGAGCCAAGCAGAGTGACGCAGCGGGCTAGGAGGCAGGGAACGCCCTTCCACCTGACTGTGGCCTGAGGGTGCCTTCCCTGGGGCCCAGCCG ............................................................................(((.((....)).)))((...(((...((((((((((((..((.((((.((((..((((((....)).)))).)))).))))))))))).)))))))..))).))..................................................................... ............................................................................77..............................................................................................................189...........................................................  | Size | Perfect hit | Total Norm | Perfect Norm | SRR444048(SRX128896) Sample 8cDNABarcode: AF-PP-333: ACG CTC TTC C. (skin)  | SRR444061(SRX128909) Sample 19cDNABarcode: AF-PP-341: ACG CTC TTC . (skin)  | GSM956925Ago2(GSM956925) "cell line: HEK293 cell linepassages: 15-20ip. (ago2 cell line)  | SRR330895(SRX091733) tissue: skin psoriatic uninvolveddisease stat. (skin)  | SRR444049(SRX128897) Sample 9cDNABarcode: AF-PP-334: ACG CTC TTC C. (skin)  | GSM956925Ago2PAZ(GSM956925) "cell line: HEK293 cell linepassages: 15-20ip. (ago2 cell line)  | SRR040028(GSM532913) G026N. (cervix)  | SRR330874(SRX091712) tissue: skin psoriatic involveddisease state:. (skin)  | GSM956925Ago2D5(GSM956925) "cell line: HEK293 cell linepassages: 15-20ip. (ago2 cell line)  | TAX577741(Rovira) total RNA. (breast)  | SRR037940(GSM510478) 293cand5_rep2. (cell line)  | GSM956925AGO2Paz8(GSM956925) "cell line: HEK293 cell linepassages: 15-20ip. (ago2 cell line)  | SRR330894(SRX091732) tissue: skin psoriatic uninvolveddisease stat. (skin)  | GSM956925Paz8D5(GSM956925) "cell line: HEK293 cell linepassages: 15-20ip. (cell line)  | TAX577745(Rovira) total RNA. (breast)  | SRR330905(SRX091743) tissue: normal skindisease state: normal. (skin)  | SRR444045(SRX128893) Sample 6cDNABarcode: AF-PP-341: ACG CTC TTC C. (skin)  | SRR444058(SRX128906) Sample 16cDNABarcode: AF-PP-335: ACG CTC TTC . (skin)  | SRR444059(SRX128907) Sample 17cDNABarcode: AF-PP-339: ACG CTC TTC . (skin)  | SRR330903(SRX091741) tissue: skin psoriatic uninvolveddisease stat. (skin)  | GSM956925PazD5(GSM956925) "cell line: HEK293 cell linepassages: 15-20ip. (cell line)  | SRR189780(GSM714640) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line)  | SRR444057(SRX128905) Sample 15cDNABarcode: AF-PP-334: ACG CTC TTC . (skin)  | TAX577742(Rovira) total RNA. (breast)  | TAX577579(Rovira) total RNA. (breast)  | SRR342898(SRX096794) small RNA seq of Right atrial tissue. (heart)  | RoviraIPAgo2(Rovira) total RNA. (ago2 breast)  | SRR330921(SRX091759) tissue: normal skindisease state: normal. (skin)  | SRR033712(GSM497057) Burkitt Lymphoma (BL510). (B cell)  | SRR330865(SRX091703) tissue: skin psoriatic involveddisease state:. (skin)  | SRR330880(SRX091718) tissue: skin psoriatic involveddisease state:. (skin)  | SRR040018(GSM532903) G701N. (cervix)  | SRR037936(GSM510474) 293cand1. (cell line)  | SRR330873(SRX091711) tissue: skin psoriatic involveddisease state:. (skin)  | SRR330883(SRX091721) tissue: skin psoriatic uninvolveddisease stat. (skin)  | SRR330879(SRX091717) tissue: skin psoriatic involveddisease state:. (skin)  | DRR000555(DRX000313) "THP-1 whole cell RNA, no treatment". (cell line)  | SRR189775(GSM714635) cell line: HEK293clip variant: CLIPenzymatic . (cell line)  | SRR037935(GSM510473) 293cand3. (cell line)  | SRR207111(GSM721073) Whole cell RNA. (cell line)  | SRR040037(GSM532922) G243T. (cervix)  | GSM532883(GSM532883) G871N. (cervix)  | DRR000557(DRX000315) "THP-1 whole cell RNA, after 3 day treatment . (cell line)  | SRR040016(GSM532901) G645N. (cervix)  | SRR330890(SRX091728) tissue: skin psoriatic uninvolveddisease stat. (skin)  | SRR330898(SRX091736) tissue: skin psoriatic uninvolveddisease stat. (skin)  | SRR326279(GSM769509) cytoplasmic fraction was isolated using PARIS. (cell line)  | SRR553573(SRX182779) source: Cerebellum. (Cerebellum)  | SRR033724(GSM497069) L428 cell line (L428). (B cell)  | GSM416733(GSM416733) HEK293. (cell line)  | SRR330897(SRX091735) tissue: skin psoriatic uninvolveddisease stat. (skin)  | SRR039192(GSM494811) K562 cell line is derived from a CML patient . (cell line)  | SRR037931(GSM510469) 293GFP. (cell line)  | SRR330887(SRX091725) tissue: skin psoriatic uninvolveddisease stat. (skin)  | TAX577739(Rovira) total RNA. (breast)  | SRR189779(GSM714639) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line)  | GSM956925F181A(GSM956925) "cell line: HEK293 cell linepassages: 15-20ip. (cell line)  | SRR038861(GSM458544) MM466. (cell line)  | SRR330861(SRX091699) tissue: skin psoriatic involveddisease state:. (skin)  | SRR330901(SRX091739) tissue: skin psoriatic uninvolveddisease stat. (skin)  | SRR037941(GSM510479) 293DroshaTN. (cell line)  | SRR444060(SRX128908) Sample 18cDNABarcode: AF-PP-340: ACG CTC TTC . (skin)  | SRR342900(SRX096796) small RNA seq of Right atrial tissue. (heart)  | SRR330870(SRX091708) tissue: skin psoriatic involveddisease state:. (skin)  | SRR038857(GSM458540) D20. (cell line)  | SRR040032(GSM532917) G603N. (cervix)  | SRR330860(SRX091698) tissue: skin psoriatic involveddisease state:. (skin)  | SRR444053(SRX128901) Sample 13cDNABarcode: AF-PP-341: ACG CTC TTC . (skin)  | SRR444054(SRX128902) Sample 14cDNABarcode: AF-PP-342: ACG CTC TTC . (skin)  | SRR363673(GSM830250) cell type: human foreskin fibroblasts (HFF)tr. (fibroblast)  | TAX577453(Rovira) total RNA. (breast)  | SRR330866(SRX091704) tissue: skin psoriatic involveddisease state:. (skin)  | SRR191550(GSM715660) 27genomic small RNA (size selected RNA from t. (breast)  | SRR330859(SRX091697) tissue: skin psoriatic involveddisease state:. (skin)  | TAX577743(Rovira) total RNA. (breast)  | SRR444044(SRX128892) Sample 5cDNABarcode: AF-PP-340: ACG CTC TTC C. (skin)  | 
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| .....................................................................................................................................................................AGCAGAGTGACGCAGCGGAA................................................................. | 20 | 1 | 32.00 | 6.00 | 4.00 | 4.00 | 4.00 | 3.00 | 1.00 | 4.00 | - | - | 2.00 | - | - | 1.00 | - | - | - | - | - | 1.00 | 2.00 | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | 1.00 | 1.00 | - | - | - | - | 1.00 | - | - | - | 
| .....................................................................................................................................................................AGCAGAGTGACGCAGCGGAAGC............................................................... | 22 | 1 | 19.00 | 6.00 | 1.00 | - | 1.00 | 2.00 | - | - | 2.00 | - | - | - | - | - | - | - | 1.00 | - | - | - | - | 1.00 | - | - | - | - | 1.00 | - | - | 1.00 | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | 1.00 | - | - | 1.00 | 1.00 | - | - | - | - | - | - | - | - | 1.00 | - | 1.00 | - | - | - | - | - | 1.00 | - | - | 1.00 | - | 
| .....................................................................................................................................................................AGCAGAGTGACGCAGCGGA.................................................................. | 19 | 1 | 18.00 | 6.00 | 4.00 | 1.00 | - | - | 1.00 | - | 1.00 | - | - | - | 2.00 | 1.00 | - | 2.00 | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | 
| .....................................................................................................................................................................AGCAGAGTGACGCAGCGGAAG................................................................ | 21 | 1 | 15.00 | 6.00 | 1.00 | - | 1.00 | - | - | - | - | 1.00 | 1.00 | 1.00 | - | 1.00 | 1.00 | 1.00 | 1.00 | 2.00 | - | - | - | - | 1.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | 
| .....................................................................................................................................................................AGCAGAGTGACGCAGCG.................................................................... | 17 | 1 | 9.00 | 9.00 | - | - | - | - | - | - | - | 2.00 | - | - | - | - | 1.00 | - | - | - | - | - | - | 1.00 | - | - | - | 1.00 | - | - | - | - | - | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 
| .....................................................................................................................................................................AGCAGAGTGACGCAGCGG................................................................... | 18 | 1 | 6.00 | 6.00 | - | - | - | 1.00 | 1.00 | 1.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 
| .....................................................................................................................................................................AGCAGAGTGACGCAGC..................................................................... | 16 | 1 | 5.00 | 5.00 | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | 1.00 | 
| .......................................................................................................................................................................CAGAGTGACGCAGCGGAAGC............................................................... | 20 | 3.00 | 0.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | |
| ...............................................................................................................GGCTGACCAGGCCGGAGGACCGTGAGCCA.............................................................................................................. | 29 | 1 | 2.00 | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 
| ........................................................................................................................................................................AGAGTGACGCAGCGGA.................................................................. | 16 | 2.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .....................................................................................................................................................................AGCAGAGTGACGCAGCGGATT................................................................ | 21 | 1 | 2.00 | 6.00 | - | - | - | - | - | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 
| .....................................................................................................................................................................AGCAGAGTGACGCAGCGGGGG................................................................ | 21 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 
| .................................................................................GGGAGCCGTGTGCAGTACC...................................................................................................................................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ......................................................................................................................................................................GCAGAGTGACGCAGCGGAA................................................................. | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ....................................................................................................................ACCAGGCCGGAGGACCGTGAGCC............................................................................................................... | 23 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 
| ............................TGGGTGTAGGCCAGGCCACTGGGTCAGTGGTG.............................................................................................................................................................................................. | 32 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 
| ....................................................................................................................ACCAGGCCGGAGGACCGTGAGCCACCCGC......................................................................................................... | 29 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .....................................................................................................................................................................AGCAGAGTGACGCAGCGGAAGA............................................................... | 22 | 1 | 1.00 | 6.00 | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 
| .....................................................................................................................................................................AGCAGAGTGACGCAGCGGTGTC............................................................... | 22 | 1 | 1.00 | 6.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 
| ......................................................................................................................................................................GCAGAGTGACGCAGCGGGCTAGGAG........................................................... | 25 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 
| .....................................................................................................................................................................AGCAGAGTGACGCAGCGGCA................................................................. | 20 | 1 | 1.00 | 6.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 
| ...................................AGGCCAGGCCACTGGGTCAGTGGCGAC............................................................................................................................................................................................ | 27 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...................GGGCTGGAATGGGTGTAGG.................................................................................................................................................................................................................... | 19 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 
| ...................................................................................................................................................................................................................TGACTGTGGCCTGAGGGTGCC.................. | 21 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 
| .....................................................................................................................................................................AGCAGAGTGACGCAGCGGTTGC............................................................... | 22 | 1 | 1.00 | 6.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 
| ................................................................................................................................................................................GCAGCGGGCTAGGAGGC......................................................... | 17 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 
| ........................................................................................................................................................................AGAGTGACGCAGCGGAA................................................................. | 17 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ................TCAGGGCTGGAATGGGTGT....................................................................................................................................................................................................................... | 19 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 
| ................................................................TTGGCGGGGAGAGCAGAA........................................................................................................................................................................ | 18 | 1.00 | 0.00 | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...............CTCAGGGCTGGAATGGGTG........................................................................................................................................................................................................................ | 19 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 
| .....................................................................................................................................................................AGCAGAGTGACGCAGCGGG.................................................................. | 19 | 1 | 1.00 | 1.00 | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 
| ..............................GGTGTAGGCCAGGCCA............................................................................................................................................................................................................ | 16 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 
| .......................................................................................................................................................................CAGAGTGACGCAGCGGAAG................................................................ | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...........................................................................................................................................................................................................................GCCTGAGGGTGCCTTAGAG............ | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .....................................................................................................................................................................AGCAGAGTGACGCAGCGGAAT................................................................ | 21 | 1 | 1.00 | 6.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 
| ............................................CACTGGGTCAGTGGTGACTGTTGGCGGGGAGAGCAG.......................................................................................................................................................................... | 36 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 
| TGGGCTCAGCTGAGCCTCAGGGCTGGAATGGGTGTAGGCCAGGCCACTGGGTCAGTGGTGACTGTTGGCGGGGAGAGCAGGGGGAGCCGTGTGCAGGGCGGGGGCTTTGCTGGCTGACCAGGCCGGAGGACCGTGAGCCACCTGCACGCCCTTGGGCCGGAGCCAAGCAGAGTGACGCAGCGGGCTAGGAGGCAGGGAACGCCCTTCCACCTGACTGTGGCCTGAGGGTGCCTTCCCTGGGGCCCAGCCG ............................................................................(((.((....)).)))((...(((...((((((((((((..((.((((.((((..((((((....)).)))).)))).))))))))))).)))))))..))).))..................................................................... ............................................................................77..............................................................................................................189...........................................................  | Size | Perfect hit | Total Norm | Perfect Norm | SRR444048(SRX128896) Sample 8cDNABarcode: AF-PP-333: ACG CTC TTC C. (skin)  | SRR444061(SRX128909) Sample 19cDNABarcode: AF-PP-341: ACG CTC TTC . (skin)  | GSM956925Ago2(GSM956925) "cell line: HEK293 cell linepassages: 15-20ip. (ago2 cell line)  | SRR330895(SRX091733) tissue: skin psoriatic uninvolveddisease stat. (skin)  | SRR444049(SRX128897) Sample 9cDNABarcode: AF-PP-334: ACG CTC TTC C. (skin)  | GSM956925Ago2PAZ(GSM956925) "cell line: HEK293 cell linepassages: 15-20ip. (ago2 cell line)  | SRR040028(GSM532913) G026N. (cervix)  | SRR330874(SRX091712) tissue: skin psoriatic involveddisease state:. (skin)  | GSM956925Ago2D5(GSM956925) "cell line: HEK293 cell linepassages: 15-20ip. (ago2 cell line)  | TAX577741(Rovira) total RNA. (breast)  | SRR037940(GSM510478) 293cand5_rep2. (cell line)  | GSM956925AGO2Paz8(GSM956925) "cell line: HEK293 cell linepassages: 15-20ip. (ago2 cell line)  | SRR330894(SRX091732) tissue: skin psoriatic uninvolveddisease stat. (skin)  | GSM956925Paz8D5(GSM956925) "cell line: HEK293 cell linepassages: 15-20ip. (cell line)  | TAX577745(Rovira) total RNA. (breast)  | SRR330905(SRX091743) tissue: normal skindisease state: normal. (skin)  | SRR444045(SRX128893) Sample 6cDNABarcode: AF-PP-341: ACG CTC TTC C. (skin)  | SRR444058(SRX128906) Sample 16cDNABarcode: AF-PP-335: ACG CTC TTC . (skin)  | SRR444059(SRX128907) Sample 17cDNABarcode: AF-PP-339: ACG CTC TTC . (skin)  | SRR330903(SRX091741) tissue: skin psoriatic uninvolveddisease stat. (skin)  | GSM956925PazD5(GSM956925) "cell line: HEK293 cell linepassages: 15-20ip. (cell line)  | SRR189780(GSM714640) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line)  | SRR444057(SRX128905) Sample 15cDNABarcode: AF-PP-334: ACG CTC TTC . (skin)  | TAX577742(Rovira) total RNA. (breast)  | TAX577579(Rovira) total RNA. (breast)  | SRR342898(SRX096794) small RNA seq of Right atrial tissue. (heart)  | RoviraIPAgo2(Rovira) total RNA. (ago2 breast)  | SRR330921(SRX091759) tissue: normal skindisease state: normal. (skin)  | SRR033712(GSM497057) Burkitt Lymphoma (BL510). (B cell)  | SRR330865(SRX091703) tissue: skin psoriatic involveddisease state:. (skin)  | SRR330880(SRX091718) tissue: skin psoriatic involveddisease state:. (skin)  | SRR040018(GSM532903) G701N. (cervix)  | SRR037936(GSM510474) 293cand1. (cell line)  | SRR330873(SRX091711) tissue: skin psoriatic involveddisease state:. (skin)  | SRR330883(SRX091721) tissue: skin psoriatic uninvolveddisease stat. (skin)  | SRR330879(SRX091717) tissue: skin psoriatic involveddisease state:. (skin)  | DRR000555(DRX000313) "THP-1 whole cell RNA, no treatment". (cell line)  | SRR189775(GSM714635) cell line: HEK293clip variant: CLIPenzymatic . (cell line)  | SRR037935(GSM510473) 293cand3. (cell line)  | SRR207111(GSM721073) Whole cell RNA. (cell line)  | SRR040037(GSM532922) G243T. (cervix)  | GSM532883(GSM532883) G871N. (cervix)  | DRR000557(DRX000315) "THP-1 whole cell RNA, after 3 day treatment . (cell line)  | SRR040016(GSM532901) G645N. (cervix)  | SRR330890(SRX091728) tissue: skin psoriatic uninvolveddisease stat. (skin)  | SRR330898(SRX091736) tissue: skin psoriatic uninvolveddisease stat. (skin)  | SRR326279(GSM769509) cytoplasmic fraction was isolated using PARIS. (cell line)  | SRR553573(SRX182779) source: Cerebellum. (Cerebellum)  | SRR033724(GSM497069) L428 cell line (L428). (B cell)  | GSM416733(GSM416733) HEK293. (cell line)  | SRR330897(SRX091735) tissue: skin psoriatic uninvolveddisease stat. (skin)  | SRR039192(GSM494811) K562 cell line is derived from a CML patient . (cell line)  | SRR037931(GSM510469) 293GFP. (cell line)  | SRR330887(SRX091725) tissue: skin psoriatic uninvolveddisease stat. (skin)  | TAX577739(Rovira) total RNA. (breast)  | SRR189779(GSM714639) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line)  | GSM956925F181A(GSM956925) "cell line: HEK293 cell linepassages: 15-20ip. (cell line)  | SRR038861(GSM458544) MM466. (cell line)  | SRR330861(SRX091699) tissue: skin psoriatic involveddisease state:. (skin)  | SRR330901(SRX091739) tissue: skin psoriatic uninvolveddisease stat. (skin)  | SRR037941(GSM510479) 293DroshaTN. (cell line)  | SRR444060(SRX128908) Sample 18cDNABarcode: AF-PP-340: ACG CTC TTC . (skin)  | SRR342900(SRX096796) small RNA seq of Right atrial tissue. (heart)  | SRR330870(SRX091708) tissue: skin psoriatic involveddisease state:. (skin)  | SRR038857(GSM458540) D20. (cell line)  | SRR040032(GSM532917) G603N. (cervix)  | SRR330860(SRX091698) tissue: skin psoriatic involveddisease state:. (skin)  | SRR444053(SRX128901) Sample 13cDNABarcode: AF-PP-341: ACG CTC TTC . (skin)  | SRR444054(SRX128902) Sample 14cDNABarcode: AF-PP-342: ACG CTC TTC . (skin)  | SRR363673(GSM830250) cell type: human foreskin fibroblasts (HFF)tr. (fibroblast)  | TAX577453(Rovira) total RNA. (breast)  | SRR330866(SRX091704) tissue: skin psoriatic involveddisease state:. (skin)  | SRR191550(GSM715660) 27genomic small RNA (size selected RNA from t. (breast)  | SRR330859(SRX091697) tissue: skin psoriatic involveddisease state:. (skin)  | TAX577743(Rovira) total RNA. (breast)  | SRR444044(SRX128892) Sample 5cDNABarcode: AF-PP-340: ACG CTC TTC C. (skin)  | 
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ......................................CCAGGCCACTGGGTCTTA.................................................................................................................................................................................................. | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | |
| .........................................................................................................................................................................................................................................GCTGGGCCCCAGGGA.. | 15 | 0 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |