| (1) AGO2.ip | (21) B-CELL | (2) BRAIN | (5) BREAST | (11) CELL-LINE | (1) CERVIX | (2) HEART | (1) LIVER | (2) OTHER | (1) RRP40.ip | (17) SKIN | (3) UTERUS |
| GGCGGCTCCTCAGTCGACCCCAGGACGCGCTGGAGGGTGTTGTGCTCAGTGTAAGTCGGTGTGCCTGGGACCGGGGAGGCGCAGGGAGGGGACCCTGGAGCTGGGCCGGGCTGTGGCCCTTGCTGGCGCTCGTGGTGGCACCCAGGAGCTTTTGGGTCCTGAGATGCGACTGCTTGGACCGTGCTGGGGATAGATAGGCTGCCCCTGAGGTGGGAGGCTTCCCGAGGAGCCGAGTCTGCACCCAGGCATTCCCGCAGCCCCTTCCCCTGAGGCTTCCATGGGTGCACAGTGTCTCCTCCAAACCCCCGTCTTCCCCGGCAGCCCAGCCTGGAAGCACGGGTGCGCGACATCGCCATAGCAACAAGGAACAC .........................................................................................................................................................................................(((((.((...((((((.((((.(((((((((((((....))))))...))).)))))))).......)))))).)))))))........................................................................................................ ..............................................................................................................................................................................175............................................................................................270................................................................................................... | Size | Perfect hit | Total Norm | Perfect Norm | SRR189785 | SRR033712(GSM497057) Burkitt Lymphoma (BL510). (B cell) | SRR189780(GSM714640) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR033714(GSM497059) Burkitt Lymphoma (BL134). (B cell) | SRR033726(GSM497071) Mututated CLL (CLLM633). (B cell) | SRR033719(GSM497064) 6hr Activated B cell line (ABC158). (B cell) | SRR033720(GSM497065) EBV activated B cell line (EBV159). (B cell) | SRR015358(GSM380323) NaÌøve B Cell (Naive39). (B cell) | SRR039619(GSM531982) HBV(+) HCC Tissue Sample 1. (liver) | SRR387910(GSM843862) antibody for ip: Ago2. (ago2 cell line) | SRR189784 | SRR343336 | SRR015362(GSM380327) NaÌøve B Cell (Naive138). (B cell) | SRR189779(GSM714639) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR033713(GSM497058) Burkitt Lymphoma (BL115). (B cell) | SRR107297(GSM677704) 18-30nt fraction of small RNA. (cell line) | SRR342894(SRX096790) small RNA seq of Right atrial tissue. (heart) | SRR033725(GSM497070) Unmutated CLL (CLLU626). (B cell) | SRR015360(GSM380325) Plasma B cells (PC137). (B cell) | SRR343334 | SRR330906(SRX091744) tissue: normal skindisease state: normal. (skin) | SRR207112(GSM721074) RRP40 knockdown. (RRP40 cell line) | SRR444059(SRX128907) Sample 17cDNABarcode: AF-PP-339: ACG CTC TTC . (skin) | SRR191612(GSM715722) 65genomic small RNA (size selected RNA from t. (breast) | SRR094131(GSM651907) small RNA(18-35nt)small RNA deep sequencing o. (uterus) | SRR553573(SRX182779) source: Cerebellum. (Cerebellum) | DRR000558(DRX000316) "THP-1 whole cell RNA, after 3 day treatment . (cell line) | SRR189782 | SRR015364(GSM380329) Plasma B cells (PC44). (B cell) | SRR330897(SRX091735) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330884(SRX091722) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR094132(GSM651908) small RNA(18-35nt)small RNA deep sequencing o. (uterus) | SRR330917(SRX091755) tissue: normal skindisease state: normal. (skin) | SRR040038(GSM532923) G531N. (cervix) | DRR000559(DRX000317) "THP-1 whole cell RNA, no treatment". (cell line) | SRR343335 | SRR033730(GSM497075) Lymphoblastic (ALL411). (B cell) | SRR015361(GSM380326) Memory B cells (MM55). (B cell) | TAX577745(Rovira) total RNA. (breast) | SRR189781(GSM714641) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR015359(GSM380324) Germinal Center B cell (GC136). (B cell) | SRR189783 | SRR330922(SRX091760) tissue: normal skindisease state: normal. (skin) | SRR330885(SRX091723) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR033724(GSM497069) L428 cell line (L428). (B cell) | SRR033728(GSM497073) MALT (MALT413). (B cell) | SRR033723(GSM497068) L1236 cell line (L1236). (B cell) | SRR330863(SRX091701) tissue: skin psoriatic involveddisease state:. (skin) | SRR330895(SRX091733) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330912(SRX091750) tissue: normal skindisease state: normal. (skin) | SRR039191(GSM494810) PBMCs were isolated by ficoll gradient from t. (blood) | SRR330908(SRX091746) tissue: normal skindisease state: normal. (skin) | TAX577588(Rovira) total RNA. (breast) | SRR033722(GSM497067) KMS12 cell line (KMS12). (B cell) | GSM450607(GSM450607) miRNA sequencing raw reads from post-mortem s. (brain) | SRR094130(GSM651906) small RNA(18-35nt)small RNA deep sequencing o. (uterus) | SRR330923(SRX091761) tissue: normal skindisease state: normal. (skin) | SRR330904(SRX091742) tissue: normal skindisease state: normal. (skin) | SRR191629(GSM715739) 5genomic small RNA (size selected RNA from to. (breast) | SRR039192(GSM494811) K562 cell line is derived from a CML patient . (cell line) | SRR033721(GSM497066) Ly3 cell line (Ly3). (B cell) | SRR038858(GSM458541) MEL202. (cell line) | SRR033727(GSM497072) HIV-positive DL (HIV412). (B cell) | SRR330896(SRX091734) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330899(SRX091737) tissue: skin psoriatic uninvolveddisease stat. (skin) | GSM450610(GSM450610) miRNA sequencing raw reads from post-mortem s. (brain) | SRR038859(GSM458542) MM386. (cell line) | SRR330894(SRX091732) tissue: skin psoriatic uninvolveddisease stat. (skin) | TAX577589(Rovira) total RNA. (breast) | SRR342898(SRX096794) small RNA seq of Right atrial tissue. (heart) | SRR330878(SRX091716) tissue: skin psoriatic involveddisease state:. (skin) | SRR033731(GSM497076) h929 Cell line (h929). (B cell) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ...................................................................................................................................................................................CGTGCTGGGGATAGAGCAT............................................................................................................................................................................. | 19 | 3 | 34.33 | 6.33 | 2.67 | 0.33 | - | 3.33 | 3.67 | 3.33 | 3.33 | - | - | 0.33 | 0.33 | 0.33 | 2.00 | - | 2.00 | 0.33 | - | 1.33 | 1.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | 0.67 | - | - | 0.67 | 0.67 | - | - | 0.67 | 0.67 | 0.67 | - | - | - | 0.33 | - | 0.33 | 0.33 | 0.33 | 0.33 | - | 0.33 | 0.33 | - | 0.33 | 0.33 | 0.33 | - | - | 0.33 | 0.33 | - | 0.33 | - | - | 0.33 |
| ...................................................................................................................................................................................CGTGCTGGGGATAGA................................................................................................................................................................................. | 15 | 3 | 6.33 | 6.33 | 0.33 | - | - | - | - | - | - | - | - | 0.33 | - | - | - | - | - | - | 0.33 | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | 0.67 | - | - | - | - | 1.00 | - | - | - | - | - | - | 0.67 | 0.33 | - | - | - | - | - | 0.33 | - | - | - | - | - | - | 0.33 | - | - | - | - | - | - | 0.33 | - | - | - | 0.33 | - | - | 0.33 | - |
| ....................................................................................................................................................................................GTGCTGGGGATAGATGATT............................................................................................................................................................................ | 19 | 4.00 | 0.00 | - | 4.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...................................................................................................................................................................................CGTGCTGGGGATAGATGGTT............................................................................................................................................................................ | 20 | 3.00 | 0.00 | - | - | - | - | - | - | - | 3.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...................................................................................................................................................................................CGTGCTGGGGATAGATCAT............................................................................................................................................................................. | 19 | 3.00 | 0.00 | 1.00 | - | - | - | - | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ....................................................................................................................................................................................GTGCTGGGGATAGATCC.............................................................................................................................................................................. | 17 | 2.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...................................................................................................................................................................................CGTGCTGGGGATAGATCATT............................................................................................................................................................................ | 20 | 2.00 | 0.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .................................................................................................................................................................................ACCGTGCTGGGGATAGATGGT............................................................................................................................................................................. | 21 | 2.00 | 0.00 | - | - | - | - | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...........AGTCGACCCCAGGACGCGCTGG.................................................................................................................................................................................................................................................................................................................................................. | 22 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...................................................................................................................................................................................CGTGCTGGGGATAGATTATT............................................................................................................................................................................ | 20 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ........................................................................................................................................................................................................................................................TTCCCGCAGCCCCTTCTC......................................................................................................... | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..................................................................................................................................................................................CCGTGCTGGGGATAGA................................................................................................................................................................................. | 16 | 1 | 1.00 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...........AGTCGACCCCAGGACGCGCTGGAGGGCG............................................................................................................................................................................................................................................................................................................................................ | 28 | 1.00 | 0.00 | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...........................................................................................ACCCTGGAGCTGGGCCGGATTC.................................................................................................................................................................................................................................................................. | 22 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ................................GAGGGTGTTGTGCTCAGT................................................................................................................................................................................................................................................................................................................................. | 18 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .............................................................................................................................................................................................................TGAGGTGGGAGGCTTTTTA................................................................................................................................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ............................................................................................................................................................................................................................CCCGAGGAGCCGAGTCTGA.................................................................................................................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ................................................................................................GGAGCTGGGCCGGGCGAG................................................................................................................................................................................................................................................................. | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...................................................................................................................................................................................CGTGCTGGGGATAGATTA.............................................................................................................................................................................. | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..................................................................................................................................................................................CCGTGCTGGGGATAGATGG.............................................................................................................................................................................. | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...................................................................................................................................................................................CGTGCTGGGGATAGATC............................................................................................................................................................................... | 17 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...................................................................................................................................................................................CGTGCTGGGGATAGATGG.............................................................................................................................................................................. | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..................................................................................................................................................................................CCGTGCTGGGGATAG.................................................................................................................................................................................. | 15 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...................................................................................................................................................................................CGTGCTGGGGATAGATGA.............................................................................................................................................................................. | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..................................................................................................................................................................................................................................................................................................................................CCAGCCTGGAAGCAC.................................. | 15 | 0 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .....................................................................ACCGGGGAGGCGCAGGGTGCG......................................................................................................................................................................................................................................................................................... | 21 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...........................................................................................................................................................................................................................................................................................................................................AAGCACGGGTGCGCGACATCGCCACAGC............ | 28 | 1.00 | 0.00 | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...................................................................................................................................................................................CGTGCTGGGGATAGACT............................................................................................................................................................................... | 17 | 3 | 0.67 | 6.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...................................................................................................................................................................................CGTGCTGGGGATAGACTAT............................................................................................................................................................................. | 19 | 3 | 0.67 | 6.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.33 | - | - | - | - | - | - | - |
| ..............................................................................................................................................................................................................................................................................................................................................CACGGGTGCGCGACATCGCCATAGCA........... | 26 | 2 | 0.50 | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...................................................................................................................................................................................CGTGCTGGGGATAGAGCC.............................................................................................................................................................................. | 18 | 3 | 0.33 | 6.33 | - | - | - | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...................................................................................................................................................................................CGTGCTGGGGATAGACCT.............................................................................................................................................................................. | 18 | 3 | 0.33 | 6.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.33 | - | - |
| ...................................................................................................................................................................................CGTGCTGGGGATAGAGCTA............................................................................................................................................................................. | 19 | 3 | 0.33 | 6.33 | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...................................................................................................................................................................................CGTGCTGGGGATAGAGCAA............................................................................................................................................................................. | 19 | 3 | 0.33 | 6.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...................................................................................................................................................................................CGTGCTGGGGATAGAGCT.............................................................................................................................................................................. | 18 | 3 | 0.33 | 6.33 | - | - | - | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .........................................................................................................................................................................................GGGGATAGATAGGCTGCCC....................................................................................................................................................................... | 19 | 3 | 0.33 | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - |
| GGCGGCTCCTCAGTCGACCCCAGGACGCGCTGGAGGGTGTTGTGCTCAGTGTAAGTCGGTGTGCCTGGGACCGGGGAGGCGCAGGGAGGGGACCCTGGAGCTGGGCCGGGCTGTGGCCCTTGCTGGCGCTCGTGGTGGCACCCAGGAGCTTTTGGGTCCTGAGATGCGACTGCTTGGACCGTGCTGGGGATAGATAGGCTGCCCCTGAGGTGGGAGGCTTCCCGAGGAGCCGAGTCTGCACCCAGGCATTCCCGCAGCCCCTTCCCCTGAGGCTTCCATGGGTGCACAGTGTCTCCTCCAAACCCCCGTCTTCCCCGGCAGCCCAGCCTGGAAGCACGGGTGCGCGACATCGCCATAGCAACAAGGAACAC .........................................................................................................................................................................................(((((.((...((((((.((((.(((((((((((((....))))))...))).)))))))).......)))))).)))))))........................................................................................................ ..............................................................................................................................................................................175............................................................................................270................................................................................................... | Size | Perfect hit | Total Norm | Perfect Norm | SRR189785 | SRR033712(GSM497057) Burkitt Lymphoma (BL510). (B cell) | SRR189780(GSM714640) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR033714(GSM497059) Burkitt Lymphoma (BL134). (B cell) | SRR033726(GSM497071) Mututated CLL (CLLM633). (B cell) | SRR033719(GSM497064) 6hr Activated B cell line (ABC158). (B cell) | SRR033720(GSM497065) EBV activated B cell line (EBV159). (B cell) | SRR015358(GSM380323) NaÌøve B Cell (Naive39). (B cell) | SRR039619(GSM531982) HBV(+) HCC Tissue Sample 1. (liver) | SRR387910(GSM843862) antibody for ip: Ago2. (ago2 cell line) | SRR189784 | SRR343336 | SRR015362(GSM380327) NaÌøve B Cell (Naive138). (B cell) | SRR189779(GSM714639) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR033713(GSM497058) Burkitt Lymphoma (BL115). (B cell) | SRR107297(GSM677704) 18-30nt fraction of small RNA. (cell line) | SRR342894(SRX096790) small RNA seq of Right atrial tissue. (heart) | SRR033725(GSM497070) Unmutated CLL (CLLU626). (B cell) | SRR015360(GSM380325) Plasma B cells (PC137). (B cell) | SRR343334 | SRR330906(SRX091744) tissue: normal skindisease state: normal. (skin) | SRR207112(GSM721074) RRP40 knockdown. (RRP40 cell line) | SRR444059(SRX128907) Sample 17cDNABarcode: AF-PP-339: ACG CTC TTC . (skin) | SRR191612(GSM715722) 65genomic small RNA (size selected RNA from t. (breast) | SRR094131(GSM651907) small RNA(18-35nt)small RNA deep sequencing o. (uterus) | SRR553573(SRX182779) source: Cerebellum. (Cerebellum) | DRR000558(DRX000316) "THP-1 whole cell RNA, after 3 day treatment . (cell line) | SRR189782 | SRR015364(GSM380329) Plasma B cells (PC44). (B cell) | SRR330897(SRX091735) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330884(SRX091722) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR094132(GSM651908) small RNA(18-35nt)small RNA deep sequencing o. (uterus) | SRR330917(SRX091755) tissue: normal skindisease state: normal. (skin) | SRR040038(GSM532923) G531N. (cervix) | DRR000559(DRX000317) "THP-1 whole cell RNA, no treatment". (cell line) | SRR343335 | SRR033730(GSM497075) Lymphoblastic (ALL411). (B cell) | SRR015361(GSM380326) Memory B cells (MM55). (B cell) | TAX577745(Rovira) total RNA. (breast) | SRR189781(GSM714641) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR015359(GSM380324) Germinal Center B cell (GC136). (B cell) | SRR189783 | SRR330922(SRX091760) tissue: normal skindisease state: normal. (skin) | SRR330885(SRX091723) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR033724(GSM497069) L428 cell line (L428). (B cell) | SRR033728(GSM497073) MALT (MALT413). (B cell) | SRR033723(GSM497068) L1236 cell line (L1236). (B cell) | SRR330863(SRX091701) tissue: skin psoriatic involveddisease state:. (skin) | SRR330895(SRX091733) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330912(SRX091750) tissue: normal skindisease state: normal. (skin) | SRR039191(GSM494810) PBMCs were isolated by ficoll gradient from t. (blood) | SRR330908(SRX091746) tissue: normal skindisease state: normal. (skin) | TAX577588(Rovira) total RNA. (breast) | SRR033722(GSM497067) KMS12 cell line (KMS12). (B cell) | GSM450607(GSM450607) miRNA sequencing raw reads from post-mortem s. (brain) | SRR094130(GSM651906) small RNA(18-35nt)small RNA deep sequencing o. (uterus) | SRR330923(SRX091761) tissue: normal skindisease state: normal. (skin) | SRR330904(SRX091742) tissue: normal skindisease state: normal. (skin) | SRR191629(GSM715739) 5genomic small RNA (size selected RNA from to. (breast) | SRR039192(GSM494811) K562 cell line is derived from a CML patient . (cell line) | SRR033721(GSM497066) Ly3 cell line (Ly3). (B cell) | SRR038858(GSM458541) MEL202. (cell line) | SRR033727(GSM497072) HIV-positive DL (HIV412). (B cell) | SRR330896(SRX091734) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330899(SRX091737) tissue: skin psoriatic uninvolveddisease stat. (skin) | GSM450610(GSM450610) miRNA sequencing raw reads from post-mortem s. (brain) | SRR038859(GSM458542) MM386. (cell line) | SRR330894(SRX091732) tissue: skin psoriatic uninvolveddisease stat. (skin) | TAX577589(Rovira) total RNA. (breast) | SRR342898(SRX096794) small RNA seq of Right atrial tissue. (heart) | SRR330878(SRX091716) tissue: skin psoriatic involveddisease state:. (skin) | SRR033731(GSM497076) h929 Cell line (h929). (B cell) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| .................................................TGTAAGTCGGTGTGCCTTTA.............................................................................................................................................................................................................................................................................................................. | 20 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .................................................TGTAAGTCGGTGTGCCTTTAA............................................................................................................................................................................................................................................................................................................. | 21 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..................................................................................................................................................................................CCGTGCTGGGGATAGATAGGCTGCCCCTCCC.................................................................................................................................................................. | 31 | 1.00 | 0.00 | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .........................................................................................................................................GCACCCAGGAGCTTTTACAT...................................................................................................................................................................................................................... | 20 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .............................CTGGAGGGTGTTGTGGGAC................................................................................................................................................................................................................................................................................................................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..............................................................................................................................................................................................................................................................................................................CCCCCGTCTTCCCCGGCAGCCCAGCCTC......................................... | 28 | 1.00 | 0.00 | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ........................................................................GGGGAGGCGCAGGGAATT......................................................................................................................................................................................................................................................................................... | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..............................................................GCCTGGGACCGGGGACCCA.................................................................................................................................................................................................................................................................................................. | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .........................................................................GGTCCCCTCCCTGCGCCTCCC..................................................................................................................................................................................................................................................................................... | 21 | 2 | 0.50 | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |