ID: uc009rno.10
GENE: Uba7(11)
chr9:107880827-107881006+


(1)
AGO.mut 		(2)
AGO1.ip 		(4)
AGO2.ip 		(1)
AGO3.ip 		(10)
B-CELL 		(10)
BRAIN 		(1)
CELL-LINE 		(12)
EMBRYO 		(1)
ESC 		(3)
FIBROBLAST 		(1)
HEART 		(2)
KIDNEY 		(10)
LIVER 		(2)
LUNG 		(4)
LYMPH 		(15)
OTHER 		(1)
OTHER.mut 		(1)
OVARY 		(1)
PANCREAS 		(1)
PIWI.ip 		(1)
SKIN 		(9)
SPLEEN 		(7)
TESTES 		(3)
THYMUS 		(2)
TOTAL-RNA 		(1)
UTERUS

Sense strand
TGTTTGGAACTGATCTTCAAGAGAAACTGAGTGACCAACACTACCTCTTGGTGAGCTGGGGGATGCTAGTGGGGAATGTCTTTGGGAAATCCACACCACATGCTCTGGCTAAGACTGTTTCTGTCACCAGGTGGGTGCTGGTGCCATTGGCTGTGAGATGCTCAAAGTCTTTGCCCTAGT
.....................................................(((..(((.(((...(((.(((...((.....))..))).)))..))).)))..)))......................................................................
..................................................51.................................................................118............................................................
SizePerfect hitTotal NormPerfect NormSRR346421(SRX098263)
Global profiling of miRNA and the hairpin pre. (mixture)		SRR042471(GSM539863)
mouse TFHS cells [09-002]. (spleen)		SRR042458(GSM539850)
mouse basophil cells [09-002]. (b cell)		SRR345200(SRX097261)
source: size fractionated RNA from mouse hipp. (brain)		SRR391848(GSM852143)
gender: femalegenotype/variation: wild typeti. (embryo)		SRR042457(GSM539849)
mouse mast cells [09-002]. (bone marrow)		SRR042473(GSM539865)
mouse nTreg cells [09-002]. (lymph)		SRR073955(GSM629281)
total RNA. (blood)		mjLiverKO1()
Liver Data. (Zcchc11 liver)		SRR059769(GSM562831)
Treg_Drosha. (spleen)		SRR037905(GSM510441)
brain_rep2. (brain)		SRR042488(GSM539880)
mouse BclXL germinal center B cells [BalbC] [09-002]. (B cell)		mjTestesWT3()
Testes Data. (testes)		SRR040489(GSM533912)
E18.5 Ago2 catalytically inactive LIVER small RNA. (ago2 liver)		SRR042447(GSM539839)
mouse mature B cells (spleen) replicate 2 [09-002]. (b cell)		SRR042469(GSM539861)
mouse Th2 cells [09-002]. (lymph)		GSM510444(GSM510444)
brain_rep5. (brain)		SRR042459(GSM539851)
mouse neutrophil cells replicate 1 [09-002]. (blood)		SRR039153(GSM471930)
HL1_siSrf1_smallRNAseq. (muscle)		mjLiverWT3()
Liver Data. (liver)		SRR346413(SRX098254)
Global profiling of miRNA and the hairpin pre. (Heart)		SRR391851(GSM852146)
gender: femalegenotype/variation: wild typeti. (embryo)		SRR059767(GSM562829)
DN3_Dicer. (thymus)		SRR042451(GSM539843)
mouse B cells activated in vitro with LPS/aIgD-Dextran [09-002]. (b cell)		SRR042448(GSM539840)
mouse B cells activated in vitro with LPS/IL4 replicate 1 [09-002]. (b cell)		SRR042487(GSM539879)
mouse BclXL B activated with LPS/IL4 [BalbC] [09-002]. (spleen)		SRR248526(GSM733814)
cell type: Thy1- spermatogonial stem cellstra. (testes)		SRR042465(GSM539857)
mouse CD4+ T cells (spleen) [09-002]. (spleen)		SRR042468(GSM539860)
mouse Th1 cells [09-002]. (lymph)		SRR059770(GSM562832)
Treg_Dicer. (spleen)		SRR042484(GSM539876)
mouse salivary gland tissue [09-002]. (salivary gland)		SRR525244(SRA056111/SRX170320)
Mus musculus domesticus miRNA sequencing. (ago2 Blood)		SRR037925(GSM510463)
e9p5_rep3. (embryo)		SRR039154(GSM471931)
HL1_siSrf2_smallRNAseq. (muscle)		SRR391850(GSM852145)
gender: femalegenotype/variation: ADAR2-/-/AD. (embryo)		SRR042450(GSM539842)
mouse B cells activated in vitro with LPS/IL4 replicate 3 [09-002]. (b cell)		SRR042466(GSM539858)
mouse CD8+ T cells (spleen) [09-002]. (spleen)		SRR042453(GSM539845)
mouse marginal zone B cells (spleen) [09-002]. (b cell)		SRR042452(GSM539844)
mouse B1 B cells [09-002]. (b cell)		SRR346414(SRX098255)
Global profiling of miRNA and the hairpin pre. (Spleen)		GSM640581(GSM640581)
small RNA in the liver with paternal control. (liver)		SRR059766(GSM562828)
DN3_Drosha. (thymus)		SRR306541(GSM750584)
19-24nt. (ago2 brain)		SRR346419(SRX098260)
Global profiling of miRNA and the hairpin pre. (Lung)		SRR039152(GSM471929)
HL1_siNon_smallRNAseq. (muscle)		SRR391852(GSM852147)
gender: femalegenotype/variation: ADAR2-/-tis. (embryo)		SRR042449(GSM539841)
mouse B cells activated in vitro with LPS/IL4 replicate 2 [09-002]. (b cell)		GSM640579(GSM640579)
small RNA in the liver with paternal Low pro. (liver)		SRR248527(GSM733815)
cell type: spermatogonial stem cell enriched . (testes)		SRR391853(GSM852148)
gender: femalegenotype/variation: ADAR2-/-/AD. (embryo)		SRR042460(GSM539852)
mouse neutrophil cells replicate 2 [09-002]. (blood)		SRR039185(GSM485325)
shLuc.1309;ROSA-rtTA (-dox). (fibroblast)		GSM510454(GSM510454)
newborn_rep10. (total RNA)		SRR042486(GSM539878)
mouse ovaries [09-002]. (ovary)		SRR037936(GSM510474)
293cand1. (cell line)		SRR525240(SRA056111/SRX170316)
Mus musculus domesticus miRNA sequencing. (ago1 Blood)		SRR346417(SRX098258)
Global profiling of miRNA and the hairpin pre. (Brain)		GSM640580(GSM640580)
small RNA in the liver with paternal Low pro. (liver)		SRR042461(GSM539853)
mouse dendritic cells [09-002]. (bone marrow)		SRR042462(GSM539854)
mouse macrophages [09-002]. (bone marrow)		SRR306539(GSM750582)
19-24nt. (ago2 brain)		SRR525241(SRA056111/SRX170317)
Mus musculus domesticus miRNA sequencing. (ago1 Blood)		GSM475279(GSM475279)
Miwi-IP. (miwi testes)		SRR345205(SRX097266)
source: size fractionated RNA from mouse hipp. (brain)		SRR037923(GSM510461)
e9p5_rep1. (embryo)		SRR059765(GSM562827)
DN3_control. (thymus)		SRR042467(GSM539859)
mouse T cells activated in vitro with Concanavalin A [09-002]. (spleen)		SRR391849(GSM852144)
gender: femalegenotype/variation: ADAR2-/-tis. (embryo)		SRR037928(GSM510466)
e7p5_rep2. (embryo)		SRR042480(GSM539872)
mouse kidney tissue [09-002]. (kidney)		SRR346418(SRX098259)
Global profiling of miRNA and the hairpin pre. (Liver)		SRR039610(GSM527274)
small RNA-Seq. (brain)		SRR037901(GSM510437)
testes_rep2. (testes)		SRR042478(GSM539870)
mouse lung tissue [09-002]. (lung)		SRR040488(GSM533911)
E18.5 wild type LIVER small RNA. (liver)		SRR065058(SRR065058)
Tissue-specific Regulation of Mouse MicroRNA . (pancreas)		SRR525243(SRA056111/SRX170319)
Mus musculus domesticus miRNA sequencing. (ago2 Blood)		Ago3IP805(Rui)
Quantitative functions of Argonaute proteins . (ago3 skin)		SRR037924(GSM510462)
e9p5_rep2. (embryo)		SRR032476(GSM485234)
sRNA_delayed_deep_sequencing. (uterus)		SRR037929(GSM510467)
e7p5_rep3. (embryo)		GSM475281(GSM475281)
total RNA. (testes)		SRR279904(GSM689054)
cell type: mouse embryonic stem cellcell line. (ESC)		SRR037904(GSM510440)
brain_rep1. (brain)		GSM510456(GSM510456)
newborn_rep12. (total RNA)		SRR042470(GSM539862)
mouse Th17 cells [09-002]. (lymph)		SRR077864(GSM637801)
18-30 nt small RNAs. (liver)		SRR077866(GSM637803)
18-30 nt small RNAs. (liver)		SRR069809(GSM610965)
small RNA sequencing; sample 1. (testes)		SRR042463(GSM539855)
mouse natural killer cells [09-002]. (spleen)		SRR345197(SRX097258)
source: size fractionated RNA from mouse hipp. (brain)		SRR039184(GSM485324)
shLuc.1309 (+dox). (fibroblast)		SRR391846(GSM852141)
gender: femalegenotype/variation: ADAR2-/-tis. (embryo)		SRR553585(SRX182791)
source: Kidney. (Kidney)		SRR042475(GSM539867)
mouse embryonic fibroblast cells [09-002]. (fibroblast)		SRR042446(GSM539838)
mouse mature B cells (spleen) replicate 1 [09-002]. (b cell)
............................................................................................ACACCACATGCTCTGGCTAAGA..................................................................22170.0070.00-5.005.00-3.003.001.002.00-3.001.00-4.001.001.001.004.00---1.002.00----1.00---1.00---1.00--1.001.002.001.00--1.00---1.002.001.001.00-1.001.00--1.001.00-1.00---1.00--1.00----1.001.001.00---1.00---1.00-1.001.00-1.00-1.001.00---1.00-1.00
............................................................................................ACACCACATGCTCTGGCTAAG...................................................................21136.0036.00-3.002.00--1.002.00---2.001.00--2.001.00-3.00--1.00--2.00--1.001.002.00-1.00-----1.00---1.00--------------1.00---------1.00-1.00------1.001.001.00--1.00-----1.00--------1.00-
............................................................................................ACACCACATGCTCTGGCTAAGT..................................................................22119.0036.00----2.00--3.00-------1.00----1.00-2.00---1.001.00-------1.00-----2.00-1.00------1.00-----------1.00-------1.00----------------1.00--------
............................................................................................ACACCACATGCTCTGGCTAA....................................................................20115.0015.00-1.001.00-1.00----1.00------------1.00--2.00-1.00----2.00---1.00-1.00----------------------1.00--1.00-------------1.00-----------------
..................................................GTGAGCTGGGGGATGCTAGTGGGGAATGTCTTTGGGAAATCCACACCACATGCTCTGGCTAAGACTGTTTCTGTCACCAG..................................................80114.0014.0014.00-----------------------------------------------------------------------------------------------
............................................................................................ACACCACATGCTCTGGCT......................................................................1819.009.00---9.00--------------------------------------------------------------------------------------------
............................................................................................ACACCACATGCTCTGGCTATGT..................................................................2216.001.00-1.00---2.00---1.00----1.00--1.00------------------------------------------------------------------------------
...........................................................................................CACACCACATGCTCTGGCTAAGA..................................................................2315.005.00-1.001.00---1.00----------------1.00-----------------------1.00------------------------------------------------
......................................................................................................CTCTGGCTAAGACTGTTTCTG.........................................................2115.005.00--------5.00---------------------------------------------------------------------------------------
.........................................TACCTCTTGGTGAGCCGGC........................................................................................................................194.000.00------------------------------------------2.00--1.00--------------1.00-----------------------------------
..................................................GTGAGCTGGGGGATGCTAGTGG............................................................................................................2214.004.00-1.001.00---1.00------------------1.00----------------------------------------------------------------------
.............................................................................................CACCACATGCTCTGGCTAAGA..................................................................2114.004.00-------------------3.00--------------------------1.00-------------------------------------------------
...........................................................................................CACACCACATGCTCTGGCTAAG...................................................................2214.004.00------------------------3.00---1.00-------------------------------------------------------------------
............................................................................................ACACCACATGCTCTGGCTAAGAC.................................................................2313.003.00----------1.00----------1.00-----------------------1.00--------------------------------------------------
..................................................GTGAGCTGGGGGATGCTAGTGGGGAATGTCTTTGGGAAATCCACACCACATGCTCTGGCTAAGACTGTTTCTGTCACCAGA.................................................8113.0014.003.00-----------------------------------------------------------------------------------------------
...............................................................TGCTAGTGGGGAATGTCTTTGGG..............................................................................................2312.002.00-------------2.00----------------------------------------------------------------------------------
............................................................................................ACACCACATGCTCTGGCTAAGAT.................................................................2312.0070.00-----------2.00------------------------------------------------------------------------------------
............................................................................................ACACCACATGCTCTGGCTAAT...................................................................2112.0015.00----1.00--------------------------1.00----------------------------------------------------------------
............................................................................................ACACCACATGCTCTGGCTAT....................................................................2012.001.00------1.00------------------------1.00----------------------------------------------------------------
..................................................GTGAGCTGGGGGATGCTAGTGGGGAATGTCTTTGGGAAATCCACACCACATGCTCTGGCTAAGACTGTTTCTGTCACC....................................................7811.001.001.00-----------------------------------------------------------------------------------------------
........................................................TGGGGGATGCTAGTGGGGA.........................................................................................................1911.001.00-------------1.00----------------------------------------------------------------------------------
...........................................................................................CACACCACATGCTCTGGCTAT....................................................................211.000.00-----------------------------1.00------------------------------------------------------------------
..................................................GTGAGCTGGGGGATGCTAGTGA............................................................................................................221.000.00---------------1.00--------------------------------------------------------------------------------
...........................................................................................CACACCACATGCTCTGGCTAA....................................................................2111.001.00--1.00---------------------------------------------------------------------------------------------
............................................................................................ACACCACATGCTCTGGCTGT....................................................................2011.009.00-----------1.00------------------------------------------------------------------------------------
............................................................................................ACACCACATGCTCTGGCTACG...................................................................2111.001.00---------------------------------------------------------------------1.00--------------------------
..................................................GTGAGCTGGGGGATGCTAGTGGT...........................................................................................................2311.004.00-1.00----------------------------------------------------------------------------------------------
............................................................................................ACACCACATGCTCTGGCA......................................................................181.000.00---1.00--------------------------------------------------------------------------------------------
........................................................................................................CTGGCTAAGACTGTTTCTGTCA......................................................2211.001.00-----------------------------------1.00------------------------------------------------------------
.......................................................................GGGAATGTCTTTGGGATG...........................................................................................181.000.00----------------------------------------------------------------------------------1.00-------------
............................................................................................ACACCACATGCTCTGGCTAAGAAA................................................................2411.0070.00-------------------------------------1.00----------------------------------------------------------
............................................................................................ACACCACATGCTCTGGCTAAGAA.................................................................2311.0070.00-----1.00------------------------------------------------------------------------------------------
............................................................................................ACACCACATGCTCTGGCTA.....................................................................1911.001.00----------------------------------1.00-------------------------------------------------------------
............................................................................................ACACCACATGCTCTGGCTAATA..................................................................2211.0015.00----------------------------------------------1.00-------------------------------------------------
..................................................................................................................................................TTGGCTGTGAGATGCCATT...............191.000.00------------------------------------------------------1.00-----------------------------------------
...................................................TGAGCTGGGGGATGCTGTGG.............................................................................................................201.000.00------------------------------------------------------------------------------------------1.00-----
...........................................................................................CACACCACATGCTCTGGCTATGT..................................................................231.000.00-----------------------------1.00------------------------------------------------------------------
..................................................GTGAGCTGGGGGATGCTAGTGGGGA.........................................................................................................2511.001.00---------------------------------------------------1.00--------------------------------------------
............................................................................................ACACCACATGCTCTGGCTGAGA..................................................................2211.009.00----------------------------------------------------------1.00-------------------------------------
..................................................GTGAGCTGGGGGATGCTAGTGGGA..........................................................................................................241.000.00--------------------------------------------------------------------------------1.00---------------
........ACTGATCTTCAAGAGAAACTGAG.....................................................................................................................................................2311.001.00-------1.00----------------------------------------------------------------------------------------
..................................................GTGAGCTGGGGGATGCTAGTAT............................................................................................................221.000.00-1.00----------------------------------------------------------------------------------------------

Antisense strand
TGTTTGGAACTGATCTTCAAGAGAAACTGAGTGACCAACACTACCTCTTGGTGAGCTGGGGGATGCTAGTGGGGAATGTCTTTGGGAAATCCACACCACATGCTCTGGCTAAGACTGTTTCTGTCACCAGGTGGGTGCTGGTGCCATTGGCTGTGAGATGCTCAAAGTCTTTGCCCTAGT
.....................................................(((..(((.(((...(((.(((...((.....))..))).)))..))).)))..)))......................................................................
..................................................51.................................................................118............................................................
SizePerfect hitTotal NormPerfect NormSRR346421(SRX098263)
Global profiling of miRNA and the hairpin pre. (mixture)		SRR042471(GSM539863)
mouse TFHS cells [09-002]. (spleen)		SRR042458(GSM539850)
mouse basophil cells [09-002]. (b cell)		SRR345200(SRX097261)
source: size fractionated RNA from mouse hipp. (brain)		SRR391848(GSM852143)
gender: femalegenotype/variation: wild typeti. (embryo)		SRR042457(GSM539849)
mouse mast cells [09-002]. (bone marrow)		SRR042473(GSM539865)
mouse nTreg cells [09-002]. (lymph)		SRR073955(GSM629281)
total RNA. (blood)		mjLiverKO1()
Liver Data. (Zcchc11 liver)		SRR059769(GSM562831)
Treg_Drosha. (spleen)		SRR037905(GSM510441)
brain_rep2. (brain)		SRR042488(GSM539880)
mouse BclXL germinal center B cells [BalbC] [09-002]. (B cell)		mjTestesWT3()
Testes Data. (testes)		SRR040489(GSM533912)
E18.5 Ago2 catalytically inactive LIVER small RNA. (ago2 liver)		SRR042447(GSM539839)
mouse mature B cells (spleen) replicate 2 [09-002]. (b cell)		SRR042469(GSM539861)
mouse Th2 cells [09-002]. (lymph)		GSM510444(GSM510444)
brain_rep5. (brain)		SRR042459(GSM539851)
mouse neutrophil cells replicate 1 [09-002]. (blood)		SRR039153(GSM471930)
HL1_siSrf1_smallRNAseq. (muscle)		mjLiverWT3()
Liver Data. (liver)		SRR346413(SRX098254)
Global profiling of miRNA and the hairpin pre. (Heart)		SRR391851(GSM852146)
gender: femalegenotype/variation: wild typeti. (embryo)		SRR059767(GSM562829)
DN3_Dicer. (thymus)		SRR042451(GSM539843)
mouse B cells activated in vitro with LPS/aIgD-Dextran [09-002]. (b cell)		SRR042448(GSM539840)
mouse B cells activated in vitro with LPS/IL4 replicate 1 [09-002]. (b cell)		SRR042487(GSM539879)
mouse BclXL B activated with LPS/IL4 [BalbC] [09-002]. (spleen)		SRR248526(GSM733814)
cell type: Thy1- spermatogonial stem cellstra. (testes)		SRR042465(GSM539857)
mouse CD4+ T cells (spleen) [09-002]. (spleen)		SRR042468(GSM539860)
mouse Th1 cells [09-002]. (lymph)		SRR059770(GSM562832)
Treg_Dicer. (spleen)		SRR042484(GSM539876)
mouse salivary gland tissue [09-002]. (salivary gland)		SRR525244(SRA056111/SRX170320)
Mus musculus domesticus miRNA sequencing. (ago2 Blood)		SRR037925(GSM510463)
e9p5_rep3. (embryo)		SRR039154(GSM471931)
HL1_siSrf2_smallRNAseq. (muscle)		SRR391850(GSM852145)
gender: femalegenotype/variation: ADAR2-/-/AD. (embryo)		SRR042450(GSM539842)
mouse B cells activated in vitro with LPS/IL4 replicate 3 [09-002]. (b cell)		SRR042466(GSM539858)
mouse CD8+ T cells (spleen) [09-002]. (spleen)		SRR042453(GSM539845)
mouse marginal zone B cells (spleen) [09-002]. (b cell)		SRR042452(GSM539844)
mouse B1 B cells [09-002]. (b cell)		SRR346414(SRX098255)
Global profiling of miRNA and the hairpin pre. (Spleen)		GSM640581(GSM640581)
small RNA in the liver with paternal control. (liver)		SRR059766(GSM562828)
DN3_Drosha. (thymus)		SRR306541(GSM750584)
19-24nt. (ago2 brain)		SRR346419(SRX098260)
Global profiling of miRNA and the hairpin pre. (Lung)		SRR039152(GSM471929)
HL1_siNon_smallRNAseq. (muscle)		SRR391852(GSM852147)
gender: femalegenotype/variation: ADAR2-/-tis. (embryo)		SRR042449(GSM539841)
mouse B cells activated in vitro with LPS/IL4 replicate 2 [09-002]. (b cell)		GSM640579(GSM640579)
small RNA in the liver with paternal Low pro. (liver)		SRR248527(GSM733815)
cell type: spermatogonial stem cell enriched . (testes)		SRR391853(GSM852148)
gender: femalegenotype/variation: ADAR2-/-/AD. (embryo)		SRR042460(GSM539852)
mouse neutrophil cells replicate 2 [09-002]. (blood)		SRR039185(GSM485325)
shLuc.1309;ROSA-rtTA (-dox). (fibroblast)		GSM510454(GSM510454)
newborn_rep10. (total RNA)		SRR042486(GSM539878)
mouse ovaries [09-002]. (ovary)		SRR037936(GSM510474)
293cand1. (cell line)		SRR525240(SRA056111/SRX170316)
Mus musculus domesticus miRNA sequencing. (ago1 Blood)		SRR346417(SRX098258)
Global profiling of miRNA and the hairpin pre. (Brain)		GSM640580(GSM640580)
small RNA in the liver with paternal Low pro. (liver)		SRR042461(GSM539853)
mouse dendritic cells [09-002]. (bone marrow)		SRR042462(GSM539854)
mouse macrophages [09-002]. (bone marrow)		SRR306539(GSM750582)
19-24nt. (ago2 brain)		SRR525241(SRA056111/SRX170317)
Mus musculus domesticus miRNA sequencing. (ago1 Blood)		GSM475279(GSM475279)
Miwi-IP. (miwi testes)		SRR345205(SRX097266)
source: size fractionated RNA from mouse hipp. (brain)		SRR037923(GSM510461)
e9p5_rep1. (embryo)		SRR059765(GSM562827)
DN3_control. (thymus)		SRR042467(GSM539859)
mouse T cells activated in vitro with Concanavalin A [09-002]. (spleen)		SRR391849(GSM852144)
gender: femalegenotype/variation: ADAR2-/-tis. (embryo)		SRR037928(GSM510466)
e7p5_rep2. (embryo)		SRR042480(GSM539872)
mouse kidney tissue [09-002]. (kidney)		SRR346418(SRX098259)
Global profiling of miRNA and the hairpin pre. (Liver)		SRR039610(GSM527274)
small RNA-Seq. (brain)		SRR037901(GSM510437)
testes_rep2. (testes)		SRR042478(GSM539870)
mouse lung tissue [09-002]. (lung)		SRR040488(GSM533911)
E18.5 wild type LIVER small RNA. (liver)		SRR065058(SRR065058)
Tissue-specific Regulation of Mouse MicroRNA . (pancreas)		SRR525243(SRA056111/SRX170319)
Mus musculus domesticus miRNA sequencing. (ago2 Blood)		Ago3IP805(Rui)
Quantitative functions of Argonaute proteins . (ago3 skin)		SRR037924(GSM510462)
e9p5_rep2. (embryo)		SRR032476(GSM485234)
sRNA_delayed_deep_sequencing. (uterus)		SRR037929(GSM510467)
e7p5_rep3. (embryo)		GSM475281(GSM475281)
total RNA. (testes)		SRR279904(GSM689054)
cell type: mouse embryonic stem cellcell line. (ESC)		SRR037904(GSM510440)
brain_rep1. (brain)		GSM510456(GSM510456)
newborn_rep12. (total RNA)		SRR042470(GSM539862)
mouse Th17 cells [09-002]. (lymph)		SRR077864(GSM637801)
18-30 nt small RNAs. (liver)		SRR077866(GSM637803)
18-30 nt small RNAs. (liver)		SRR069809(GSM610965)
small RNA sequencing; sample 1. (testes)		SRR042463(GSM539855)
mouse natural killer cells [09-002]. (spleen)		SRR345197(SRX097258)
source: size fractionated RNA from mouse hipp. (brain)		SRR039184(GSM485324)
shLuc.1309 (+dox). (fibroblast)		SRR391846(GSM852141)
gender: femalegenotype/variation: ADAR2-/-tis. (embryo)		SRR553585(SRX182791)
source: Kidney. (Kidney)		SRR042475(GSM539867)
mouse embryonic fibroblast cells [09-002]. (fibroblast)		SRR042446(GSM539838)
mouse mature B cells (spleen) replicate 1 [09-002]. (b cell)
.......AACTGATCTTCAAGAGGC........................................................................................................................................................... 188.000.00------------------4.00--------------2.00----------2.00---------------------------------------------------
.............................................................................GTCTTTGGGAAATCCACACCAC................................................................................. 2211.001.00-------------------------------------------------1.00----------------------------------------------
.............................................TCTTGGTGAGCTGGGGGAACAG................................................................................................................. 221.000.00--------------------------------------------------------------------1.00---------------------------
..................................................................................................................................GTGGGTGCTGGTGCCAGG................................ 181.000.00--------------------------------------------------------------------------------------------1.00---
.....................................ACACTACCTCTTGGTGAGCT........................................................................................................................... 2011.001.00-------------------------------------------------------------------------------------------1.00----