ID: uc009cly.6
GENE: Aup1(7)
chr6:83006379-83006585+


(1)
AGO.mut 		(2)
AGO1.ip 		(12)
AGO2.ip 		(2)
AGO3.ip 		(9)
B-CELL 		(19)
BRAIN 		(2)
CELL-LINE 		(1)
DGCR8.mut 		(10)
EMBRYO 		(9)
ESC 		(5)
FIBROBLAST 		(1)
KIDNEY 		(4)
LIVER 		(1)
LYMPH 		(12)
OTHER 		(8)
OTHER.mut 		(4)
PIWI.ip 		(1)
PIWI.mut 		(5)
SKIN 		(7)
SPLEEN 		(15)
TESTES 		(2)
THYMUS

Sense strand
GTCGACAGCTAGGGGAAGAGAGTGAGGAGTTTGCGCTCCGTGTACAACAGGTGGTAGTGAACAGGGGTGTGGTGGAAGTGGGGGGGTCCCTCCCTCCTGGGGAGAAGGGGAAGAAGACCTGACGAGGCTACAGCTATAACCTTCCAATTCTCCCTAGCTGGTGGCCAAAGAATTGGGCCAGATAGGGACACGGCTCACTCCAGCAGA
................................................................................................((((((((((..(((((.((.(((....)))))...........)))))..))))))))))..................................................
............................................................................................93..............................................................157................................................
SizePerfect hitTotal NormPerfect NormSRR546155(SRX180174)
Global profiling of miRNA and the hairpin pre. (ago2 Neuroblastoma)		SRR391851(GSM852146)
gender: femalegenotype/variation: wild typeti. (embryo)		SRR279904(GSM689054)
cell type: mouse embryonic stem cellcell line. (ESC)		SRR391846(GSM852141)
gender: femalegenotype/variation: ADAR2-/-tis. (embryo)		SRR391853(GSM852148)
gender: femalegenotype/variation: ADAR2-/-/AD. (embryo)		SRR685339(GSM1079783)
Small RNAs (15-50 nts in length) from immorta. (cell line)		SRR390299(GSM849857)
cell line: NIH-3T3cell type: fibroblastip ant. (ago2 fibroblast)		SRR038742(GSM527277)
small RNA-Seq. (dgcr8 brain)		SRR059769(GSM562831)
Treg_Drosha. (spleen)		mjTestesKO7()
Testes Data. (Zcchc11 testes)		SRR040489(GSM533912)
E18.5 Ago2 catalytically inactive LIVER small RNA. (ago2 liver)		SRR391852(GSM852147)
gender: femalegenotype/variation: ADAR2-/-tis. (embryo)		SRR073954(GSM629280)
total RNA. (blood)		SRR390297(GSM849855)
cell line: NIH-3T3cell type: fibroblastip ant. (fibroblast)		SRR391845(GSM852140)
gender: femalegenotype/variation: wild typeti. (embryo)		SRR039185(GSM485325)
shLuc.1309;ROSA-rtTA (-dox). (fibroblast)		SRR346418(SRX098259)
Global profiling of miRNA and the hairpin pre. (Liver)		SRR346424(SRX098266)
Global profiling of miRNA and the hairpin pre. (Neuroblastoma)		SRR042454(GSM539846)
mouse germinal center B cells (lymph node) [09-002]. (b cell)		SRR306537(GSM750580)
19-24nt. (ago2 brain)		mjLiverWT2()
Liver Data. (liver)		SRR391848(GSM852143)
gender: femalegenotype/variation: wild typeti. (embryo)		SRR391850(GSM852145)
gender: femalegenotype/variation: ADAR2-/-/AD. (embryo)		SRR038744(GSM527279)
small RNA-Seq. (brain)		SRR042449(GSM539841)
mouse B cells activated in vitro with LPS/IL4 replicate 2 [09-002]. (b cell)		SRR029036(GSM433288)
18dpp_hetero_tdrd6-KO. (tdrd6 testes)		SRR345199(SRX097260)
source: size fractionated RNA from mouse hipp. (brain)		SRR306542(GSM750585)
19-24nt. (ago2 brain)		GSM314557(GSM314557)
ESC dgcr8 (Illumina). (ESC)		SRR042468(GSM539860)
mouse Th1 cells [09-002]. (lymph)		SRR059771(GSM562833)
CD4_control. (spleen)		Ago1IP517(Rui)
Quantitative functions of Argonaute proteins . (ago1 skin)		SRR402760(SRX117943)
source: ES E14 male cells. (ESC)		SRR279903(GSM689053)
cell type: mouse embryonic stem cellcell line. (ESC)		Ago2IP504(Rui)
Quantitative functions of Argonaute proteins . (ago2 skin)		SRR553602(SRX182808)
source: Sertoli cells. (Sertoli cells)		SRR346417(SRX098258)
Global profiling of miRNA and the hairpin pre. (Brain)		SRR028732(GSM400969)
Mili-Tdrd1 KO associated. (mili testes)		SRR402762(SRX117945)
source: ES E14 male cells. (ESC)		SRR029123(GSM416611)
NIH3T3. (cell line)		SRR034119(GSM466729)
Mili IP_Tdrd9+/- replicate2. (mili testes)		SRR391849(GSM852144)
gender: femalegenotype/variation: ADAR2-/-tis. (embryo)		SRR306541(GSM750584)
19-24nt. (ago2 brain)		SRR059766(GSM562828)
DN3_Drosha. (thymus)		SRR034118(GSM466728)
Mili IP_Tdrd9+/- replicate1. (mili testes)		SRR306533(GSM750576)
19-24nt. (ago2 brain)		SRR116846(GSM678422)
Small RNA deep sequencing from mouse epididym. (epididymis)		SRR029041(GSM433293)
6w_homo_tdrd6-KO. (tdrd6 testes)		SRR042458(GSM539850)
mouse basophil cells [09-002]. (b cell)		SRR248525(GSM733813)
cell type: Thy1- spermatogonial stem cellstra. (testes)		SRR402761(SRX117944)
source: ES E14 male cells. (ESC)		SRR042487(GSM539879)
mouse BclXL B activated with LPS/IL4 [BalbC] [09-002]. (spleen)		SRR206941(GSM723282)
other. (brain)		SRR306536(GSM750579)
19-24nt. (ago2 brain)		SRR345196(SRX097257)
source: size fractionated RNA from mouse hipp. (brain)		SRR042447(GSM539839)
mouse mature B cells (spleen) replicate 2 [09-002]. (b cell)		SRR037924(GSM510462)
e9p5_rep2. (embryo)		SRR346422(SRX098264)
Global profiling of miRNA and the hairpin pre. (Muscle)		SRR029042(GSM433294)
18.5dpc_hetero_tdrd1-KO. (tdrd1 testes)		SRR346416(SRX098257)
Global profiling of miRNA and the hairpin pre. (Kidney)		SRR029037(GSM433289)
18dpp_homo_tdrd6-KO. (tdrd6 testes)		SRR034120(GSM466730)
Mili IP_Tdrd9-/- replicate1. (mili testes)		SRR306527(GSM750570)
19-24nt. (ago2 brain)		Ago3IP805(Rui)
Quantitative functions of Argonaute proteins . (ago3 skin)		SRR345198(SRX097259)
source: size fractionated RNA from mouse hipp. (brain)		SRR402766(SRX117949)
source: ES PGK female cells. (ESC)		SRR040488(GSM533911)
E18.5 wild type LIVER small RNA. (liver)		SRR039153(GSM471930)
HL1_siSrf1_smallRNAseq. (muscle)		SRR042475(GSM539867)
mouse embryonic fibroblast cells [09-002]. (fibroblast)		SRR042459(GSM539851)
mouse neutrophil cells replicate 1 [09-002]. (blood)		SRR345197(SRX097258)
source: size fractionated RNA from mouse hipp. (brain)		SRR029038(GSM433290)
25dpp_hetero_tdrd6-KO. (tdrd6 testes)		SRR553604(SRX182810)
source: Spermatocytes. (Spermatocytes)		SRR279907(GSM689057)
cell type: mouse embryonic stem cellcell line. (ESC)		SRR306535(GSM750578)
19-24nt. (ago2 brain)		SRR306531(GSM750574)
19-24nt. (ago2 brain)		SRR042463(GSM539855)
mouse natural killer cells [09-002]. (spleen)		SRR042471(GSM539863)
mouse TFHS cells [09-002]. (spleen)		SRR248526(GSM733814)
cell type: Thy1- spermatogonial stem cellstra. (testes)		SRR042455(GSM539847)
mouse plasma cells [09-002]. (blood)		SRR042450(GSM539842)
mouse B cells activated in vitro with LPS/IL4 replicate 3 [09-002]. (b cell)		SRR039154(GSM471931)
HL1_siSrf2_smallRNAseq. (muscle)		Ago3IP812(Rui)
Quantitative functions of Argonaute proteins . (ago3 skin)		SRR039186(GSM485326)
shLuc.1309;ROSA-rtTA (+dox). (fibroblast)		SRR042488(GSM539880)
mouse BclXL germinal center B cells [BalbC] [09-002]. (B cell)		mjTestesKO6()
Testes Data. (Zcchc11 testes)		SRR042445(GSM539837)
mouse immature B cells [09-002]. (b cell)		SRR391847(GSM852142)
gender: femalegenotype/variation: ADAR2-/-/AD. (embryo)		mjTestesKO8()
Testes Data. (Zcchc11 testes)		SRR345201(SRX097262)
source: size fractionated RNA from mouse hipp. (brain)		SRR042484(GSM539876)
mouse salivary gland tissue [09-002]. (salivary gland)		SRR059770(GSM562832)
Treg_Dicer. (spleen)		SRR059772(GSM562834)
CD4_Drosha. (spleen)		SRR279906(GSM689056)
cell type: mouse embryonic stem cellcell line. (ESC)		SRR306534(GSM750577)
19-24nt. (ago2 brain)		SRR042451(GSM539843)
mouse B cells activated in vitro with LPS/aIgD-Dextran [09-002]. (b cell)		SRR206942(GSM723283)
other. (brain)		SRR014232(GSM319956)
16.5 dpc MILI. (mili testes)		SRR059765(GSM562827)
DN3_control. (thymus)		Ago1IP812(Rui)
Quantitative functions of Argonaute proteins . (ago1 skin)		SRR042452(GSM539844)
mouse B1 B cells [09-002]. (b cell)
........................................................................................................................................TAACCTTCCAATTCTCCCTAGT.................................................22151.004.009.002.002.00-1.001.00-3.00--1.00-1.00--1.00---3.00-2.00-1.00-1.00-2.00---2.00---1.00--1.00---2.00--2.001.001.00-----1.00------1.00-1.001.00-------1.00---1.00-1.00----1.00---1.00---------1.00---1.00
........................................................................................................................................TAACCTTCCAATTCTCCCTAGA.................................................22120.004.003.00----3.005.00------1.00--------------------1.00-1.00--2.00----------------1.001.00-------1.00---------------------------------1.00-
......................................................................................................................................TATAACCTTCCAATTCTCCCTAGT.................................................24111.001.001.001.00------1.00--1.00---1.00-------1.00----2.00---------------------------------------1.00--------------1.00----------1.00------
.................................................................................................TGGGGAGAAGGGGAAGAAGACCTG......................................................................................24111.0011.00-1.002.00-----3.00-2.00--------------------------------1.00----------------------1.00-------------------------------1.00--
.................................................................................................TGGGGAGAAGGGGAAGAAGACC........................................................................................22110.0010.00-2.00-2.00-------1.00-3.00-------------------1.00---------------------------------------1.00---------------------------
.......................................................................................................................................................................................AGGGACACGGCTCACTCCAGC...2116.006.00-2.00--2.00------1.00-----------------------------1.00-----------------------------------------------------------
.......................................................................................................................................................................................AGGGACACGGCTCACTCCAGCA..2215.005.00---3.002.00------------------------------------------------------------------------------------------------
.........................................................................................................................................................................................GGACACGGCTCACTCCAGCA..2014.004.00---------3.00----1.00--------------------------------------------------------------------------------------
........................................................................................................................................TAACCTTCCAATTCTCCCTAGC.................................................2214.004.00------------2.00--------1.00------------1.00------------------------------------------------------------------
.................................................................................................TGGGGAGAAGGGGAAGAAGACCT.......................................................................................2314.004.00-----------------1.00-------------------------------------1.00----------------------------1.00-----1.00----------
........................................................................................................................................TAACCTTCCAATTCTCCCTAG..................................................2114.004.003.00------1.00---------------------------------------------------------------------------------------------
.TCGACAGCTAGGGGAAGAGA..........................................................................................................................................................................................2013.003.00--3.00--------------------------------------------------------------------------------------------------
..........................................................................................................................................................................AATTGGGCCAGATAGGGACACGGCTT...........2613.001.00--------------------3.00--------------------------------------------------------------------------------
..................................GCTCCGTGTACAACAG.............................................................................................................................................................1613.003.00-----3.00-----------------------------------------------------------------------------------------------
........................................................................................................................................TAACCTTCCAATTCTCCCTAGTA................................................2312.004.001.001.00---------------------------------------------------------------------------------------------------
.......................................................................................................................................................................................AGGGACACGGCTCACTCCA.....1912.002.00---2.00-------------------------------------------------------------------------------------------------
................................................................................................CTGGGGAGAAGGGGAAGAAGACC........................................................................................2312.002.00---------------2.00-------------------------------------------------------------------------------------
...............................................................................................CCTGGGGAGAAGGGGAAGAAG...........................................................................................2112.002.00--------------------------------------------------------------------------1.00----------------1.00---------
..................................................................................................GGGGAGAAGGGGAAGAAGAC.........................................................................................2012.002.00------------------------------2.00----------------------------------------------------------------------
..........................................TACAACAGGTGGTAGTGAACAGGGGT...........................................................................................................................................2612.002.00----------------------------------------1.00---1.00--------------------------------------------------------
........................................................................................................................................TAACCTTCCAATTCTCCCTAGTT................................................2312.004.00-------------------------1.00-------------------------------------------------------1.00-------------------
....................................................................................................................................................................................GATAGGGACACGGCTCACTCC......2112.002.00---------1.00------1.00------------------------------------------------------------------------------------
...............................................................................................................................................................GGTGGCCAAAGAATTGGGCCAGAT........................2412.002.00----------------------1.00------------------1.00-----------------------------------------------------------
..............................................................................................TCCTGGGGAGAAGGGGAAGAAG...........................................................................................2212.002.001.00-----------------------1.00----------------------------------------------------------------------------
.................................CGCTCCGTGTACAACAG.............................................................................................................................................................1712.002.00-----------------1.00--------------------1.00--------------------------------------------------------------
.......................................................................................................................................................................AAGAATTGGGCCAGATAGGGACACGGC.............2712.002.00-------------------------------------1.00-----------------------1.00---------------------------------------
............................................................................................................................................................................TTGGGCCAGATAGGGACACGGCTCACT........2712.002.00----------2.00------------------------------------------------------------------------------------------
...........................................................................................................................................................................ATTGGGCCAGATAGGGACACGGG.............231.000.00---------------------------------------------------1.00-------------------------------------------------
.....................................................................................................................................................................CAAAGAATTGGGCCAGATAGGGACACGG..............2811.001.00---------1.00-------------------------------------------------------------------------------------------
....................................................................................................................................................................................GATAGGGACACGGCTCACTCCAG....2311.001.00-----------------------------------------------------------------------------------------------1.00-----
....................................................................................................................................................................................GATAGGGACACGGCTCACTCCAGCAGA2711.001.00------------------1.00----------------------------------------------------------------------------------
..............................................................................................TCCTGGGGAGAAGGGGAAGAAGA..........................................................................................2311.001.00---------------------------------1.00-------------------------------------------------------------------
...........................................................................................................................................................................ATTGGGCCAGATAGGGACACGGCT............2411.001.00-------------------------------------------------------------------------------1.00---------------------
................................GCGCTCCGTGTACAACAGCT...........................................................................................................................................................2011.001.00----1.00------------------------------------------------------------------------------------------------
........................................................................................................................................TAACCTTCCAATTCTCCCTATT.................................................221.000.001.00----------------------------------------------------------------------------------------------------
...............................................................................................................................................................................................GGCTCACTCCAGCAGGAAC191.000.00-------------------------------------------------1.00---------------------------------------------------
................................GCGCTCCGTGTACAACAG.............................................................................................................................................................1811.001.00---------------------------------------------------------------------------------------------1.00-------
...................................................................................................................................................................................AGATAGGGACACGGCTCACTCCAGCAG.2711.001.00----------------1.00------------------------------------------------------------------------------------
.................................................................................................TGGGGAGAAGGGGAAGAAGAC.........................................................................................2111.001.00--------1.00--------------------------------------------------------------------------------------------
..............................................................................................................AAGAAGACCTGACGAAAAT..............................................................................191.000.00------------------------------------------------------1.00----------------------------------------------
.....................................................................................................................................................................................ATAGGGACACGGCTCACTCCAGCAGA2611.001.00------------------------------------1.00----------------------------------------------------------------
.....................................................................................................................................................................CAAAGAATTGGGCCAGATAGG.....................2111.001.00-------------------------------------------------------------------------------------1.00---------------
......................................................................................................................................TATAACCTTCCAATTCTCCCT....................................................2111.001.00-------1.00---------------------------------------------------------------------------------------------
.............................................................................................................................................................................TGGGCCAGATAGGGACAC................1811.001.00--------------------------------------------------------------------------------1.00--------------------
..................AGAGTGAGGAGTTTGTGCT..........................................................................................................................................................................191.000.00---------------------------------------------------------------------1.00-------------------------------
..............................................................................................TCCTGGGGAGAAGGGGAAGAAGACCT.......................................................................................2611.001.00------------------------------------------------1.00----------------------------------------------------
................................................................................................CTGGGGAGAAGGGGAAGAAGAC.........................................................................................2211.001.00-----------1.00-----------------------------------------------------------------------------------------
................................................................................................................................................................................GCCAGATAGGGACACGGCT............1911.001.00----------------------------------------------------1.00------------------------------------------------
..........AGGGGAAGAGAGTGAGGAGTTTG..............................................................................................................................................................................2311.001.00------------------------1.00----------------------------------------------------------------------------
......................................................................................................................................................................AAAGAATTGGGCCAGATAGGGACACGG..............2711.001.00------------------1.00----------------------------------------------------------------------------------
..................AGAGTGAGGAGTTTGATT...........................................................................................................................................................................181.000.00----------------------------------------------1.00------------------------------------------------------
..................AGAGTGAGGAGTTTGTAT...........................................................................................................................................................................181.000.00------------1.00----------------------------------------------------------------------------------------
.............................................................................................................................................................................TGGGCCAGATAGGGACACGGCTCAC.........2511.001.00----------------1.00------------------------------------------------------------------------------------
..............GAAGAGAGTGAGGAGCCCT..............................................................................................................................................................................191.000.00-------------------------------------------1.00---------------------------------------------------------
..........................................TACAACAGGTGGTAGTGAACAGGGGTT..........................................................................................................................................2711.002.00----------------------------------------1.00------------------------------------------------------------
....................AGTGAGGAGTTTGCGCTCCGTGTACA.................................................................................................................................................................2611.001.00-------------------------------------------------------------------------------------------------1.00---
.........................................GTACAACAGGTGGTAGTGAACAGGGG............................................................................................................................................2611.001.00----------------------------------------------------------------------------------------1.00------------
.......................................................................................................................................................................AAGAATTGGGCCAGATAGGGACACG...............2511.001.00----------------------------------------------------------------------------1.00------------------------
...............................................................................................CCTGGGGAGAAGGGGAAGAAGAT.........................................................................................231.000.00--------------1.00--------------------------------------------------------------------------------------
...........................................................................................................................................................AGCTGGTGGCCAAAGAATTGGGCCAG..........................2611.001.00----1.00------------------------------------------------------------------------------------------------
........................................................................................................................................................................AGAATTGGGCCAGATAGGGACACGGT.............261.000.00------------------1.00----------------------------------------------------------------------------------
.......................................................................................................................................................................................AGGGACACGGCTCACTCCAGCAGA2411.001.00--------------1.00--------------------------------------------------------------------------------------
........................................................................................................................................................................AGAATTGGGCCAGATAGGGACACGGCT............2711.001.00--------------------------------------------1.00--------------------------------------------------------
......................................................................................................................................TATAACCTTCCAATTCTCCCGAG..................................................231.000.001.00----------------------------------------------------------------------------------------------------
......................................................................................................................................TATAACCTTCCAATTCTCCCTAG..................................................2311.001.001.00----------------------------------------------------------------------------------------------------
..........................................................................................................................................................................AATTGGGCCAGATAGGGACACGGCTCAC.........2811.001.00------------------------------------------------------------------------------1.00----------------------
.......................GAGGAGTTTGCGCTCCGTGT....................................................................................................................................................................2011.001.00----------------------1.00------------------------------------------------------------------------------
.........TAGGGGAAGAGAGTGGGTC...................................................................................................................................................................................191.000.00-------------------------------------------------------------------1.00---------------------------------
............................................................................................................................................................................................CACGGCTCACTCCAGCAGA1911.001.00-----------------1.00-----------------------------------------------------------------------------------
.................................................................................................TGGGGAGAAGGGGAAGAAG...........................................................................................1911.001.00--------------------------------------------------1.00--------------------------------------------------
....................................................................GTGGTGGAAGTGGGGGAG.........................................................................................................................181.000.00----------------------------------------------------------------1.00------------------------------------
...............................................................................................CCTGGGGAGAAGGGGAAGAAGACC........................................................................................2411.001.00--------------------------------------------------------------------------------------------1.00--------
..........................................................................................................................................................................AATTGGGCCAGATAGGGACACGGCT............2511.001.00-----------------------------------1.00-----------------------------------------------------------------
...............................................................................................................................................................................GGCCAGATAGGGACACGGCTCACT........2411.001.00---------------------------------------------------------------------------------------1.00-------------
................................................................................................................................................................................GCCAGATAGGGACACGGCTCACTCCAGCAG.3011.001.00-----------------------------------------------------------1.00-----------------------------------------
........................................................................................................................................................................................GGGACACGGCTCACTCCAGC...2011.001.00---1.00-------------------------------------------------------------------------------------------------
..........AGGGGAAGAGAGTGAGGAGTT................................................................................................................................................................................2111.001.00----1.00------------------------------------------------------------------------------------------------
..............................................................................................TCCTGGGGAGAAGGGGAAGAAGACC........................................................................................2511.001.00--1.00--------------------------------------------------------------------------------------------------
.......GCTAGGGGAAGAGAGTGAGGAG..................................................................................................................................................................................2211.001.00-----------------------------1.00-----------------------------------------------------------------------
............................................................................................................................................................................TTGGGCCAGATAGGGACACGGCTTA..........251.000.00-----------------------------1.00-----------------------------------------------------------------------
.........TAGGGGAAGAGAGTGATG....................................................................................................................................................................................181.000.00-----------------------------------------------------------------------------------------1.00-----------
...................................................................................................................................................................................AGATAGGGACACGGCTCACTCCAGCAGACT301.000.00-------------------------------------1.00---------------------------------------------------------------
............................................................................................................................................................................TTGGGCCAGATAGGGACACGGC.............2211.001.00------------------------------------------------------------------------1.00----------------------------
.......................................................................................................................................................................................AGGGACACGGCTCAC.........1530.330.33----------------------0.33------------------------------------------------------------------------------

Antisense strand
GTCGACAGCTAGGGGAAGAGAGTGAGGAGTTTGCGCTCCGTGTACAACAGGTGGTAGTGAACAGGGGTGTGGTGGAAGTGGGGGGGTCCCTCCCTCCTGGGGAGAAGGGGAAGAAGACCTGACGAGGCTACAGCTATAACCTTCCAATTCTCCCTAGCTGGTGGCCAAAGAATTGGGCCAGATAGGGACACGGCTCACTCCAGCAGA
................................................................................................((((((((((..(((((.((.(((....)))))...........)))))..))))))))))..................................................
............................................................................................93..............................................................157................................................
SizePerfect hitTotal NormPerfect NormSRR546155(SRX180174)
Global profiling of miRNA and the hairpin pre. (ago2 Neuroblastoma)		SRR391851(GSM852146)
gender: femalegenotype/variation: wild typeti. (embryo)		SRR279904(GSM689054)
cell type: mouse embryonic stem cellcell line. (ESC)		SRR391846(GSM852141)
gender: femalegenotype/variation: ADAR2-/-tis. (embryo)		SRR391853(GSM852148)
gender: femalegenotype/variation: ADAR2-/-/AD. (embryo)		SRR685339(GSM1079783)
Small RNAs (15-50 nts in length) from immorta. (cell line)		SRR390299(GSM849857)
cell line: NIH-3T3cell type: fibroblastip ant. (ago2 fibroblast)		SRR038742(GSM527277)
small RNA-Seq. (dgcr8 brain)		SRR059769(GSM562831)
Treg_Drosha. (spleen)		mjTestesKO7()
Testes Data. (Zcchc11 testes)		SRR040489(GSM533912)
E18.5 Ago2 catalytically inactive LIVER small RNA. (ago2 liver)		SRR391852(GSM852147)
gender: femalegenotype/variation: ADAR2-/-tis. (embryo)		SRR073954(GSM629280)
total RNA. (blood)		SRR390297(GSM849855)
cell line: NIH-3T3cell type: fibroblastip ant. (fibroblast)		SRR391845(GSM852140)
gender: femalegenotype/variation: wild typeti. (embryo)		SRR039185(GSM485325)
shLuc.1309;ROSA-rtTA (-dox). (fibroblast)		SRR346418(SRX098259)
Global profiling of miRNA and the hairpin pre. (Liver)		SRR346424(SRX098266)
Global profiling of miRNA and the hairpin pre. (Neuroblastoma)		SRR042454(GSM539846)
mouse germinal center B cells (lymph node) [09-002]. (b cell)		SRR306537(GSM750580)
19-24nt. (ago2 brain)		mjLiverWT2()
Liver Data. (liver)		SRR391848(GSM852143)
gender: femalegenotype/variation: wild typeti. (embryo)		SRR391850(GSM852145)
gender: femalegenotype/variation: ADAR2-/-/AD. (embryo)		SRR038744(GSM527279)
small RNA-Seq. (brain)		SRR042449(GSM539841)
mouse B cells activated in vitro with LPS/IL4 replicate 2 [09-002]. (b cell)		SRR029036(GSM433288)
18dpp_hetero_tdrd6-KO. (tdrd6 testes)		SRR345199(SRX097260)
source: size fractionated RNA from mouse hipp. (brain)		SRR306542(GSM750585)
19-24nt. (ago2 brain)		GSM314557(GSM314557)
ESC dgcr8 (Illumina). (ESC)		SRR042468(GSM539860)
mouse Th1 cells [09-002]. (lymph)		SRR059771(GSM562833)
CD4_control. (spleen)		Ago1IP517(Rui)
Quantitative functions of Argonaute proteins . (ago1 skin)		SRR402760(SRX117943)
source: ES E14 male cells. (ESC)		SRR279903(GSM689053)
cell type: mouse embryonic stem cellcell line. (ESC)		Ago2IP504(Rui)
Quantitative functions of Argonaute proteins . (ago2 skin)		SRR553602(SRX182808)
source: Sertoli cells. (Sertoli cells)		SRR346417(SRX098258)
Global profiling of miRNA and the hairpin pre. (Brain)		SRR028732(GSM400969)
Mili-Tdrd1 KO associated. (mili testes)		SRR402762(SRX117945)
source: ES E14 male cells. (ESC)		SRR029123(GSM416611)
NIH3T3. (cell line)		SRR034119(GSM466729)
Mili IP_Tdrd9+/- replicate2. (mili testes)		SRR391849(GSM852144)
gender: femalegenotype/variation: ADAR2-/-tis. (embryo)		SRR306541(GSM750584)
19-24nt. (ago2 brain)		SRR059766(GSM562828)
DN3_Drosha. (thymus)		SRR034118(GSM466728)
Mili IP_Tdrd9+/- replicate1. (mili testes)		SRR306533(GSM750576)
19-24nt. (ago2 brain)		SRR116846(GSM678422)
Small RNA deep sequencing from mouse epididym. (epididymis)		SRR029041(GSM433293)
6w_homo_tdrd6-KO. (tdrd6 testes)		SRR042458(GSM539850)
mouse basophil cells [09-002]. (b cell)		SRR248525(GSM733813)
cell type: Thy1- spermatogonial stem cellstra. (testes)		SRR402761(SRX117944)
source: ES E14 male cells. (ESC)		SRR042487(GSM539879)
mouse BclXL B activated with LPS/IL4 [BalbC] [09-002]. (spleen)		SRR206941(GSM723282)
other. (brain)		SRR306536(GSM750579)
19-24nt. (ago2 brain)		SRR345196(SRX097257)
source: size fractionated RNA from mouse hipp. (brain)		SRR042447(GSM539839)
mouse mature B cells (spleen) replicate 2 [09-002]. (b cell)		SRR037924(GSM510462)
e9p5_rep2. (embryo)		SRR346422(SRX098264)
Global profiling of miRNA and the hairpin pre. (Muscle)		SRR029042(GSM433294)
18.5dpc_hetero_tdrd1-KO. (tdrd1 testes)		SRR346416(SRX098257)
Global profiling of miRNA and the hairpin pre. (Kidney)		SRR029037(GSM433289)
18dpp_homo_tdrd6-KO. (tdrd6 testes)		SRR034120(GSM466730)
Mili IP_Tdrd9-/- replicate1. (mili testes)		SRR306527(GSM750570)
19-24nt. (ago2 brain)		Ago3IP805(Rui)
Quantitative functions of Argonaute proteins . (ago3 skin)		SRR345198(SRX097259)
source: size fractionated RNA from mouse hipp. (brain)		SRR402766(SRX117949)
source: ES PGK female cells. (ESC)		SRR040488(GSM533911)
E18.5 wild type LIVER small RNA. (liver)		SRR039153(GSM471930)
HL1_siSrf1_smallRNAseq. (muscle)		SRR042475(GSM539867)
mouse embryonic fibroblast cells [09-002]. (fibroblast)		SRR042459(GSM539851)
mouse neutrophil cells replicate 1 [09-002]. (blood)		SRR345197(SRX097258)
source: size fractionated RNA from mouse hipp. (brain)		SRR029038(GSM433290)
25dpp_hetero_tdrd6-KO. (tdrd6 testes)		SRR553604(SRX182810)
source: Spermatocytes. (Spermatocytes)		SRR279907(GSM689057)
cell type: mouse embryonic stem cellcell line. (ESC)		SRR306535(GSM750578)
19-24nt. (ago2 brain)		SRR306531(GSM750574)
19-24nt. (ago2 brain)		SRR042463(GSM539855)
mouse natural killer cells [09-002]. (spleen)		SRR042471(GSM539863)
mouse TFHS cells [09-002]. (spleen)		SRR248526(GSM733814)
cell type: Thy1- spermatogonial stem cellstra. (testes)		SRR042455(GSM539847)
mouse plasma cells [09-002]. (blood)		SRR042450(GSM539842)
mouse B cells activated in vitro with LPS/IL4 replicate 3 [09-002]. (b cell)		SRR039154(GSM471931)
HL1_siSrf2_smallRNAseq. (muscle)		Ago3IP812(Rui)
Quantitative functions of Argonaute proteins . (ago3 skin)		SRR039186(GSM485326)
shLuc.1309;ROSA-rtTA (+dox). (fibroblast)		SRR042488(GSM539880)
mouse BclXL germinal center B cells [BalbC] [09-002]. (B cell)		mjTestesKO6()
Testes Data. (Zcchc11 testes)		SRR042445(GSM539837)
mouse immature B cells [09-002]. (b cell)		SRR391847(GSM852142)
gender: femalegenotype/variation: ADAR2-/-/AD. (embryo)		mjTestesKO8()
Testes Data. (Zcchc11 testes)		SRR345201(SRX097262)
source: size fractionated RNA from mouse hipp. (brain)		SRR042484(GSM539876)
mouse salivary gland tissue [09-002]. (salivary gland)		SRR059770(GSM562832)
Treg_Dicer. (spleen)		SRR059772(GSM562834)
CD4_Drosha. (spleen)		SRR279906(GSM689056)
cell type: mouse embryonic stem cellcell line. (ESC)		SRR306534(GSM750577)
19-24nt. (ago2 brain)		SRR042451(GSM539843)
mouse B cells activated in vitro with LPS/aIgD-Dextran [09-002]. (b cell)		SRR206942(GSM723283)
other. (brain)		SRR014232(GSM319956)
16.5 dpc MILI. (mili testes)		SRR059765(GSM562827)
DN3_control. (thymus)		Ago1IP812(Rui)
Quantitative functions of Argonaute proteins . (ago1 skin)		SRR042452(GSM539844)
mouse B1 B cells [09-002]. (b cell)
............................................................................................................................................................GCTGGTGGCCAAAGACTC................................. 181.000.00----------------------------------------------------------1.00------------------------------------------
.................................................................................................................................ACAGCTATAACCTTCCTG............................................................ 181.000.00--------------------------1.00--------------------------------------------------------------------------
.................................................................................................................................ACAGCTATAACCTTCCTC............................................................ 181.000.00--------------------------1.00--------------------------------------------------------------------------
.........................GGAGTTTGCGCTCCGTA..................................................................................................................................................................... 171.000.00----------------------------------------------------------------------1.00------------------------------
...................GAGTGAGGAGTTTGCGTG.......................................................................................................................................................................... 181.000.00--------------1.00--------------------------------------------------------------------------------------