ID: uc008uht.4
GENE: Hectd3(5)
chr4:116669585-116669772+


(1)
AGO.mut 		(5)
AGO2.ip 		(8)
B-CELL 		(15)
BRAIN 		(2)
CELL-LINE 		(1)
DGCR8.mut 		(11)
EMBRYO 		(8)
ESC 		(4)
FIBROBLAST 		(2)
KIDNEY 		(9)
LIVER 		(2)
LYMPH 		(15)
OTHER 		(8)
OTHER.mut 		(1)
OVARY 		(1)
PIWI.ip 		(1)
PIWI.mut 		(3)
SPLEEN 		(17)
TESTES 		(1)
THYMUS 		(2)
TOTAL-RNA 		(1)
UTERUS

Sense strand
CAGTGCCAACACTGGGTACGGCTTACCATGAAGAAAGGCACAATTGTCAAGTGAGTGGGCTCTGGGCATGACAGGGTGGATGAGCCATGTGCTGCGGGTGCCTAGAGACTCATTCAGATACATACTCTGGGTCCTCAGGAAGCTGCTACTCACAGTGGATACCACAGATGACAACTTCATGCCGAAAC
...................................................((((((((((((((((((..(((.((((.....))))...)))...)))))))))).))))))))..........((((....))))..................................................
..................................................51.....................................................................................138................................................
SizePerfect hitTotal NormPerfect NormSRR546155(SRX180174)
Global profiling of miRNA and the hairpin pre. (ago2 Neuroblastoma)		SRR346421(SRX098263)
Global profiling of miRNA and the hairpin pre. (mixture)		mjTestesKO7()
Testes Data. (Zcchc11 testes)		SRR553583(SRX182789)
source: Cerebellum. (Cerebellum)		SRR346424(SRX098266)
Global profiling of miRNA and the hairpin pre. (Neuroblastoma)		SRR553602(SRX182808)
source: Sertoli cells. (Sertoli cells)		mjTestesKO6()
Testes Data. (Zcchc11 testes)		mjLiverWT1()
Liver Data. (liver)		SRR553582(SRX182788)
source: Brain. (Brain)		mjTestesKO5()
Testes Data. (Zcchc11 testes)		SRR391852(GSM852147)
gender: femalegenotype/variation: ADAR2-/-tis. (embryo)		SRR346417(SRX098258)
Global profiling of miRNA and the hairpin pre. (Brain)		SRR346425(SRX098267)
Global profiling of miRNA and the hairpin pre. (Neuroblastoma)		mjTestesKO8()
Testes Data. (Zcchc11 testes)		mjTestesWT4()
Testes Data. (testes)		SRR279904(GSM689054)
cell type: mouse embryonic stem cellcell line. (ESC)		mjLiverKO3()
Liver Data. (Zcchc11 liver)		SRR390299(GSM849857)
cell line: NIH-3T3cell type: fibroblastip ant. (ago2 fibroblast)		SRR391853(GSM852148)
gender: femalegenotype/variation: ADAR2-/-/AD. (embryo)		mjLiverKO1()
Liver Data. (Zcchc11 liver)		mjTestesWT2()
Testes Data. (testes)		SRR042471(GSM539863)
mouse TFHS cells [09-002]. (spleen)		SRR248526(GSM733814)
cell type: Thy1- spermatogonial stem cellstra. (testes)		SRR248523(GSM733811)
cell type: Thy1+ spermatogonial stem cellstra. (testes)		SRR685339(GSM1079783)
Small RNAs (15-50 nts in length) from immorta. (cell line)		SRR346423(SRX098265)
Global profiling of miRNA and the hairpin pre. (Brain)		SRR391845(GSM852140)
gender: femalegenotype/variation: wild typeti. (embryo)		GSM314557(GSM314557)
ESC dgcr8 (Illumina). (ESC)		SRR391846(GSM852141)
gender: femalegenotype/variation: ADAR2-/-tis. (embryo)		SRR039154(GSM471931)
HL1_siSrf2_smallRNAseq. (muscle)		SRR029043(GSM433295)
18.5dpc_homo_tdrd1-KO. (tdrd1 testes)		SRR279906(GSM689056)
cell type: mouse embryonic stem cellcell line. (ESC)		SRR391848(GSM852143)
gender: femalegenotype/variation: wild typeti. (embryo)		SRR391849(GSM852144)
gender: femalegenotype/variation: ADAR2-/-tis. (embryo)		SRR346422(SRX098264)
Global profiling of miRNA and the hairpin pre. (Muscle)		SRR346416(SRX098257)
Global profiling of miRNA and the hairpin pre. (Kidney)		SRR040488(GSM533911)
E18.5 wild type LIVER small RNA. (liver)		SRR248525(GSM733813)
cell type: Thy1- spermatogonial stem cellstra. (testes)		SRR279903(GSM689053)
cell type: mouse embryonic stem cellcell line. (ESC)		SRR248527(GSM733815)
cell type: spermatogonial stem cell enriched . (testes)		SRR042454(GSM539846)
mouse germinal center B cells (lymph node) [09-002]. (b cell)		SRR553585(SRX182791)
source: Kidney. (Kidney)		SRR391847(GSM852142)
gender: femalegenotype/variation: ADAR2-/-/AD. (embryo)		SRR391850(GSM852145)
gender: femalegenotype/variation: ADAR2-/-/AD. (embryo)		SRR279905(GSM689055)
cell type: mouse embryonic stem cellcell line. (ESC)		GSM509278(GSM509278)
small RNA cloning by length. (piwi testes)		SRR391851(GSM852146)
gender: femalegenotype/variation: wild typeti. (embryo)		SRR553586(SRX182792)
source: Testis. (testes)		SRR346418(SRX098259)
Global profiling of miRNA and the hairpin pre. (Liver)		SRR345199(SRX097260)
source: size fractionated RNA from mouse hipp. (brain)		SRR042447(GSM539839)
mouse mature B cells (spleen) replicate 2 [09-002]. (b cell)		SRR206940(GSM723281)
other. (brain)		SRR073954(GSM629280)
total RNA. (blood)		SRR042444(GSM539836)
mouse pre B cells [09-002]. (b cell)		SRR306530(GSM750573)
19-24nt. (ago2 brain)		SRR073955(GSM629281)
total RNA. (blood)		GSM509279(GSM509279)
MVH-/- E16.5 small RNA. (testes)		SRR065054(SRR065054)
Tissue-specific Regulation of Mouse MicroRNA . (jejunum)		SRR345198(SRX097259)
source: size fractionated RNA from mouse hipp. (brain)		SRR402766(SRX117949)
source: ES PGK female cells. (ESC)		SRR037914(GSM510451)
newborn_rep7. (total RNA)		SRR042469(GSM539861)
mouse Th2 cells [09-002]. (lymph)		SRR077864(GSM637801)
18-30 nt small RNAs. (liver)		SRR042458(GSM539850)
mouse basophil cells [09-002]. (b cell)		SRR042477(GSM539869)
mouse brain tissue [09-002]. (brain)		SRR042470(GSM539862)
mouse Th17 cells [09-002]. (lymph)		SRR037904(GSM510440)
brain_rep1. (brain)		SRR060845(GSM561991)
total RNA. (brain)		SRR038742(GSM527277)
small RNA-Seq. (dgcr8 brain)		SRR346420(SRX098261)
Global profiling of miRNA and the hairpin pre. (Uterus)		SRR029038(GSM433290)
25dpp_hetero_tdrd6-KO. (tdrd6 testes)		SRR042463(GSM539855)
mouse natural killer cells [09-002]. (spleen)		GSM519104(GSM519104)
mouse_granulocyte_nuclei_smallRNAs. (cell line)		SRR042446(GSM539838)
mouse mature B cells (spleen) replicate 1 [09-002]. (b cell)		SRR059771(GSM562833)
CD4_control. (spleen)		SRR306540(GSM750583)
19-24nt. (ago2 brain)		SRR390300(GSM849858)
cell line: NIH-3T3cell type: fibroblastinfect. (ago2 fibroblast)		SRR402762(SRX117945)
source: ES E14 male cells. (ESC)		SRR042486(GSM539878)
mouse ovaries [09-002]. (ovary)		GSM510455(GSM510455)
newborn_rep11. (total RNA)		SRR345201(SRX097262)
source: size fractionated RNA from mouse hipp. (brain)		SRR039185(GSM485325)
shLuc.1309;ROSA-rtTA (-dox). (fibroblast)		SRR206939(GSM723280)
other. (brain)		SRR037925(GSM510463)
e9p5_rep3. (embryo)		SRR037930(GSM510468)
e7p5_rep4. (embryo)		GSM640578(GSM640578)
small RNA in the liver with paternal control. (liver)		SRR553603(SRX182809)
source: Spermatids. (Spermatids)		GSM314552(GSM314552)
ESC wild type (Illumina). (ESC)		SRR065056(SRR065056)
Tissue-specific Regulation of Mouse MicroRNA . (jejunum)		GSM640582(GSM640582)
small RNA in the liver with paternal control . (liver)		SRR014232(GSM319956)
16.5 dpc MILI. (mili testes)		SRR059766(GSM562828)
DN3_Drosha. (thymus)		mjTestesWT3()
Testes Data. (testes)		SRR116846(GSM678422)
Small RNA deep sequencing from mouse epididym. (epididymis)		SRR042448(GSM539840)
mouse B cells activated in vitro with LPS/IL4 replicate 1 [09-002]. (b cell)		SRR039152(GSM471929)
HL1_siNon_smallRNAseq. (muscle)		SRR042443(GSM539835)
mouse pro B cells [09-002]. (b cell)		SRR039183(GSM485323)
shLuc.1309 (-dox). (fibroblast)		SRR039610(GSM527274)
small RNA-Seq. (brain)		SRR042451(GSM539843)
mouse B cells activated in vitro with LPS/aIgD-Dextran [09-002]. (b cell)		SRR040489(GSM533912)
E18.5 Ago2 catalytically inactive LIVER small RNA. (ago2 liver)
..................................................GTGAGTGGGCTCTGGGCATGACA...................................................................................................................23188.0088.008.00-10.004.001.003.005.008.004.002.005.001.001.00----3.002.004.001.00-1.001.003.00---1.00---1.00-2.001.00---1.00-1.00-1.00--1.00----1.00-1.00-----1.00--1.00---1.001.001.00--1.00----1.00-------------1.00-----1.00--1.00-
..................................................GTGAGTGGGCTCTGGGCATGAC....................................................................................................................22166.0066.0012.00-5.006.004.002.00---2.001.001.001.003.006.00-------1.00--1.00-2.00-1.00--1.002.00--2.001.00-1.00--1.00------------1.00-----1.00--1.001.00------------1.00------------1.00-1.00-1.00-1.00--1.00
..................................................GTGAGTGGGCTCTGGGCATGA.....................................................................................................................21146.0046.0015.00-6.003.002.00---2.003.00-2.00--------1.00-1.001.00-1.00----1.00-1.001.00-------------1.00------1.00---------------1.00----1.00---1.00-------1.00-------------
..................................................GTGAGTGGGCTCTGGGCATGACT...................................................................................................................23123.0066.002.00----4.002.00-3.00-1.002.001.00------------1.00---1.00------------------------------------------1.00--------1.00--1.001.00------1.00-----1.00--
..................................................GTGAGTGGGCTCTGGGCATGACAGGGTGGATGAGCCATGTGCTGCGGGTGCCTAGAGACTCATTCAGATACATACTCTGGGTCCTCAG..................................................88122.0022.00-22.00---------------------------------------------------------------------------------------------------
..................................................................................................................CAGATACATACTCTGGGTCCTCAG..................................................24113.0013.00-----2.00---------5.002.00----2.00----------------------2.00--------------------------------------------------------
..............................................................................................CGGGTGCCTAGAGACTCATTCAGT......................................................................24110.003.005.00--1.001.00-------------------------------------------2.00-------------------------------------1.00--------------
..................................................GTGAGTGGGCTCTGGGCATGACAT..................................................................................................................2418.0088.001.00----2.00-----------------------------------1.00----1.00----------1.00-----1.00------------------------1.00------------
..................................................GTGAGTGGGCTCTGGGCAT.......................................................................................................................1917.007.003.00--2.001.00-------1.00----------------------------------------------------------------------------------------
..................................................GTGAGTGGGCTCTGGGCATGT.....................................................................................................................2116.002.001.00-------1.00-----------2.00---------2.00----------------------------------------------------------------------
..................................................GTGAGTGGGCTCTGGGCATGAAA...................................................................................................................2316.0046.001.00--1.00------------3.00--------------------------1.00---------------------------------------------------------
..................................................GTGAGTGGGCTCTGGGCATGACATAAC...............................................................................................................2714.0088.00-------4.00---------------------------------------------------------------------------------------------
..............................................................................................CGGGTGCCTAGAGACTCATTCAGA......................................................................2414.004.001.00-----3.00----------------------------------------------------------------------------------------------
..................................................GTGAGTGGGCTCTGGGCATGACAGT.................................................................................................................253.000.001.00--------------------1.00------------------------------1.00------------------------------------------------
..............................................................................................CGGGTGCCTAGAGACTCATTCAG.......................................................................2313.003.00----2.00------------------------------------------1.00-----------------------------------------------------
.................................................................................................................TCAGATACATACTCTGGGTCCTCAG..................................................2513.003.00-------------------------------3.00---------------------------------------------------------------------
..................................................GTGAGTGGGCTCTGGGCATGACAGGGTGGATGAGCCATGTGCTGCGGGTGCCTAGAGACTCATTCAGATACATACTCTGGGTCCTCAGAAG...............................................9113.0022.00-3.00---------------------------------------------------------------------------------------------------
..................................................GTGAGTGGGCTCTGGGCATGACAA..................................................................................................................2413.0088.00------1.00---------------1.00-----1.00------------------------------------------------------------------------
..................................................GTGAGTGGGCTCTGGGCATGACAGA.................................................................................................................253.000.00-----------------1.00---1.00----------------------------1.00--------------------------------------------------
..................................................GTGAGTGGGCTCTGGGCATGAA....................................................................................................................2212.0046.001.00--------1.00-------------------------------------------------------------------------------------------
..................................................GTGAGTGGGCTCTGGGCATGACAAA.................................................................................................................2512.0088.00----1.00-1.00----------------------------------------------------------------------------------------------
..................................................GTGAGTGGGCTCTGGGCATGAT....................................................................................................................2212.0046.00---1.00-------------------1.00-----------------------------------------------------------------------------
..................................................................................................................CAGATACATACTCTGGGTCCTCAGTTTA..............................................2812.0013.00-------------2.00---------------------------------------------------------------------------------------
..................................................GTGAGTGGGCTCTGGGCATGACAGGG................................................................................................................2612.002.00---------------------------------------------1.00----------1.00--------------------------------------------
........ACACTGGGTACGGCTTACCATGAATTT.........................................................................................................................................................272.000.00----------------------------------------2.00------------------------------------------------------------
..................................................GTGAGTGGGCTCTGGGCATG......................................................................................................................2012.002.00------1.00------1.00---------------------------------------------------------------------------------------
..................................................GTGAGTGGGCTCTGGGCATGTAAT..................................................................................................................2412.002.00----2.00------------------------------------------------------------------------------------------------
..................................................GTGAGTGGGCTCTGGGCATGAAT...................................................................................................................2312.0046.00----1.00---------------------1.00--------------------------------------------------------------------------
..................................................GTGAGTGGGCTCTGGGCATGACTA..................................................................................................................2411.0066.00--------1.00--------------------------------------------------------------------------------------------
...................................................TGAGTGGGCTCTGGGCATGAC....................................................................................................................2111.001.00-----------------------------------1.00-----------------------------------------------------------------
................TACGGCTTACCATGAAGAA.........................................................................................................................................................1911.001.00----------------------------------------------------------------------------------------------1.00------
...........................................................CTCTGGGCATGACAGACG...............................................................................................................181.000.00----------------------------------------------------------1.00------------------------------------------
..................................................GTGAGTGGGCTCTGGGCAA.......................................................................................................................191.000.00--1.00--------------------------------------------------------------------------------------------------
...........................................................................................................................................................................CAACTTCATGCCGAAGAA181.000.00-------------------------------------------------1.00---------------------------------------------------
.................................................................................................................TCAGATACATACTCTGGGTCCTCAGA.................................................2611.003.00-----------------------------------------------------------------------------1.00-----------------------
..................................................GTGAGTGGGCTCTGGGCATGATT...................................................................................................................2311.0046.001.00----------------------------------------------------------------------------------------------------
...................................................TGAGTGGGCTCTGGGCATGACA...................................................................................................................2211.001.00---1.00-------------------------------------------------------------------------------------------------
...........................ATGAAGAAAGGCACAATTGTCAA..........................................................................................................................................2311.001.00------------------------------------------------------------1.00----------------------------------------
..................................................GTGAGTGGGCTCTGGGCATT......................................................................................................................2011.007.001.00----------------------------------------------------------------------------------------------------
..................................................GTGAGTGGGCTCTGGGCATGG.....................................................................................................................2111.002.001.00----------------------------------------------------------------------------------------------------
..................................................GTGAGTGGGCTCTGGGCATGACAGG.................................................................................................................2511.001.00---------------------------------------------1.00-------------------------------------------------------
........................ACCATGAAGAAAGGCACAATTGT.............................................................................................................................................2311.001.00------------------1.00----------------------------------------------------------------------------------
..................................................................................................................CAGATACATACTCTGGGTCCTCAGA.................................................2511.0013.00--------------------------------------1.00--------------------------------------------------------------
....................GCTTACCATGAAGAAAGGC.....................................................................................................................................................1911.001.00--------------------------------------1.00--------------------------------------------------------------
..................................................GTGAGTGGGCTCTGGGCATCACT...................................................................................................................2311.007.00-----1.00-----------------------------------------------------------------------------------------------
..................................................GTGAGTGGGCTCTGGGCATGACTAGT................................................................................................................2611.0066.00------------1.00----------------------------------------------------------------------------------------
..................................................GTGAGTGGGCTCTGGGCATA......................................................................................................................2011.007.00----1.00------------------------------------------------------------------------------------------------
..................................................GTGAGTGGGCTCTGGGCATGAAAAT.................................................................................................................2511.0046.001.00----------------------------------------------------------------------------------------------------
.......................TACCATGAAGAAAGGCACAATT...............................................................................................................................................2211.001.00------------------------------------------1.00----------------------------------------------------------
................................GAAAGGCACAATTGTCAA..........................................................................................................................................1811.001.00-----------------------------------------------------------------------------------1.00-----------------
..................................................GTGAGTGGGCTCTGGGCATATA....................................................................................................................2211.007.00------------1.00----------------------------------------------------------------------------------------
........................ACCATGAAGAAAGGCACAAT................................................................................................................................................2011.001.00------------------1.00----------------------------------------------------------------------------------
..................................................................................................................CAGATACATACTCTGGGTCCTCAGT.................................................2511.0013.00----------------------------------------------------------------------------------1.00------------------
..................................................GTGAGTGGGCTCTGGGCATGATA...................................................................................................................2311.0046.00--1.00--------------------------------------------------------------------------------------------------
..................................................GTGAGTGGGCTCTGGGCATGACTT..................................................................................................................2411.0066.00-------------------------------------------------------------------------1.00---------------------------
..................................................GTGAGTGGGCTCTGGGCATGAAC...................................................................................................................2311.0046.00-------------------------------------1.00---------------------------------------------------------------
..................................................GTGAGTGGGCTCTGGGCATTA.....................................................................................................................2111.007.00----1.00------------------------------------------------------------------------------------------------
..................................................GTGAGTGGGCTCTGGGCATGACC...................................................................................................................2311.0066.00----1.00------------------------------------------------------------------------------------------------
............................................................................................................................................................GGATACCACAGATGACAACTTC..........2211.001.00--------------------------1.00--------------------------------------------------------------------------
........................ACCATGAAGAAAGGCACAATT...............................................................................................................................................2111.001.00--------------------------1.00--------------------------------------------------------------------------
..............................................................................................CGGGTGCCTAGAGACTCATTAG........................................................................221.000.00---------------------------------------------------------------------1.00-------------------------------
....................GCTTACCATGAAGAAAGG......................................................................................................................................................1811.001.00--------------------------------------------------------------------------1.00--------------------------
..................................................GTGAGTGGGCTCTGGGCATGACATTA................................................................................................................2611.0088.00---------------------------1.00-------------------------------------------------------------------------

Antisense strand
CAGTGCCAACACTGGGTACGGCTTACCATGAAGAAAGGCACAATTGTCAAGTGAGTGGGCTCTGGGCATGACAGGGTGGATGAGCCATGTGCTGCGGGTGCCTAGAGACTCATTCAGATACATACTCTGGGTCCTCAGGAAGCTGCTACTCACAGTGGATACCACAGATGACAACTTCATGCCGAAAC
...................................................((((((((((((((((((..(((.((((.....))))...)))...)))))))))).))))))))..........((((....))))..................................................
..................................................51.....................................................................................138................................................
SizePerfect hitTotal NormPerfect NormSRR546155(SRX180174)
Global profiling of miRNA and the hairpin pre. (ago2 Neuroblastoma)		SRR346421(SRX098263)
Global profiling of miRNA and the hairpin pre. (mixture)		mjTestesKO7()
Testes Data. (Zcchc11 testes)		SRR553583(SRX182789)
source: Cerebellum. (Cerebellum)		SRR346424(SRX098266)
Global profiling of miRNA and the hairpin pre. (Neuroblastoma)		SRR553602(SRX182808)
source: Sertoli cells. (Sertoli cells)		mjTestesKO6()
Testes Data. (Zcchc11 testes)		mjLiverWT1()
Liver Data. (liver)		SRR553582(SRX182788)
source: Brain. (Brain)		mjTestesKO5()
Testes Data. (Zcchc11 testes)		SRR391852(GSM852147)
gender: femalegenotype/variation: ADAR2-/-tis. (embryo)		SRR346417(SRX098258)
Global profiling of miRNA and the hairpin pre. (Brain)		SRR346425(SRX098267)
Global profiling of miRNA and the hairpin pre. (Neuroblastoma)		mjTestesKO8()
Testes Data. (Zcchc11 testes)		mjTestesWT4()
Testes Data. (testes)		SRR279904(GSM689054)
cell type: mouse embryonic stem cellcell line. (ESC)		mjLiverKO3()
Liver Data. (Zcchc11 liver)		SRR390299(GSM849857)
cell line: NIH-3T3cell type: fibroblastip ant. (ago2 fibroblast)		SRR391853(GSM852148)
gender: femalegenotype/variation: ADAR2-/-/AD. (embryo)		mjLiverKO1()
Liver Data. (Zcchc11 liver)		mjTestesWT2()
Testes Data. (testes)		SRR042471(GSM539863)
mouse TFHS cells [09-002]. (spleen)		SRR248526(GSM733814)
cell type: Thy1- spermatogonial stem cellstra. (testes)		SRR248523(GSM733811)
cell type: Thy1+ spermatogonial stem cellstra. (testes)		SRR685339(GSM1079783)
Small RNAs (15-50 nts in length) from immorta. (cell line)		SRR346423(SRX098265)
Global profiling of miRNA and the hairpin pre. (Brain)		SRR391845(GSM852140)
gender: femalegenotype/variation: wild typeti. (embryo)		GSM314557(GSM314557)
ESC dgcr8 (Illumina). (ESC)		SRR391846(GSM852141)
gender: femalegenotype/variation: ADAR2-/-tis. (embryo)		SRR039154(GSM471931)
HL1_siSrf2_smallRNAseq. (muscle)		SRR029043(GSM433295)
18.5dpc_homo_tdrd1-KO. (tdrd1 testes)		SRR279906(GSM689056)
cell type: mouse embryonic stem cellcell line. (ESC)		SRR391848(GSM852143)
gender: femalegenotype/variation: wild typeti. (embryo)		SRR391849(GSM852144)
gender: femalegenotype/variation: ADAR2-/-tis. (embryo)		SRR346422(SRX098264)
Global profiling of miRNA and the hairpin pre. (Muscle)		SRR346416(SRX098257)
Global profiling of miRNA and the hairpin pre. (Kidney)		SRR040488(GSM533911)
E18.5 wild type LIVER small RNA. (liver)		SRR248525(GSM733813)
cell type: Thy1- spermatogonial stem cellstra. (testes)		SRR279903(GSM689053)
cell type: mouse embryonic stem cellcell line. (ESC)		SRR248527(GSM733815)
cell type: spermatogonial stem cell enriched . (testes)		SRR042454(GSM539846)
mouse germinal center B cells (lymph node) [09-002]. (b cell)		SRR553585(SRX182791)
source: Kidney. (Kidney)		SRR391847(GSM852142)
gender: femalegenotype/variation: ADAR2-/-/AD. (embryo)		SRR391850(GSM852145)
gender: femalegenotype/variation: ADAR2-/-/AD. (embryo)		SRR279905(GSM689055)
cell type: mouse embryonic stem cellcell line. (ESC)		GSM509278(GSM509278)
small RNA cloning by length. (piwi testes)		SRR391851(GSM852146)
gender: femalegenotype/variation: wild typeti. (embryo)		SRR553586(SRX182792)
source: Testis. (testes)		SRR346418(SRX098259)
Global profiling of miRNA and the hairpin pre. (Liver)		SRR345199(SRX097260)
source: size fractionated RNA from mouse hipp. (brain)		SRR042447(GSM539839)
mouse mature B cells (spleen) replicate 2 [09-002]. (b cell)		SRR206940(GSM723281)
other. (brain)		SRR073954(GSM629280)
total RNA. (blood)		SRR042444(GSM539836)
mouse pre B cells [09-002]. (b cell)		SRR306530(GSM750573)
19-24nt. (ago2 brain)		SRR073955(GSM629281)
total RNA. (blood)		GSM509279(GSM509279)
MVH-/- E16.5 small RNA. (testes)		SRR065054(SRR065054)
Tissue-specific Regulation of Mouse MicroRNA . (jejunum)		SRR345198(SRX097259)
source: size fractionated RNA from mouse hipp. (brain)		SRR402766(SRX117949)
source: ES PGK female cells. (ESC)		SRR037914(GSM510451)
newborn_rep7. (total RNA)		SRR042469(GSM539861)
mouse Th2 cells [09-002]. (lymph)		SRR077864(GSM637801)
18-30 nt small RNAs. (liver)		SRR042458(GSM539850)
mouse basophil cells [09-002]. (b cell)		SRR042477(GSM539869)
mouse brain tissue [09-002]. (brain)		SRR042470(GSM539862)
mouse Th17 cells [09-002]. (lymph)		SRR037904(GSM510440)
brain_rep1. (brain)		SRR060845(GSM561991)
total RNA. (brain)		SRR038742(GSM527277)
small RNA-Seq. (dgcr8 brain)		SRR346420(SRX098261)
Global profiling of miRNA and the hairpin pre. (Uterus)		SRR029038(GSM433290)
25dpp_hetero_tdrd6-KO. (tdrd6 testes)		SRR042463(GSM539855)
mouse natural killer cells [09-002]. (spleen)		GSM519104(GSM519104)
mouse_granulocyte_nuclei_smallRNAs. (cell line)		SRR042446(GSM539838)
mouse mature B cells (spleen) replicate 1 [09-002]. (b cell)		SRR059771(GSM562833)
CD4_control. (spleen)		SRR306540(GSM750583)
19-24nt. (ago2 brain)		SRR390300(GSM849858)
cell line: NIH-3T3cell type: fibroblastinfect. (ago2 fibroblast)		SRR402762(SRX117945)
source: ES E14 male cells. (ESC)		SRR042486(GSM539878)
mouse ovaries [09-002]. (ovary)		GSM510455(GSM510455)
newborn_rep11. (total RNA)		SRR345201(SRX097262)
source: size fractionated RNA from mouse hipp. (brain)		SRR039185(GSM485325)
shLuc.1309;ROSA-rtTA (-dox). (fibroblast)		SRR206939(GSM723280)
other. (brain)		SRR037925(GSM510463)
e9p5_rep3. (embryo)		SRR037930(GSM510468)
e7p5_rep4. (embryo)		GSM640578(GSM640578)
small RNA in the liver with paternal control. (liver)		SRR553603(SRX182809)
source: Spermatids. (Spermatids)		GSM314552(GSM314552)
ESC wild type (Illumina). (ESC)		SRR065056(SRR065056)
Tissue-specific Regulation of Mouse MicroRNA . (jejunum)		GSM640582(GSM640582)
small RNA in the liver with paternal control . (liver)		SRR014232(GSM319956)
16.5 dpc MILI. (mili testes)		SRR059766(GSM562828)
DN3_Drosha. (thymus)		mjTestesWT3()
Testes Data. (testes)		SRR116846(GSM678422)
Small RNA deep sequencing from mouse epididym. (epididymis)		SRR042448(GSM539840)
mouse B cells activated in vitro with LPS/IL4 replicate 1 [09-002]. (b cell)		SRR039152(GSM471929)
HL1_siNon_smallRNAseq. (muscle)		SRR042443(GSM539835)
mouse pro B cells [09-002]. (b cell)		SRR039183(GSM485323)
shLuc.1309 (-dox). (fibroblast)		SRR039610(GSM527274)
small RNA-Seq. (brain)		SRR042451(GSM539843)
mouse B cells activated in vitro with LPS/aIgD-Dextran [09-002]. (b cell)		SRR040489(GSM533912)
E18.5 Ago2 catalytically inactive LIVER small RNA. (ago2 liver)
.........................................................................................................................................................................GACAACTTCATGCCGAATAGT 211.000.00--------------------------------------------------------------------------------1.00--------------------
..........................................................................................................GACTCATTCAGATACGGC................................................................ 181.000.00-----------------------------1.00-----------------------------------------------------------------------
......................................................................................................................................................................GATGACAACTTCATGCGCT... 191.000.00----------------------------1.00------------------------------------------------------------------------
............................................................................................TGCGGGTGCCTAGAGAT............................................................................... 171.000.00-----------------------------------------------------------------------------------------1.00-----------
...............GTACGGCTTACCA................................................................................................................................................................ 1340.250.25-------------------------------------------------0.25---------------------------------------------------