| (1) AGO.mut | (4) AGO2.ip | (7) B-CELL | (10) BRAIN | (7) EMBRYO | (2) ESC | (1) KIDNEY | (2) LIVER | (1) LUNG | (3) LYMPH | (10) OTHER | (4) OTHER.mut | (2) PIWI.ip | (1) PIWI.mut | (1) SKIN | (5) SPLEEN | (1) TDRD1.ip | (12) TESTES | (1) TOTAL-RNA | (1) UTERUS | 
| CTTGGTTAGCACATGGCTCAGCTGAGGCTGGAATCCAGTTTCAGACCCCCATGTCTTAAATGCTGGGCAGAGCTCCTAGCTGAACTTCCTGCTCTGCTAAGCTTGGGAGACAATGTCACTAGGACCAGAGGAACCCTGGGGAAGGCAGGAACTAAGGATGTCAAGCAGAATGCCCCAAAGTATCATGTCCTTCCCACCAGGAGGGCCGTGTAGCCATTACGAGGGTGGCCAACCTTCTGCTATGTATGTA .......................................................................................................................................((((((((((((.(((((..((...((.....))...))....))).)).)).)))))))..))).................................................. ...................................................................................................................................132.................................................................200................................................ | Size | Perfect hit | Total Norm | Perfect Norm | SRR391848(GSM852143) gender: femalegenotype/variation: wild typeti. (embryo) | SRR279907(GSM689057) cell type: mouse embryonic stem cellcell line. (ESC) | SRR546155(SRX180174) Global profiling of miRNA and the hairpin pre. (ago2 Neuroblastoma) | SRR391852(GSM852147) gender: femalegenotype/variation: ADAR2-/-tis. (embryo) | SRR346421(SRX098263) Global profiling of miRNA and the hairpin pre. (mixture) | SRR039154(GSM471931) HL1_siSrf2_smallRNAseq. (muscle) | SRR345198(SRX097259) source: size fractionated RNA from mouse hipp. (brain) | SRR345207(SRX097268) source: size fractionated RNA from mouse hipp. (brain) | SRR391851(GSM852146) gender: femalegenotype/variation: wild typeti. (embryo) | SRR553583(SRX182789) source: Cerebellum. (Cerebellum) | SRR042463(GSM539855) mouse natural killer cells [09-002]. (spleen) | SRR345204(SRX097265) source: size fractionated RNA from mouse hipp. (brain) | SRR042488(GSM539880) mouse BclXL germinal center B cells [BalbC] [09-002]. (B cell) | SRR042473(GSM539865) mouse nTreg cells [09-002]. (lymph) | SRR391850(GSM852145) gender: femalegenotype/variation: ADAR2-/-/AD. (embryo) | SRR345202(SRX097263) source: size fractionated RNA from mouse hipp. (brain) | SRR345203(SRX097264) source: size fractionated RNA from mouse hipp. (brain) | SRR034119(GSM466729) Mili IP_Tdrd9+/- replicate2. (mili testes) | SRR042471(GSM539863) mouse TFHS cells [09-002]. (spleen) | Ago2IP504(Rui) Quantitative functions of Argonaute proteins . (ago2 skin) | SRR060845(GSM561991) total RNA. (brain) | SRR042487(GSM539879) mouse BclXL B activated with LPS/IL4 [BalbC] [09-002]. (spleen) | SRR042477(GSM539869) mouse brain tissue [09-002]. (brain) | SRR042469(GSM539861) mouse Th2 cells [09-002]. (lymph) | SRR042458(GSM539850) mouse basophil cells [09-002]. (b cell) | SRR306532(GSM750575) 19-24nt. (ago2 brain) | SRR042474(GSM539866) mouse embryonic stem cells [09-002]. (ESC) | SRR525243(SRA056111/SRX170319) Mus musculus domesticus miRNA sequencing. (ago2 Blood) | SRR042445(GSM539837) mouse immature B cells [09-002]. (b cell) | SRR034120(GSM466730) Mili IP_Tdrd9-/- replicate1. (mili testes) | SRR248523(GSM733811) cell type: Thy1+ spermatogonial stem cellstra. (testes) | SRR346416(SRX098257) Global profiling of miRNA and the hairpin pre. (Kidney) | SRR073954(GSM629280) total RNA. (blood) | SRR029042(GSM433294) 18.5dpc_hetero_tdrd1-KO. (tdrd1 testes) | SRR028732(GSM400969) Mili-Tdrd1 KO associated. (mili testes) | SRR042447(GSM539839) mouse mature B cells (spleen) replicate 2 [09-002]. (b cell) | SRR346417(SRX098258) Global profiling of miRNA and the hairpin pre. (Brain) | SRR040489(GSM533912) E18.5 Ago2 catalytically inactive LIVER small RNA. (ago2 liver) | SRR042467(GSM539859) mouse T cells activated in vitro with Concanavalin A [09-002]. (spleen) | mjTestesKO7() Testes Data. (Zcchc11 testes) | SRR391849(GSM852144) gender: femalegenotype/variation: ADAR2-/-tis. (embryo) | SRR346418(SRX098259) Global profiling of miRNA and the hairpin pre. (Liver) | SRR042459(GSM539851) mouse neutrophil cells replicate 1 [09-002]. (blood) | SRR042451(GSM539843) mouse B cells activated in vitro with LPS/aIgD-Dextran [09-002]. (b cell) | SRR042443(GSM539835) mouse pro B cells [09-002]. (b cell) | SRR039153(GSM471930) HL1_siSrf1_smallRNAseq. (muscle) | SRR042468(GSM539860) mouse Th1 cells [09-002]. (lymph) | SRR039152(GSM471929) HL1_siNon_smallRNAseq. (muscle) | SRR042446(GSM539838) mouse mature B cells (spleen) replicate 1 [09-002]. (b cell) | SRR248524(GSM733812) cell type: Thy1+ spermatogonial stem cellstra. (testes) | SRR069809(GSM610965) small RNA sequencing; sample 1. (testes) | SRR553602(SRX182808) source: Sertoli cells. (Sertoli cells) | SRR028730(GSM400967) Tdrd1-associated. (tdrd1 testes) | SRR029039(GSM433291) 25dpp_homo_tdrd6-KO. (tdrd6 testes) | SRR391845(GSM852140) gender: femalegenotype/variation: wild typeti. (embryo) | SRR032477(GSM485235) sRNA_activation_deep_sequencing. (uterus) | mjTestesWT3() Testes Data. (testes) | SRR037909(GSM510446) newborn_rep2. (total RNA) | SRR391853(GSM852148) gender: femalegenotype/variation: ADAR2-/-/AD. (embryo) | SRR037906(GSM510442) brain_rep3. (brain) | SRR042465(GSM539857) mouse CD4+ T cells (spleen) [09-002]. (spleen) | SRR346419(SRX098260) Global profiling of miRNA and the hairpin pre. (Lung) | mjTestesKO8() Testes Data. (Zcchc11 testes) | 
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ........................................................................................................................................TGGGGAAGGCAGGAACTAAGG............................................................................................. | 21 | 1 | 17.00 | 17.00 | - | 3.00 | - | - | - | - | - | - | - | 1.00 | 1.00 | - | 1.00 | - | - | - | - | - | 1.00 | 1.00 | 1.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | 1.00 | 1.00 | - | - | 1.00 | - | - | - | 1.00 | - | - | 1.00 | - | - | 1.00 | - | - | - | - | - | 
| ..........................................................................................................................................................................................................................ACGAGGGTGGCCAACCTTCT............ | 20 | 1 | 8.00 | 8.00 | 6.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 
| ........................................................................................................................................TGGGGAAGGCAGGAACTAAG.............................................................................................. | 20 | 1 | 8.00 | 8.00 | - | 3.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | 1.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | 
| .......................................................................................................................................CTGGGGAAGGCAGGAACTAAGG............................................................................................. | 22 | 1 | 5.00 | 5.00 | - | 1.00 | - | - | - | 1.00 | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | 
| ................................................................................................................................................................................AAAGTATCATGTCCTTCCCACCAGT................................................. | 25 | 5.00 | 0.00 | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | |
| ..........................................................................................................................................................................................................................ACGAGGGTGGCCAACCTTCTGCT......... | 23 | 1 | 4.00 | 4.00 | 3.00 | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 
| ........................................................................................................................................TGGGGAAGGCAGGAACTAAGA............................................................................................. | 21 | 1 | 3.00 | 8.00 | - | - | - | - | - | - | - | 1.00 | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 
| ........................................................................................................................................TGGGGAAGGCAGGAACTAAGGA............................................................................................ | 22 | 1 | 3.00 | 3.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | 
| .......................................................................................................................................CTGGGGAAGGCAGGAACT................................................................................................. | 18 | 1 | 2.00 | 2.00 | - | - | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 
| ........................................................................................................................................TGGGGAAGGCAGGAACTAAGGAA........................................................................................... | 23 | 1 | 2.00 | 3.00 | - | - | - | - | - | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 
| ..........................................................................................................................................................................................................GGGCCGTGTAGCCATTACGAGGGT........................ | 24 | 1 | 2.00 | 2.00 | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 
| .......................................................................................................................TAGGACCAGAGGAACCCTGGGGAAGGCAGGAACTAAGGATGTCAAGCAGAATGCCCCAAAGTATCATGTCCTTCCCACCAGAAA............................................... | 84 | 2.00 | 0.00 | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...................................................................................................................................................................................................................AGCCATTACGAGGGTGGCCAACCT............... | 24 | 1 | 2.00 | 2.00 | 1.00 | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 
| .......................................................................................................................................CTGGGGAAGGCAGGAACTAAGGAC........................................................................................... | 24 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ................................................................................................................................................................................AAAGTATCATGTCCTTCCCACC.................................................... | 22 | 1 | 1.00 | 1.00 | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 
| .................................................................................................................................................CAGGAACTAAGGATGAAGC...................................................................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...................................................................................................................................................................................................ACCAGGAGGGCCGTGTGG..................................... | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ................................................................................................................................................................................AAAGTATCATGTCCTTCCCAC..................................................... | 21 | 1 | 1.00 | 1.00 | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 
| .......................................................................................................................................CTGGGGAAGGCAGGAACTAAGGATGTCA....................................................................................... | 28 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 
| .........................................................................................................................................................................................................AGGGCCGTGTAGCCATTACGAGG.......................... | 23 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 
| ......................................................................................................TTGGGAGACAATGTCAG................................................................................................................................... | 17 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | |
| .......................................................................................................................................CTGGGGAAGGCAGGAACTA................................................................................................ | 19 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 
| .......................................................................................................................................CTGGGGAAGGCAGGAAC.................................................................................................. | 17 | 2 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 
| ......................................................................................................................................CCTGGGGAAGGCAGGAACTAAGGAT........................................................................................... | 25 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 
| ................................................................................................................................................................................AAAGTATCATGTCCTTCCCACCAT.................................................. | 24 | 1.00 | 0.00 | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ........................................................................................................................................TGGGGAAGGCAGGAACTAAGGT............................................................................................ | 22 | 1 | 1.00 | 17.00 | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 
| ..............................................................................................TGCTAAGCTTGGGAGACAATGTCACT.................................................................................................................................. | 26 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 
| ...................................................................................................................................................................................................ACCAGGAGGGCCGTGTGGGT................................... | 20 | 1.00 | 0.00 | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..............................................................................GCTGAACTTCCTGCTCTGC......................................................................................................................................................... | 19 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 
| ......TAGCACATGGCTCAGCTGAGGCTGG........................................................................................................................................................................................................................... | 25 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | 
| ........................................................................................CTGCTCTGCTAAGCTTGGGAGACAATGT...................................................................................................................................... | 28 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 
| ........................................................................................................................................TGGGGAAGGCAGGAACTAATG............................................................................................. | 21 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 
| ......................................................................................................................................................................AGAATGCCCCAAAGTATCATGTCCTTCC........................................................ | 28 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 
| ......................................................................................................................................CCTGGGGAAGGCAGGAACTAAGGA............................................................................................ | 24 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 
| .......................................................................................................................................................................................................................ATTACGAGGGTGGCCAACC................ | 19 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 
| .......................................................................................................................................CTGGGGAAGGCAGGAACTAAGGATG.......................................................................................... | 25 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 
| ........................................................................................................................................TGGGGAAGGCAGGAACTAAGGATGT......................................................................................... | 25 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 
| .............TGGCTCAGCTGAGGCTGCTCT........................................................................................................................................................................................................................ | 21 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..........................................................................................................................................GGGAAGGCAGGAACTAAGGATT.......................................................................................... | 22 | 1.00 | 0.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...................................................................................................................................................GGAACTAAGGATGTCAAGCAGAATGCCC........................................................................... | 28 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | 
| ........................................................................................................................................TGGGGAAGGCAGGAACTAA............................................................................................... | 19 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 
| .......................................................................................................................................CTGGGGAAGGCAGGAACTAAG.............................................................................................. | 21 | 1 | 1.00 | 1.00 | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 
| ...................................................................................................................................................................................................................AGCCATTACGAGGGTGGCCAACCTT.............. | 25 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 
| ........................................................................................................................................TGGGGAAGGCAGGAACTAAA.............................................................................................. | 20 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 
| ..................................................................................................................................................AGGAACTAAGGATGTCAAGCAGA................................................................................. | 23 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 
| .......................................................................................................................................CTGGGGAAGGCAGGAACTAATGT............................................................................................ | 23 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ......................................................................................................................................CCTGGGGAAGGCAGGAACTAAGG............................................................................................. | 23 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 
| ..............................................................................................................................AGAGGAACCCTGGGGAAGGCAGGAACTAAGGATGTCAAGCAGAATGCCCCAAAGTATCATGTCCTTCCCACCAG.................................................. | 74 | 1 | 1.00 | 1.00 | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 
| ........................................................................................................................................TGGGGAAGGCAGGAACTAAGGAAA.......................................................................................... | 24 | 1 | 1.00 | 3.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 
| .......................................................................................................................TAGGACCAGAGGAACC................................................................................................................... | 16 | 2 | 0.50 | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.50 | - | 
| .....................................................................................................................................................................................................................................CAACCTTCTGCTATGT..... | 16 | 3 | 0.33 | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 
| CTTGGTTAGCACATGGCTCAGCTGAGGCTGGAATCCAGTTTCAGACCCCCATGTCTTAAATGCTGGGCAGAGCTCCTAGCTGAACTTCCTGCTCTGCTAAGCTTGGGAGACAATGTCACTAGGACCAGAGGAACCCTGGGGAAGGCAGGAACTAAGGATGTCAAGCAGAATGCCCCAAAGTATCATGTCCTTCCCACCAGGAGGGCCGTGTAGCCATTACGAGGGTGGCCAACCTTCTGCTATGTATGTA .......................................................................................................................................((((((((((((.(((((..((...((.....))...))....))).)).)).)))))))..))).................................................. ...................................................................................................................................132.................................................................200................................................ | Size | Perfect hit | Total Norm | Perfect Norm | SRR391848(GSM852143) gender: femalegenotype/variation: wild typeti. (embryo) | SRR279907(GSM689057) cell type: mouse embryonic stem cellcell line. (ESC) | SRR546155(SRX180174) Global profiling of miRNA and the hairpin pre. (ago2 Neuroblastoma) | SRR391852(GSM852147) gender: femalegenotype/variation: ADAR2-/-tis. (embryo) | SRR346421(SRX098263) Global profiling of miRNA and the hairpin pre. (mixture) | SRR039154(GSM471931) HL1_siSrf2_smallRNAseq. (muscle) | SRR345198(SRX097259) source: size fractionated RNA from mouse hipp. (brain) | SRR345207(SRX097268) source: size fractionated RNA from mouse hipp. (brain) | SRR391851(GSM852146) gender: femalegenotype/variation: wild typeti. (embryo) | SRR553583(SRX182789) source: Cerebellum. (Cerebellum) | SRR042463(GSM539855) mouse natural killer cells [09-002]. (spleen) | SRR345204(SRX097265) source: size fractionated RNA from mouse hipp. (brain) | SRR042488(GSM539880) mouse BclXL germinal center B cells [BalbC] [09-002]. (B cell) | SRR042473(GSM539865) mouse nTreg cells [09-002]. (lymph) | SRR391850(GSM852145) gender: femalegenotype/variation: ADAR2-/-/AD. (embryo) | SRR345202(SRX097263) source: size fractionated RNA from mouse hipp. (brain) | SRR345203(SRX097264) source: size fractionated RNA from mouse hipp. (brain) | SRR034119(GSM466729) Mili IP_Tdrd9+/- replicate2. (mili testes) | SRR042471(GSM539863) mouse TFHS cells [09-002]. (spleen) | Ago2IP504(Rui) Quantitative functions of Argonaute proteins . (ago2 skin) | SRR060845(GSM561991) total RNA. (brain) | SRR042487(GSM539879) mouse BclXL B activated with LPS/IL4 [BalbC] [09-002]. (spleen) | SRR042477(GSM539869) mouse brain tissue [09-002]. (brain) | SRR042469(GSM539861) mouse Th2 cells [09-002]. (lymph) | SRR042458(GSM539850) mouse basophil cells [09-002]. (b cell) | SRR306532(GSM750575) 19-24nt. (ago2 brain) | SRR042474(GSM539866) mouse embryonic stem cells [09-002]. (ESC) | SRR525243(SRA056111/SRX170319) Mus musculus domesticus miRNA sequencing. (ago2 Blood) | SRR042445(GSM539837) mouse immature B cells [09-002]. (b cell) | SRR034120(GSM466730) Mili IP_Tdrd9-/- replicate1. (mili testes) | SRR248523(GSM733811) cell type: Thy1+ spermatogonial stem cellstra. (testes) | SRR346416(SRX098257) Global profiling of miRNA and the hairpin pre. (Kidney) | SRR073954(GSM629280) total RNA. (blood) | SRR029042(GSM433294) 18.5dpc_hetero_tdrd1-KO. (tdrd1 testes) | SRR028732(GSM400969) Mili-Tdrd1 KO associated. (mili testes) | SRR042447(GSM539839) mouse mature B cells (spleen) replicate 2 [09-002]. (b cell) | SRR346417(SRX098258) Global profiling of miRNA and the hairpin pre. (Brain) | SRR040489(GSM533912) E18.5 Ago2 catalytically inactive LIVER small RNA. (ago2 liver) | SRR042467(GSM539859) mouse T cells activated in vitro with Concanavalin A [09-002]. (spleen) | mjTestesKO7() Testes Data. (Zcchc11 testes) | SRR391849(GSM852144) gender: femalegenotype/variation: ADAR2-/-tis. (embryo) | SRR346418(SRX098259) Global profiling of miRNA and the hairpin pre. (Liver) | SRR042459(GSM539851) mouse neutrophil cells replicate 1 [09-002]. (blood) | SRR042451(GSM539843) mouse B cells activated in vitro with LPS/aIgD-Dextran [09-002]. (b cell) | SRR042443(GSM539835) mouse pro B cells [09-002]. (b cell) | SRR039153(GSM471930) HL1_siSrf1_smallRNAseq. (muscle) | SRR042468(GSM539860) mouse Th1 cells [09-002]. (lymph) | SRR039152(GSM471929) HL1_siNon_smallRNAseq. (muscle) | SRR042446(GSM539838) mouse mature B cells (spleen) replicate 1 [09-002]. (b cell) | SRR248524(GSM733812) cell type: Thy1+ spermatogonial stem cellstra. (testes) | SRR069809(GSM610965) small RNA sequencing; sample 1. (testes) | SRR553602(SRX182808) source: Sertoli cells. (Sertoli cells) | SRR028730(GSM400967) Tdrd1-associated. (tdrd1 testes) | SRR029039(GSM433291) 25dpp_homo_tdrd6-KO. (tdrd6 testes) | SRR391845(GSM852140) gender: femalegenotype/variation: wild typeti. (embryo) | SRR032477(GSM485235) sRNA_activation_deep_sequencing. (uterus) | mjTestesWT3() Testes Data. (testes) | SRR037909(GSM510446) newborn_rep2. (total RNA) | SRR391853(GSM852148) gender: femalegenotype/variation: ADAR2-/-/AD. (embryo) | SRR037906(GSM510442) brain_rep3. (brain) | SRR042465(GSM539857) mouse CD4+ T cells (spleen) [09-002]. (spleen) | SRR346419(SRX098260) Global profiling of miRNA and the hairpin pre. (Lung) | mjTestesKO8() Testes Data. (Zcchc11 testes) | 
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ........................................................................................................GGGAGACAATGTCACTAGGACCAGA......................................................................................................................... | 25 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | 
| ..............................................................................................................................................................................CCAAAGTATCATGTCCTTCCCACCAGGA................................................ | 28 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 
| .....................................................................................................................................................................................................................................CAACCTTCTGCTATGCTGG.. | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...................................................................................ACTTCCTGCTCTGCTACT..................................................................................................................................................... | 18 | 1.00 | 0.00 | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .....................................................................................................................................................................................................................................CAACCTTCTGCTATGCT.... | 17 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ................................................CCATGTCTTAAATGCTGGGCAGAGCTCCT............................................................................................................................................................................. | 29 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 
| ..............................................................................................................................................................................................................................GGGTGGCCAACCTTCGGG.......... | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..................................................................................................................................................................................AGTATCATGTCCTTCCC....................................................... | 17 | 3 | 0.33 | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.33 |