ID: uc008mja.5
GENE: Vps16(6)
chr2:130264371-130264568+


(13)
AGO2.ip 		(1)
AGO3.ip 		(13)
B-CELL 		(26)
BRAIN 		(3)
CELL-LINE 		(2)
DCR.mut 		(1)
DGCR8.mut 		(9)
EMBRYO 		(7)
ESC 		(5)
FIBROBLAST 		(1)
HEART 		(2)
KIDNEY 		(4)
LIVER 		(2)
LUNG 		(5)
LYMPH 		(22)
OTHER 		(7)
OTHER.mut 		(1)
OVARY 		(1)
PIWI.ip 		(3)
PIWI.mut 		(3)
SKIN 		(8)
SPLEEN 		(23)
TESTES 		(1)
THYMUS 		(3)
TOTAL-RNA 		(3)
UTERUS

Sense strand
CTGTAGGACCCGATCTTTACCTTCTGGATCATGCTACCTGCTCTGCAGTGGTGAGAACCTAAGTGGGAATGAAATGGAAGGGCTGGTCAACAAGTAGGAAGGCATTGAGAAGTCAGTTTATCTGGTTTCCTCCTTGGTCCTGCCCCAGACACCTGCTGGCTTAGCCCCAGGAGTGAGCAGCTTCCTACAGATGGCTGT
...............................................................................((((.((....((((.((((((.((...(((......)))...)).)))))).))))..)).)))).....................................................
........................................................................73.........................................................................148................................................
SizePerfect hitTotal NormPerfect NormSRR546155(SRX180174)
Global profiling of miRNA and the hairpin pre. (ago2 Neuroblastoma)		SRR553602(SRX182808)
source: Sertoli cells. (Sertoli cells)		SRR553583(SRX182789)
source: Cerebellum. (Cerebellum)		SRR553582(SRX182788)
source: Brain. (Brain)		SRR346425(SRX098267)
Global profiling of miRNA and the hairpin pre. (Neuroblastoma)		SRR042469(GSM539861)
mouse Th2 cells [09-002]. (lymph)		SRR346424(SRX098266)
Global profiling of miRNA and the hairpin pre. (Neuroblastoma)		mjTestesWT4()
Testes Data. (testes)		SRR402760(SRX117943)
source: ES E14 male cells. (ESC)		SRR042447(GSM539839)
mouse mature B cells (spleen) replicate 2 [09-002]. (b cell)		SRR042471(GSM539863)
mouse TFHS cells [09-002]. (spleen)		SRR042470(GSM539862)
mouse Th17 cells [09-002]. (lymph)		SRR346423(SRX098265)
Global profiling of miRNA and the hairpin pre. (Brain)		mjTestesWT3()
Testes Data. (testes)		SRR345207(SRX097268)
source: size fractionated RNA from mouse hipp. (brain)		SRR402762(SRX117945)
source: ES E14 male cells. (ESC)		SRR042468(GSM539860)
mouse Th1 cells [09-002]. (lymph)		mjTestesWT1()
Testes Data. (testes)		SRR042446(GSM539838)
mouse mature B cells (spleen) replicate 1 [09-002]. (b cell)		SRR346421(SRX098263)
Global profiling of miRNA and the hairpin pre. (mixture)		SRR042458(GSM539850)
mouse basophil cells [09-002]. (b cell)		SRR042454(GSM539846)
mouse germinal center B cells (lymph node) [09-002]. (b cell)		mjLiverWT3()
Liver Data. (liver)		SRR346417(SRX098258)
Global profiling of miRNA and the hairpin pre. (Brain)		SRR042450(GSM539842)
mouse B cells activated in vitro with LPS/IL4 replicate 3 [09-002]. (b cell)		SRR042472(GSM539864)
mouse iTreg cells [09-002]. (lymph)		SRR279907(GSM689057)
cell type: mouse embryonic stem cellcell line. (ESC)		SRR394084(GSM855970)
background strain: C57BL6/SV129cell type: KRa. (dicer cell line)		SRR042459(GSM539851)
mouse neutrophil cells replicate 1 [09-002]. (blood)		SRR039154(GSM471931)
HL1_siSrf2_smallRNAseq. (muscle)		SRR390300(GSM849858)
cell line: NIH-3T3cell type: fibroblastinfect. (ago2 fibroblast)		SRR042456(GSM539848)
mouse hematopoetic progenitor cells [09-002]. (bone marrow)		SRR042443(GSM539835)
mouse pro B cells [09-002]. (b cell)		SRR248524(GSM733812)
cell type: Thy1+ spermatogonial stem cellstra. (testes)		SRR248526(GSM733814)
cell type: Thy1- spermatogonial stem cellstra. (testes)		SRR248523(GSM733811)
cell type: Thy1+ spermatogonial stem cellstra. (testes)		SRR391851(GSM852146)
gender: femalegenotype/variation: wild typeti. (embryo)		SRR391847(GSM852142)
gender: femalegenotype/variation: ADAR2-/-/AD. (embryo)		GSM510444(GSM510444)
brain_rep5. (brain)		SRR042457(GSM539849)
mouse mast cells [09-002]. (bone marrow)		SRR042448(GSM539840)
mouse B cells activated in vitro with LPS/IL4 replicate 1 [09-002]. (b cell)		SRR042451(GSM539843)
mouse B cells activated in vitro with LPS/aIgD-Dextran [09-002]. (b cell)		mjTestesKO8()
Testes Data. (Zcchc11 testes)		SRR345205(SRX097266)
source: size fractionated RNA from mouse hipp. (brain)		SRR059769(GSM562831)
Treg_Drosha. (spleen)		SRR042477(GSM539869)
mouse brain tissue [09-002]. (brain)		SRR042449(GSM539841)
mouse B cells activated in vitro with LPS/IL4 replicate 2 [09-002]. (b cell)		SRR248525(GSM733813)
cell type: Thy1- spermatogonial stem cellstra. (testes)		SRR345204(SRX097265)
source: size fractionated RNA from mouse hipp. (brain)		SRR346414(SRX098255)
Global profiling of miRNA and the hairpin pre. (Spleen)		SRR042478(GSM539870)
mouse lung tissue [09-002]. (lung)		SRR391848(GSM852143)
gender: femalegenotype/variation: wild typeti. (embryo)		SRR042467(GSM539859)
mouse T cells activated in vitro with Concanavalin A [09-002]. (spleen)		SRR042488(GSM539880)
mouse BclXL germinal center B cells [BalbC] [09-002]. (B cell)		SRR391853(GSM852148)
gender: femalegenotype/variation: ADAR2-/-/AD. (embryo)		SRR391846(GSM852141)
gender: femalegenotype/variation: ADAR2-/-tis. (embryo)		SRR042444(GSM539836)
mouse pre B cells [09-002]. (b cell)		SRR390299(GSM849857)
cell line: NIH-3T3cell type: fibroblastip ant. (ago2 fibroblast)		SRR032477(GSM485235)
sRNA_activation_deep_sequencing. (uterus)		SRR042453(GSM539845)
mouse marginal zone B cells (spleen) [09-002]. (b cell)		SRR248527(GSM733815)
cell type: spermatogonial stem cell enriched . (testes)		SRR279904(GSM689054)
cell type: mouse embryonic stem cellcell line. (ESC)		GSM475280(GSM475280)
Mili-IP. (mili testes)		SRR345203(SRX097264)
source: size fractionated RNA from mouse hipp. (brain)		SRR028732(GSM400969)
Mili-Tdrd1 KO associated. (mili testes)		SRR042462(GSM539854)
mouse macrophages [09-002]. (bone marrow)		SRR042466(GSM539858)
mouse CD8+ T cells (spleen) [09-002]. (spleen)		SRR069809(GSM610965)
small RNA sequencing; sample 1. (testes)		SRR042463(GSM539855)
mouse natural killer cells [09-002]. (spleen)		SRR042483(GSM539875)
mouse muscle tissue [09-002]. (muscle)		SRR042460(GSM539852)
mouse neutrophil cells replicate 2 [09-002]. (blood)		SRR553585(SRX182791)
source: Kidney. (Kidney)		SRR306540(GSM750583)
19-24nt. (ago2 brain)		SRR402766(SRX117949)
source: ES PGK female cells. (ESC)		SRR073955(GSM629281)
total RNA. (blood)		SRR042487(GSM539879)
mouse BclXL B activated with LPS/IL4 [BalbC] [09-002]. (spleen)		SRR345196(SRX097257)
source: size fractionated RNA from mouse hipp. (brain)		SRR038742(GSM527277)
small RNA-Seq. (dgcr8 brain)		SRR553586(SRX182792)
source: Testis. (testes)		SRR279906(GSM689056)
cell type: mouse embryonic stem cellcell line. (ESC)		SRR039152(GSM471929)
HL1_siNon_smallRNAseq. (muscle)		mjLiverKO3()
Liver Data. (Zcchc11 liver)		SRR042473(GSM539865)
mouse nTreg cells [09-002]. (lymph)		SRR042461(GSM539853)
mouse dendritic cells [09-002]. (bone marrow)		SRR042475(GSM539867)
mouse embryonic fibroblast cells [09-002]. (fibroblast)		SRR029037(GSM433289)
18dpp_homo_tdrd6-KO. (tdrd6 testes)		Ago3IP805(Rui)
Quantitative functions of Argonaute proteins . (ago3 skin)		SRR345202(SRX097263)
source: size fractionated RNA from mouse hipp. (brain)		SRR402761(SRX117944)
source: ES E14 male cells. (ESC)		Ago2IP517(Rui)
Quantitative functions of Argonaute proteins . (ago2 skin)		SRR306541(GSM750584)
19-24nt. (ago2 brain)		SRR346419(SRX098260)
Global profiling of miRNA and the hairpin pre. (Lung)		SRR042445(GSM539837)
mouse immature B cells [09-002]. (b cell)		SRR042464(GSM539856)
mouse CD4+CD8+ T cells (thymus) [09-002]. (thymus)		SRR065052(SRR065052)
Tissue-specific Regulation of Mouse MicroRNA . (jejunum)		GSM509280(GSM509280)
small RNA cloning by length. (testes)		SRR306539(GSM750582)
19-24nt. (ago2 brain)		SRR206939(GSM723280)
other. (brain)		GSM509278(GSM509278)
small RNA cloning by length. (piwi testes)		SRR039186(GSM485326)
shLuc.1309;ROSA-rtTA (+dox). (fibroblast)		SRR029039(GSM433291)
25dpp_homo_tdrd6-KO. (tdrd6 testes)		SRR391845(GSM852140)
gender: femalegenotype/variation: wild typeti. (embryo)		SRR553604(SRX182810)
source: Spermatocytes. (Spermatocytes)		Ago2IP504(Rui)
Quantitative functions of Argonaute proteins . (ago2 skin)		SRR346420(SRX098261)
Global profiling of miRNA and the hairpin pre. (Uterus)		mjTestesKO5()
Testes Data. (Zcchc11 testes)		SRR037921(GSM510459)
e12p5_rep3. (embryo)		SRR014231(GSM319955)
16.5 dpc total. (testes)		SRR069810(GSM610966)
small RNA sequencing; sample 2. (testes)		SRR346422(SRX098264)
Global profiling of miRNA and the hairpin pre. (Muscle)		SRR206940(GSM723281)
other. (brain)		GSM510456(GSM510456)
newborn_rep12. (total RNA)		SRR037914(GSM510451)
newborn_rep7. (total RNA)		SRR685339(GSM1079783)
Small RNAs (15-50 nts in length) from immorta. (cell line)		SRR038744(GSM527279)
small RNA-Seq. (brain)		SRR306533(GSM750576)
19-24nt. (ago2 brain)		GSM640581(GSM640581)
small RNA in the liver with paternal control. (liver)		SRR553584(SRX182790)
source: Heart. (Heart)		SRR391849(GSM852144)
gender: femalegenotype/variation: ADAR2-/-tis. (embryo)		SRR038743(GSM527278)
small RNA-Seq. (dicer brain)		SRR039183(GSM485323)
shLuc.1309 (-dox). (fibroblast)		SRR346418(SRX098259)
Global profiling of miRNA and the hairpin pre. (Liver)		GSM509277(GSM509277)
small RNA cloning by length. (piwi testes)		SRR042486(GSM539878)
mouse ovaries [09-002]. (ovary)		SRR038741(GSM527276)
small RNA-Seq. (brain)		GSM510453(GSM510453)
newborn_rep9. (total RNA)		SRR525242(SRA056111/SRX170318)
Mus musculus domesticus miRNA sequencing. (ago2 Blood)		SRR306535(GSM750578)
19-24nt. (ago2 brain)		SRR042465(GSM539857)
mouse CD4+ T cells (spleen) [09-002]. (spleen)		SRR042455(GSM539847)
mouse plasma cells [09-002]. (blood)		mjTestesKO7()
Testes Data. (Zcchc11 testes)		SRR306537(GSM750580)
19-24nt. (ago2 brain)		SRR073954(GSM629280)
total RNA. (blood)		SRR346416(SRX098257)
Global profiling of miRNA and the hairpin pre. (Kidney)		SRR032476(GSM485234)
sRNA_delayed_deep_sequencing. (uterus)		SRR029036(GSM433288)
18dpp_hetero_tdrd6-KO. (tdrd6 testes)		SRR060845(GSM561991)
total RNA. (brain)		SRR023848(GSM307157)
mEFsmallrna_rep1. (cell line)		SRR206941(GSM723282)
other. (brain)		SRR391852(GSM852147)
gender: femalegenotype/variation: ADAR2-/-tis. (embryo)		SRR306544(GSM750587)
19-24nt. (ago2 brain)
.............................................................................AAGGGCTGGTCAACAAGTAGGA...................................................................................................221138.00138.0015.0010.007.004.006.003.004.004.001.001.00--3.001.006.006.00--1.00-2.00--2.002.002.001.00-1.001.00-2.001.00-2.00-1.00-1.00-1.001.001.003.002.001.00-1.004.00--1.00----2.00-2.001.00-1.00-2.00--1.00---1.001.001.00-----1.00-1.00-1.001.00-1.002.00---1.00-1.00-1.00---1.001.00------1.00--1.001.00-----------1.001.00--1.00---1.00--1.00--1.00----
.............................................................................AAGGGCTGGTCAACAAGTAGG....................................................................................................21181.0081.0018.002.007.004.003.003.001.00---1.001.004.004.00-1.001.00----1.005.00--2.00--1.00-----1.001.001.00--2.00--2.00-------------1.00---1.00-----1.00--1.00-------1.00-------------1.00---1.001.00-----------1.00--1.00------------1.001.00-1.001.00--1.00---------
.............................................................................AAGGGCTGGTCAACAAGTAGGAAG.................................................................................................24172.0072.0015.0011.00-4.001.001.001.00-6.001.003.003.00---1.00--1.00-1.002.00-1.00--1.00---1.00---------2.00-1.00----1.00-1.001.00------1.00--1.002.00------1.00------1.00-------1.00------------------1.00--1.00-1.00------1.00-----------------1.00--------
.............................................................................AAGGGCTGGTCAACAAGTAGGAA..................................................................................................23164.0064.004.004.003.00-1.003.003.003.00-2.00-1.00--1.00-2.00-1.00-1.001.001.00--2.00--1.002.00--2.00----1.00--1.001.00---1.001.00--1.00--2.001.001.00--2.001.001.00----------1.001.00-1.00----1.00-1.00-1.00-1.00----------------1.00-----------------1.001.00----------------1.001.00--
.............................................................................AAGGGCTGGTCAACAAGTAG.....................................................................................................20135.0035.001.00-3.003.00-1.00---2.003.003.001.00----8.00--1.00-------1.00----------1.00-1.00-1.001.00---------------------------1.00--------------2.00---------1.00-------------------------------------------
.............................................................................AAGGGCTGGTCAACAAGTAGGAAGT................................................................................................25126.0072.002.006.00--2.001.003.00-----------1.00-2.00---1.00------2.00---1.001.00----1.00----------------------------------------------1.00----------------------------1.00----------------1.00------
..............................................................................AGGGCTGGTCAACAAGTAGGAAG.................................................................................................23121.0021.001.00-1.00-----4.00-1.00-----1.00------1.001.00-3.00----1.001.00------1.00------------1.00------------------------1.00---1.00------1.00----------------------------------------1.00-----------
..............................................................................AGGGCTGGTCAACAAGTAGGAAGG................................................................................................24114.0014.003.00------5.00--------1.00---------1.00--------------------1.00-1.00-1.00-------1.00---------------------------------------------------------------------------------
.............................................................................AAGGGCTGGTCAACAAGTAGGAAA.................................................................................................24111.0064.002.00--1.00-----1.00-1.00----1.00-1.00-----1.00-------------1.00--------------------------1.00--1.00------------------------------------------------------------------------
..................................................GTGAGAACCTAAGTGGGAATGAAATGGAAGGGCTGGTCAACAAGTAGGAAGGCATTGAGAAGTCAGTTT...............................................................................6917.007.00-------------------7.00-------------------------------------------------------------------------------------------------------------------------
.................TACCTTCTGGATCATGCTACCTGCTC...........................................................................................................................................................2616.006.00---------------------------6.00-----------------------------------------------------------------------------------------------------------------
..............................................................................AGGGCTGGTCAACAAGTAGGA...................................................................................................2116.006.00---1.00------1.00----------1.00-------------------------------1.00-------------1.00-1.00-----------------------------------------------------------------------
..................................................GTGAGAACCTAAGTGGGAATGAAATGG.........................................................................................................................2716.006.00---------------------------------2.001.001.00-----------1.00----------------1.00----------------------------------------------------------------------------
..............................................................................AGGGCTGGTCAACAAGTAGG....................................................................................................2015.005.00--2.00-1.00--------1.00-----------------------------------------------------------------------------------------------------1.00-------------------------
..............................................................................AGGGCTGGTCAACAAGTAG.....................................................................................................1914.004.00---1.00----------1.00-------------1.00------------------------1.00---------------------------------------------------------------------------------------
.............................................................................................................................TTTCCTCCTTGGTCCTGCCC.....................................................2014.004.001.00-----------------------------3.00--------------------------------------------------------------------------------------------------------------
.............................................................................AAGGGCTGGTCAACAAGTAGGAAT.................................................................................................2413.0064.00---1.00-----------------1.00------1.00----------------------------------------------------------------------------------------------------------------
..............................................................................AGGGCTGGTCAACAAGTAGGAA..................................................................................................2213.003.00----1.00----1.00-------------1.00---------------------------------------------------------------------------------------------------------------------
..............................................................................................................................TTCCTCCTTGGTCCTGCCCCAGT.................................................233.000.002.00--------------------------------------------------------------------------1.00-----------------------------------------------------------------
............................................................................GAAGGGCTGGTCAACAAGTAGGA...................................................................................................2313.003.001.00-----------------------------------1.00-----------------------------------------------1.00--------------------------------------------------------
.............................................................................AAGGGCTGGTCAACAAGTAGGAAGGT...............................................................................................2613.003.003.00--------------------------------------------------------------------------------------------------------------------------------------------
...............................................................................................................................TCCTCCTTGGTCCTGCCCCAGT.................................................223.000.00----------------1.00---------------------------1.00---------1.00--------------------------------------------------------------------------------------
.............................................................................AAGGGCTGGTCAACAAGTAGGT...................................................................................................2213.0081.00-1.00----------------1.00-------------------------------------------------------------------------------------1.00------------------------------------
.............................................................................AAGGGCTGGTCAACAAGTAGGAAGG................................................................................................2513.003.001.002.00-------------------------------------------------------------------------------------------------------------------------------------------
.....................TTCTGGATCATGCTACCTGCTCTGCA.......................................................................................................................................................2613.003.00-------------------------------------------------------3.00-------------------------------------------------------------------------------------
.............................................................................AAGGGCTGGTCAACAAGTAGGAT..................................................................................................2312.00138.00------------------1.00-------------------------------1.00------------------------------------------------------------------------------------------
..................................................GTGAGAACCTAAGTGGGAATGAAATGGA........................................................................................................................2812.002.00---------------------------------2.00-----------------------------------------------------------------------------------------------------------
.......................CTGGATCATGCTACCTGCTCTGCAGTG....................................................................................................................................................2712.002.00---------------------1.00---------------------------------------------1.00-------------------------------------------------------------------------
.............................................................................AAGGGCTGGTCAACAAGTAGTAA..................................................................................................2312.0035.00-----1.00---------------------------------------1.00-----------------------------------------------------------------------------------------------
...............TTTACCTTCTGGATCATGCTACCTGC.............................................................................................................................................................2612.002.00-------------------------------------------------------------------------------2.00-------------------------------------------------------------
..............................................................................AGGGCTGGTCAACAAGTAGGAAGGT...............................................................................................2512.0014.00------1.00---------------------------------------1.00----------------------------------------------------------------------------------------------
..................................................GTGAGAACCTAAGTGGGAATGAAATG..........................................................................................................................2612.002.00----------------------------------1.001.00---------------------------------------------------------------------------------------------------------
...............................................................................................AGGAAGGCATTGAGAAGTCAGT.................................................................................2212.002.00-------------------------------------2.00-------------------------------------------------------------------------------------------------------
......................TCTGGATCATGCTACCTGCTCTGCAGT.....................................................................................................................................................2712.002.00-------------2.00-------------------------------------------------------------------------------------------------------------------------------
......................TCTGGATCATGCTACCTGCTCTGCAGTG....................................................................................................................................................2811.001.00-----------------------------------1.00---------------------------------------------------------------------------------------------------------
..............................................................................AGGGCTGGTCAACAAGTAGGAAGT................................................................................................2411.0021.00------------1.00--------------------------------------------------------------------------------------------------------------------------------
..............................................................................AGGGCTGGTCAACAAGTAGGAAGGTACT............................................................................................2811.0014.00---------------------------------1.00-----------------------------------------------------------------------------------------------------------
............................................................................GAAGGGCTGGTCAACAAGTAG.....................................................................................................2111.001.00----------1.00----------------------------------------------------------------------------------------------------------------------------------
..............................................................................................................................................................GCTTAGCCCCAGGAGTGAGCAGCTTC..............2611.001.00---------------------------------------------------------------------------------------------------------------------------------------1.00-----
.............................................................................AAGGGCTGGTCAACAAGCAGG....................................................................................................211.000.00----1.00----------------------------------------------------------------------------------------------------------------------------------------
.............................................................................AAGGGCTGGTCAACAAGTAT.....................................................................................................201.000.00-----1.00---------------------------------------------------------------------------------------------------------------------------------------
..............................................................................AGGGCTGGTCAACAAGTAGGAT..................................................................................................2211.006.00-----------------------1.00---------------------------------------------------------------------------------------------------------------------
.............................................................................AAGGGCTGGTCAACAAGTAGGAAGTAT..............................................................................................2711.0072.00---------------------------------------------------------------------------------------------1.00-----------------------------------------------
.............................................................................AAGGGCTGGTCAACAAGTAGA....................................................................................................2111.0035.00---1.00-----------------------------------------------------------------------------------------------------------------------------------------
.............................................................................................................................................................................TGAGCAGCTTCCTACAGATGGC...2211.001.00-------------------------------------1.00-------------------------------------------------------------------------------------------------------
.............................................................................AAGGGCTGGTCAACAAGTAGGAC..................................................................................................2311.00138.001.00--------------------------------------------------------------------------------------------------------------------------------------------
..............................................................................................TAGGAAGGCATTGAGAAGTCAGTT................................................................................2411.001.00----------------------------------------------1.00----------------------------------------------------------------------------------------------
.....................................................................................GTCAACAAGTAGGAAGGCATTGAGAA.......................................................................................2611.001.00--------------------------------------------------------------1.00------------------------------------------------------------------------------
.............................................................................AAGGGCTGGTCAACAAGTAGGTTA.................................................................................................2411.0081.00------------------1.00--------------------------------------------------------------------------------------------------------------------------
...TAGGACCCGATCTTTACCTTCT.............................................................................................................................................................................2211.001.00--------------------------------------------------------------1.00------------------------------------------------------------------------------
..............................................................................................................................TTCCTCCTTGGTCCTGCCCCAGA.................................................2311.001.00--------------------------------------1.00------------------------------------------------------------------------------------------------------
.............................................................................AAGGGCTGGTCAACAAGTAGAA...................................................................................................2211.0035.00---------1.00-----------------------------------------------------------------------------------------------------------------------------------
.................................................................................................................................................CAGACACCTGCTGGCGCT...................................181.000.00----------------------------------------------------------------------------1.00----------------------------------------------------------------
..............................................................................................................................TTCCTCCTTGGTCCTGCCCCAGTT................................................241.000.001.00--------------------------------------------------------------------------------------------------------------------------------------------
.............................................................................AAGGGCTGGTCAACAAGTAGGG...................................................................................................2211.0081.00---------------------------------------------------------------------------------1.00-----------------------------------------------------------
.............................................................................AAGGGCTGGTCAACAAGTGGGA...................................................................................................221.000.00--------------------------------------1.00------------------------------------------------------------------------------------------------------
.............................................................................AAGGGCTGGTCAACAAGTAGGC...................................................................................................2211.0081.00-------------------------------------------------------------------------------------------------------1.00-------------------------------------
.............................................................................................................................TTTCCTCCTTGGTCCTGCCCCAAT.................................................2411.001.00---------------------------------------------------1.00-----------------------------------------------------------------------------------------
.............................................................................AAGGGCTGGTCAACAAGTATGA...................................................................................................221.000.00---------1.00-----------------------------------------------------------------------------------------------------------------------------------
..............................................................................AGGGCTGGTCAACAAGTAGGAAGGCAT.............................................................................................2711.001.00----------------------------------------------------------------1.00----------------------------------------------------------------------------
............................................................................................................................................................TGGCTTAGCCCCAGGAGTGAGCAGC.................2511.001.00-------------------------------------------------------------------------------------1.00-------------------------------------------------------
..................................................GTGAGAACCTAAGTGGGAAT................................................................................................................................2011.001.00-------------------------------------------------------------------------------------------------------------------------------------------1.00-
...TAGGACCCGATCTTTACCTTCTGGATCATGC....................................................................................................................................................................3111.001.00------------------------------------------------------------1.00--------------------------------------------------------------------------------
........................................................................................................................................................................AGGAGTGAGCAGCTTCCTACAGATGGCT..2811.001.00----------------------------------------------1.00----------------------------------------------------------------------------------------------
..................................................................................................................................................................AGCCCCAGGAGTGAGCAGCTTCCT............2411.001.00----------------------------------------------------------------------------------------------------------------------1.00----------------------
.............................................................................................................................TTTCCTCCTTGGTCCTGCCCCAGA.................................................2411.001.00-------------------------------------------------------------------------1.00-------------------------------------------------------------------
..............................................................................................................................TTCCTCCTTGGTCCTGCCCCTTT.................................................231.000.00-----------------------------------------------------------------------------------------1.00---------------------------------------------------
...............TTTACCTTCTGGATCATGCTACCTGCTCT..........................................................................................................................................................2911.001.00----------------------------------------------------------------------------------------------------1.00----------------------------------------
.............................................................................................................AAGTCAGTTTATCTGATC.......................................................................181.000.00--------------------------------------------------------------------------------------------------------------------1.00------------------------
.............................................................................AAGGGCTGGTCAACAAGTATT....................................................................................................211.000.00----------------1.00----------------------------------------------------------------------------------------------------------------------------
.............................................................................AAGGGCTGGTCAACAAGTATGAA..................................................................................................231.000.00------------------------1.00--------------------------------------------------------------------------------------------------------------------
.............................................................................AAGGGCTGGTCAACAAGTAGGAAGTT...............................................................................................2611.0072.00----1.00----------------------------------------------------------------------------------------------------------------------------------------
...............................................................................................................................TCCTCCTTGGTCCTGCCCCAGTAA...............................................241.000.00-----------------------------1.00---------------------------------------------------------------------------------------------------------------
.............................................................................AAGGGCTGGTCAACAAGTAGGCA..................................................................................................2311.0081.00---------------------------------------------1.00-----------------------------------------------------------------------------------------------
.............................................................................AAGGGCTGGTCAACAAGTAGTAAG.................................................................................................2411.0035.00--------------------------------------------------1.00------------------------------------------------------------------------------------------
.............................................................................AAGGGCTGGTCAACAAGTAGGAAGGTAT.............................................................................................2811.003.001.00--------------------------------------------------------------------------------------------------------------------------------------------
............................................................................GAAGGGCTGGTCAACAAGTAGG....................................................................................................2211.001.00-----1.00---------------------------------------------------------------------------------------------------------------------------------------
.............................................................................AAGGGCTGGTCAACAAGTAGGTA..................................................................................................2311.0081.00-----------1.00---------------------------------------------------------------------------------------------------------------------------------
.........................................................................................................................................................................GGAGTGAGCAGCTTCTATG..........191.000.00----------------------------------------------------------------------------1.00----------------------------------------------------------------
.............................................................................AAGGGCTGGTCAACAAGTAGGTT..................................................................................................2311.0081.00--------------------------------1.00------------------------------------------------------------------------------------------------------------
...............................TGCTACCTGCTCTGCAGTGAC..................................................................................................................................................211.000.00-------------------------------------------------------------------------------------------------------------------------1.00-------------------
...............................................................................................................................TCCTCCTTGGTCCTGCCCCAA..................................................211.000.00-----------------------------------------------------------------------------------------------------------------1.00---------------------------
............................................................AAGTGGGAATGAAATGGAAGGGCT..................................................................................................................2411.001.00------------------------------------------------------1.00--------------------------------------------------------------------------------------
.............................................................................................................................TTTCCTCCTTGGTCCTGCCCCA...................................................2211.001.00------------------------------1.00--------------------------------------------------------------------------------------------------------------
..............................................................................AGGGCTGGTCAACAAGTACGA...................................................................................................211.000.00-----------------------------1.00---------------------------------------------------------------------------------------------------------------
.............................................................................AAGGGCTGGTCAACAAGTAGTAAA.................................................................................................2411.0035.00-----------------------------------------------------------------1.00---------------------------------------------------------------------------
.............................................................................AAGGGCTGGTCAACAAGGAG.....................................................................................................201.000.001.00--------------------------------------------------------------------------------------------------------------------------------------------
.......................................................................................................................ATCTGGTTTCCTCCTCCA.............................................................181.000.00----------------------------------------------------------------------------------------------------------------1.00----------------------------
.......................................................................................CAACAAGTAGGAAGGC...............................................................................................1620.500.50--------------------------------------------------------------------------------------------------------------------------------------------0.50

Antisense strand
CTGTAGGACCCGATCTTTACCTTCTGGATCATGCTACCTGCTCTGCAGTGGTGAGAACCTAAGTGGGAATGAAATGGAAGGGCTGGTCAACAAGTAGGAAGGCATTGAGAAGTCAGTTTATCTGGTTTCCTCCTTGGTCCTGCCCCAGACACCTGCTGGCTTAGCCCCAGGAGTGAGCAGCTTCCTACAGATGGCTGT
...............................................................................((((.((....((((.((((((.((...(((......)))...)).)))))).))))..)).)))).....................................................
........................................................................73.........................................................................148................................................
SizePerfect hitTotal NormPerfect NormSRR546155(SRX180174)
Global profiling of miRNA and the hairpin pre. (ago2 Neuroblastoma)		SRR553602(SRX182808)
source: Sertoli cells. (Sertoli cells)		SRR553583(SRX182789)
source: Cerebellum. (Cerebellum)		SRR553582(SRX182788)
source: Brain. (Brain)		SRR346425(SRX098267)
Global profiling of miRNA and the hairpin pre. (Neuroblastoma)		SRR042469(GSM539861)
mouse Th2 cells [09-002]. (lymph)		SRR346424(SRX098266)
Global profiling of miRNA and the hairpin pre. (Neuroblastoma)		mjTestesWT4()
Testes Data. (testes)		SRR402760(SRX117943)
source: ES E14 male cells. (ESC)		SRR042447(GSM539839)
mouse mature B cells (spleen) replicate 2 [09-002]. (b cell)		SRR042471(GSM539863)
mouse TFHS cells [09-002]. (spleen)		SRR042470(GSM539862)
mouse Th17 cells [09-002]. (lymph)		SRR346423(SRX098265)
Global profiling of miRNA and the hairpin pre. (Brain)		mjTestesWT3()
Testes Data. (testes)		SRR345207(SRX097268)
source: size fractionated RNA from mouse hipp. (brain)		SRR402762(SRX117945)
source: ES E14 male cells. (ESC)		SRR042468(GSM539860)
mouse Th1 cells [09-002]. (lymph)		mjTestesWT1()
Testes Data. (testes)		SRR042446(GSM539838)
mouse mature B cells (spleen) replicate 1 [09-002]. (b cell)		SRR346421(SRX098263)
Global profiling of miRNA and the hairpin pre. (mixture)		SRR042458(GSM539850)
mouse basophil cells [09-002]. (b cell)		SRR042454(GSM539846)
mouse germinal center B cells (lymph node) [09-002]. (b cell)		mjLiverWT3()
Liver Data. (liver)		SRR346417(SRX098258)
Global profiling of miRNA and the hairpin pre. (Brain)		SRR042450(GSM539842)
mouse B cells activated in vitro with LPS/IL4 replicate 3 [09-002]. (b cell)		SRR042472(GSM539864)
mouse iTreg cells [09-002]. (lymph)		SRR279907(GSM689057)
cell type: mouse embryonic stem cellcell line. (ESC)		SRR394084(GSM855970)
background strain: C57BL6/SV129cell type: KRa. (dicer cell line)		SRR042459(GSM539851)
mouse neutrophil cells replicate 1 [09-002]. (blood)		SRR039154(GSM471931)
HL1_siSrf2_smallRNAseq. (muscle)		SRR390300(GSM849858)
cell line: NIH-3T3cell type: fibroblastinfect. (ago2 fibroblast)		SRR042456(GSM539848)
mouse hematopoetic progenitor cells [09-002]. (bone marrow)		SRR042443(GSM539835)
mouse pro B cells [09-002]. (b cell)		SRR248524(GSM733812)
cell type: Thy1+ spermatogonial stem cellstra. (testes)		SRR248526(GSM733814)
cell type: Thy1- spermatogonial stem cellstra. (testes)		SRR248523(GSM733811)
cell type: Thy1+ spermatogonial stem cellstra. (testes)		SRR391851(GSM852146)
gender: femalegenotype/variation: wild typeti. (embryo)		SRR391847(GSM852142)
gender: femalegenotype/variation: ADAR2-/-/AD. (embryo)		GSM510444(GSM510444)
brain_rep5. (brain)		SRR042457(GSM539849)
mouse mast cells [09-002]. (bone marrow)		SRR042448(GSM539840)
mouse B cells activated in vitro with LPS/IL4 replicate 1 [09-002]. (b cell)		SRR042451(GSM539843)
mouse B cells activated in vitro with LPS/aIgD-Dextran [09-002]. (b cell)		mjTestesKO8()
Testes Data. (Zcchc11 testes)		SRR345205(SRX097266)
source: size fractionated RNA from mouse hipp. (brain)		SRR059769(GSM562831)
Treg_Drosha. (spleen)		SRR042477(GSM539869)
mouse brain tissue [09-002]. (brain)		SRR042449(GSM539841)
mouse B cells activated in vitro with LPS/IL4 replicate 2 [09-002]. (b cell)		SRR248525(GSM733813)
cell type: Thy1- spermatogonial stem cellstra. (testes)		SRR345204(SRX097265)
source: size fractionated RNA from mouse hipp. (brain)		SRR346414(SRX098255)
Global profiling of miRNA and the hairpin pre. (Spleen)		SRR042478(GSM539870)
mouse lung tissue [09-002]. (lung)		SRR391848(GSM852143)
gender: femalegenotype/variation: wild typeti. (embryo)		SRR042467(GSM539859)
mouse T cells activated in vitro with Concanavalin A [09-002]. (spleen)		SRR042488(GSM539880)
mouse BclXL germinal center B cells [BalbC] [09-002]. (B cell)		SRR391853(GSM852148)
gender: femalegenotype/variation: ADAR2-/-/AD. (embryo)		SRR391846(GSM852141)
gender: femalegenotype/variation: ADAR2-/-tis. (embryo)		SRR042444(GSM539836)
mouse pre B cells [09-002]. (b cell)		SRR390299(GSM849857)
cell line: NIH-3T3cell type: fibroblastip ant. (ago2 fibroblast)		SRR032477(GSM485235)
sRNA_activation_deep_sequencing. (uterus)		SRR042453(GSM539845)
mouse marginal zone B cells (spleen) [09-002]. (b cell)		SRR248527(GSM733815)
cell type: spermatogonial stem cell enriched . (testes)		SRR279904(GSM689054)
cell type: mouse embryonic stem cellcell line. (ESC)		GSM475280(GSM475280)
Mili-IP. (mili testes)		SRR345203(SRX097264)
source: size fractionated RNA from mouse hipp. (brain)		SRR028732(GSM400969)
Mili-Tdrd1 KO associated. (mili testes)		SRR042462(GSM539854)
mouse macrophages [09-002]. (bone marrow)		SRR042466(GSM539858)
mouse CD8+ T cells (spleen) [09-002]. (spleen)		SRR069809(GSM610965)
small RNA sequencing; sample 1. (testes)		SRR042463(GSM539855)
mouse natural killer cells [09-002]. (spleen)		SRR042483(GSM539875)
mouse muscle tissue [09-002]. (muscle)		SRR042460(GSM539852)
mouse neutrophil cells replicate 2 [09-002]. (blood)		SRR553585(SRX182791)
source: Kidney. (Kidney)		SRR306540(GSM750583)
19-24nt. (ago2 brain)		SRR402766(SRX117949)
source: ES PGK female cells. (ESC)		SRR073955(GSM629281)
total RNA. (blood)		SRR042487(GSM539879)
mouse BclXL B activated with LPS/IL4 [BalbC] [09-002]. (spleen)		SRR345196(SRX097257)
source: size fractionated RNA from mouse hipp. (brain)		SRR038742(GSM527277)
small RNA-Seq. (dgcr8 brain)		SRR553586(SRX182792)
source: Testis. (testes)		SRR279906(GSM689056)
cell type: mouse embryonic stem cellcell line. (ESC)		SRR039152(GSM471929)
HL1_siNon_smallRNAseq. (muscle)		mjLiverKO3()
Liver Data. (Zcchc11 liver)		SRR042473(GSM539865)
mouse nTreg cells [09-002]. (lymph)		SRR042461(GSM539853)
mouse dendritic cells [09-002]. (bone marrow)		SRR042475(GSM539867)
mouse embryonic fibroblast cells [09-002]. (fibroblast)		SRR029037(GSM433289)
18dpp_homo_tdrd6-KO. (tdrd6 testes)		Ago3IP805(Rui)
Quantitative functions of Argonaute proteins . (ago3 skin)		SRR345202(SRX097263)
source: size fractionated RNA from mouse hipp. (brain)		SRR402761(SRX117944)
source: ES E14 male cells. (ESC)		Ago2IP517(Rui)
Quantitative functions of Argonaute proteins . (ago2 skin)		SRR306541(GSM750584)
19-24nt. (ago2 brain)		SRR346419(SRX098260)
Global profiling of miRNA and the hairpin pre. (Lung)		SRR042445(GSM539837)
mouse immature B cells [09-002]. (b cell)		SRR042464(GSM539856)
mouse CD4+CD8+ T cells (thymus) [09-002]. (thymus)		SRR065052(SRR065052)
Tissue-specific Regulation of Mouse MicroRNA . (jejunum)		GSM509280(GSM509280)
small RNA cloning by length. (testes)		SRR306539(GSM750582)
19-24nt. (ago2 brain)		SRR206939(GSM723280)
other. (brain)		GSM509278(GSM509278)
small RNA cloning by length. (piwi testes)		SRR039186(GSM485326)
shLuc.1309;ROSA-rtTA (+dox). (fibroblast)		SRR029039(GSM433291)
25dpp_homo_tdrd6-KO. (tdrd6 testes)		SRR391845(GSM852140)
gender: femalegenotype/variation: wild typeti. (embryo)		SRR553604(SRX182810)
source: Spermatocytes. (Spermatocytes)		Ago2IP504(Rui)
Quantitative functions of Argonaute proteins . (ago2 skin)		SRR346420(SRX098261)
Global profiling of miRNA and the hairpin pre. (Uterus)		mjTestesKO5()
Testes Data. (Zcchc11 testes)		SRR037921(GSM510459)
e12p5_rep3. (embryo)		SRR014231(GSM319955)
16.5 dpc total. (testes)		SRR069810(GSM610966)
small RNA sequencing; sample 2. (testes)		SRR346422(SRX098264)
Global profiling of miRNA and the hairpin pre. (Muscle)		SRR206940(GSM723281)
other. (brain)		GSM510456(GSM510456)
newborn_rep12. (total RNA)		SRR037914(GSM510451)
newborn_rep7. (total RNA)		SRR685339(GSM1079783)
Small RNAs (15-50 nts in length) from immorta. (cell line)		SRR038744(GSM527279)
small RNA-Seq. (brain)		SRR306533(GSM750576)
19-24nt. (ago2 brain)		GSM640581(GSM640581)
small RNA in the liver with paternal control. (liver)		SRR553584(SRX182790)
source: Heart. (Heart)		SRR391849(GSM852144)
gender: femalegenotype/variation: ADAR2-/-tis. (embryo)		SRR038743(GSM527278)
small RNA-Seq. (dicer brain)		SRR039183(GSM485323)
shLuc.1309 (-dox). (fibroblast)		SRR346418(SRX098259)
Global profiling of miRNA and the hairpin pre. (Liver)		GSM509277(GSM509277)
small RNA cloning by length. (piwi testes)		SRR042486(GSM539878)
mouse ovaries [09-002]. (ovary)		SRR038741(GSM527276)
small RNA-Seq. (brain)		GSM510453(GSM510453)
newborn_rep9. (total RNA)		SRR525242(SRA056111/SRX170318)
Mus musculus domesticus miRNA sequencing. (ago2 Blood)		SRR306535(GSM750578)
19-24nt. (ago2 brain)		SRR042465(GSM539857)
mouse CD4+ T cells (spleen) [09-002]. (spleen)		SRR042455(GSM539847)
mouse plasma cells [09-002]. (blood)		mjTestesKO7()
Testes Data. (Zcchc11 testes)		SRR306537(GSM750580)
19-24nt. (ago2 brain)		SRR073954(GSM629280)
total RNA. (blood)		SRR346416(SRX098257)
Global profiling of miRNA and the hairpin pre. (Kidney)		SRR032476(GSM485234)
sRNA_delayed_deep_sequencing. (uterus)		SRR029036(GSM433288)
18dpp_hetero_tdrd6-KO. (tdrd6 testes)		SRR060845(GSM561991)
total RNA. (brain)		SRR023848(GSM307157)
mEFsmallrna_rep1. (cell line)		SRR206941(GSM723282)
other. (brain)		SRR391852(GSM852147)
gender: femalegenotype/variation: ADAR2-/-tis. (embryo)		SRR306544(GSM750587)
19-24nt. (ago2 brain)
.........................................................................................................................................TCCTGCCCCAGACACGGCC.......................................... 191.000.00--------------------------------------------------------------------------1.00------------------------------------------------------------------
.........................................................................................................................................TCCTGCCCCAGACACGGTC.......................................... 191.000.00--------------------------------------------------------------------------1.00------------------------------------------------------------------