| (3) AGO2.ip | (4) B-CELL | (12) BRAIN | (2) CELL-LINE | (1) DCR.mut | (2) DGCR8.mut | (2) EMBRYO | (5) ESC | (1) HEART | (1) KIDNEY | (6) LIVER | (1) LUNG | (11) OTHER | (8) OTHER.mut | (1) OVARY | (1) PANCREAS | (1) SKIN | (3) SPLEEN | (14) TESTES | (1) UTERUS |
| CCCTCACCAGCCACCAGGGCCTCTGTGCCTGCTAGGATCTCTTCCCACTATATAGTCTGCCTCCAGGTGCCCATGGCTCCCAGGAGTGGGTGAATGAATAAATGAATGAGTGAATGAATGAAAGGATAAAGAGATGCAGGACCTACAGGAAGGAAGTGATACCGGCCCAATTCGGCCCTGACTCTCATTCCTTTCTGTAGTCAGCCTTCGAGGCCGAGGTGTCTGAGATTGCCATCAGTCAGGCCGAGGT ..............................................................................................................................................(((((((((((((..((....((((......)))).....))...))))))))))))).................................................. ..........................................................................................................................................139..........................................................200................................................ | Size | Perfect hit | Total Norm | Perfect Norm | SRR546155(SRX180174) Global profiling of miRNA and the hairpin pre. (ago2 Neuroblastoma) | SRR042459(GSM539851) mouse neutrophil cells replicate 1 [09-002]. (blood) | SRR346424(SRX098266) Global profiling of miRNA and the hairpin pre. (Neuroblastoma) | mjTestesWT3() Testes Data. (testes) | SRR346425(SRX098267) Global profiling of miRNA and the hairpin pre. (Neuroblastoma) | mjLiverKO1() Liver Data. (Zcchc11 liver) | SRR553582(SRX182788) source: Brain. (Brain) | mjLiverKO3() Liver Data. (Zcchc11 liver) | SRR553602(SRX182808) source: Sertoli cells. (Sertoli cells) | GSM519104(GSM519104) mouse_granulocyte_nuclei_smallRNAs. (cell line) | SRR042460(GSM539852) mouse neutrophil cells replicate 2 [09-002]. (blood) | SRR248525(GSM733813) cell type: Thy1- spermatogonial stem cellstra. (testes) | SRR346423(SRX098265) Global profiling of miRNA and the hairpin pre. (Brain) | SRR346417(SRX098258) Global profiling of miRNA and the hairpin pre. (Brain) | mjTestesWT1() Testes Data. (testes) | SRR248526(GSM733814) cell type: Thy1- spermatogonial stem cellstra. (testes) | SRR042447(GSM539839) mouse mature B cells (spleen) replicate 2 [09-002]. (b cell) | mjTestesKO7() Testes Data. (Zcchc11 testes) | SRR042483(GSM539875) mouse muscle tissue [09-002]. (muscle) | SRR346419(SRX098260) Global profiling of miRNA and the hairpin pre. (Lung) | mjTestesKO6() Testes Data. (Zcchc11 testes) | SRR685339(GSM1079783) Small RNAs (15-50 nts in length) from immorta. (cell line) | SRR038742(GSM527277) small RNA-Seq. (dgcr8 brain) | SRR029042(GSM433294) 18.5dpc_hetero_tdrd1-KO. (tdrd1 testes) | SRR042488(GSM539880) mouse BclXL germinal center B cells [BalbC] [09-002]. (B cell) | SRR346414(SRX098255) Global profiling of miRNA and the hairpin pre. (Spleen) | SRR038741(GSM527276) small RNA-Seq. (brain) | mjLiverWT3() Liver Data. (liver) | SRR059769(GSM562831) Treg_Drosha. (spleen) | mjTestesKO5() Testes Data. (Zcchc11 testes) | SRR069809(GSM610965) small RNA sequencing; sample 1. (testes) | SRR206940(GSM723281) other. (brain) | SRR042455(GSM539847) mouse plasma cells [09-002]. (blood) | SRR042452(GSM539844) mouse B1 B cells [09-002]. (b cell) | SRR039610(GSM527274) small RNA-Seq. (brain) | SRR346418(SRX098259) Global profiling of miRNA and the hairpin pre. (Liver) | SRR038743(GSM527278) small RNA-Seq. (dicer brain) | SRR553583(SRX182789) source: Cerebellum. (Cerebellum) | SRR042466(GSM539858) mouse CD8+ T cells (spleen) [09-002]. (spleen) | SRR346415(SRX098256) source: Testis. (Testes) | SRR042450(GSM539842) mouse B cells activated in vitro with LPS/IL4 replicate 3 [09-002]. (b cell) | SRR029043(GSM433295) 18.5dpc_homo_tdrd1-KO. (tdrd1 testes) | SRR346413(SRX098254) Global profiling of miRNA and the hairpin pre. (Heart) | SRR525242(SRA056111/SRX170318) Mus musculus domesticus miRNA sequencing. (ago2 Blood) | GSM640583(GSM640583) small RNA in the liver with paternal Low prot. (liver) | SRR402762(SRX117945) source: ES E14 male cells. (ESC) | SRR042486(GSM539878) mouse ovaries [09-002]. (ovary) | SRR042485(GSM539877) mouse testicular tissue [09-002]. (testes) | SRR037905(GSM510441) brain_rep2. (brain) | SRR042474(GSM539866) mouse embryonic stem cells [09-002]. (ESC) | GSM314557(GSM314557) ESC dgcr8 (Illumina). (ESC) | SRR279903(GSM689053) cell type: mouse embryonic stem cellcell line. (ESC) | SRR345197(SRX097258) source: size fractionated RNA from mouse hipp. (brain) | SRR391853(GSM852148) gender: femalegenotype/variation: ADAR2-/-/AD. (embryo) | SRR042482(GSM539874) mouse skin tissue [09-002]. (skin) | SRR553604(SRX182810) source: Spermatocytes. (Spermatocytes) | SRR038745(GSM527280) small RNA-Seq. (dgcr8 brain) | SRR014231(GSM319955) 16.5 dpc total. (testes) | SRR279904(GSM689054) cell type: mouse embryonic stem cellcell line. (ESC) | SRR032476(GSM485234) sRNA_delayed_deep_sequencing. (uterus) | SRR306528(GSM750571) 19-24nt. (ago2 brain) | SRR065058(SRR065058) Tissue-specific Regulation of Mouse MicroRNA . (pancreas) | SRR040488(GSM533911) E18.5 wild type LIVER small RNA. (liver) | SRR391846(GSM852141) gender: femalegenotype/variation: ADAR2-/-tis. (embryo) | SRR029036(GSM433288) 18dpp_hetero_tdrd6-KO. (tdrd6 testes) | SRR346416(SRX098257) Global profiling of miRNA and the hairpin pre. (Kidney) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ..................................................................................................................................................................................TGACTCTCATTCCTTTCTGTAGT................................................. | 23 | 1 | 82.00 | 82.00 | 5.00 | - | 9.00 | 3.00 | 5.00 | 10.00 | 3.00 | 9.00 | 3.00 | 1.00 | - | 1.00 | 1.00 | 4.00 | - | 2.00 | - | 3.00 | - | 1.00 | 3.00 | 2.00 | 2.00 | - | - | 1.00 | 2.00 | 2.00 | 1.00 | 1.00 | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | 1.00 | 1.00 | - | 1.00 | - | 1.00 | - | - | 1.00 | - | - | - | - | 1.00 | - | - | 1.00 | - | - | - | - |
| ..................................................................................................................................................................................TGACTCTCATTCCTTTCTGTAG.................................................. | 22 | 1 | 29.00 | 29.00 | - | - | - | 12.00 | - | - | 2.00 | - | 1.00 | 1.00 | - | 3.00 | 1.00 | - | - | 3.00 | - | 1.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | 1.00 | - | 1.00 | - | 1.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..................................................................................................................................................................................TGACTCTCATTCCTTTCTG..................................................... | 19 | 1 | 26.00 | 26.00 | - | 15.00 | - | - | - | - | - | - | - | - | 4.00 | - | - | - | - | - | 1.00 | - | 3.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | 1.00 | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - |
| ...............................................................................................................................................TACAGGAAGGAAGTGATACCGG..................................................................................... | 22 | 1 | 25.00 | 25.00 | 5.00 | 1.00 | 4.00 | - | 2.00 | - | - | - | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | 1.00 | 1.00 | - | - | 1.00 | - | - | - | - | 2.00 | 1.00 | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | 1.00 | - | 1.00 | 1.00 | - | - | - | - | - |
| ..................................................................................................................................................................................TGACTCTCATTCCTTTCTGTAGC................................................. | 23 | 1 | 23.00 | 29.00 | 9.00 | - | 7.00 | - | 4.00 | - | - | - | 2.00 | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..................................................................................................................................................................................TGACTCTCATTCCTTTCTGT.................................................... | 20 | 1 | 13.00 | 13.00 | - | 8.00 | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..................................................................................................................................................................................TGACTCTCATTCCTTTCTGTAGA................................................. | 23 | 1 | 8.00 | 29.00 | - | - | - | - | 1.00 | - | 1.00 | - | - | 1.00 | - | 1.00 | 2.00 | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..................................................................................................................................................................................TGACTCTCATTCCTTTCTGTAGTTA............................................... | 25 | 1 | 5.00 | 82.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 5.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..................................................................................................................................................................................TGACTCTCATTCCTTTCT...................................................... | 18 | 3 | 4.33 | 4.33 | - | 1.00 | - | - | - | - | - | - | - | - | 1.33 | - | - | - | - | - | 0.33 | - | 0.33 | - | - | - | - | - | 0.33 | - | - | - | - | - | - | - | 0.67 | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...............................................................................................................................................TACAGGAAGGAAGTGATACCG...................................................................................... | 21 | 1 | 4.00 | 4.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..................................................................................................................................................................................TGACTCTCATTCCTTTCTGTA................................................... | 21 | 1 | 3.00 | 3.00 | - | 3.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...................................................................................................................................................................................GACTCTCATTCCTTTCTGTAGT................................................. | 22 | 1 | 3.00 | 3.00 | - | - | - | - | - | - | 1.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - |
| ...............................................................................................................................................TACAGGAAGGAAGTGATACCGGT.................................................................................... | 23 | 1 | 3.00 | 25.00 | 3.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...............................................................................................................................................TACAGGAAGGAAGTGATACCGGA.................................................................................... | 23 | 1 | 2.00 | 25.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..................................................................................................................................................................................TGACTCTCATTCCTTTCTGTAGTA................................................ | 24 | 1 | 2.00 | 82.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..................................................................................................................................................................................TGACTCTCATTCCTTTCTGTAGTG................................................ | 24 | 1 | 2.00 | 82.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .............................................................................................................................................CCTACAGGAAGGAAGTGATACCGGCCCA................................................................................. | 28 | 1 | 2.00 | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .......................................................................................................................................................................................CTCATTCCTTTCTGTAGT................................................. | 18 | 1 | 1.00 | 1.00 | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..................................................................................................................................................................................TGACTCTCATTCCTTTCTGTAGTAT............................................... | 25 | 1 | 1.00 | 82.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ......................................................................................................TGAATGAGTGAATGAATGAGTGT............................................................................................................................. | 23 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...................................................................................................................................................................................GACTCTCATTCCTTTCTGTAG.................................................. | 21 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...............................................................................................................................................TACAGGAAGGAAGTGATACTGGT.................................................................................... | 23 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ....................................................................................................................................................................................ACTCTCATTCCTTTCTGTAGT................................................. | 21 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ................................................................................CAGGAGTGGGTGAATGTAA....................................................................................................................................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..................................................................................................................................................................................TGACTCTCATTCCTTTCTGTAGTAGA.............................................. | 26 | 1 | 1.00 | 82.00 | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .............................................................................................................................................................GATACCGGCCCAATTGGC........................................................................... | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ............................................................................................................................................ACCTACAGGAAGGAAGTGAT.......................................................................................... | 20 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - |
| ..................................................................................................................................................................................TGACTCTCATTCCTTTCTGTATT................................................. | 23 | 1 | 1.00 | 3.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..................................................................................................................................................................................TGACTCTCATTCCTTTCTGTAGG................................................. | 23 | 1 | 1.00 | 29.00 | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..............................................................................................TGAATAAATGAATGAGTAACC....................................................................................................................................... | 21 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ....................................................................................................AATGAATGAGTGAATGAAGGGG................................................................................................................................ | 22 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...............................................................................................................................................TACAGGAAGGAAGTGATACCGGTT................................................................................... | 24 | 1 | 1.00 | 25.00 | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..................................................................................................................................................................................TGACTCTCATTCCTTTCTGTATTT................................................ | 24 | 1 | 1.00 | 3.00 | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...............................................................................................................................................TACAGGAAGGAAGTGATACC....................................................................................... | 20 | 1 | 1.00 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..............................................................................................................................................CTACAGGAAGGAAGTGATACCGG..................................................................................... | 23 | 1 | 1.00 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .......................................................................................................................................GCAGGACCTACAGGAAG.................................................................................................. | 17 | 2 | 0.50 | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.50 | - | - |
| ........................................................................................GGTGAATGAATAAATGAA................................................................................................................................................ | 18 | 5 | 0.20 | 0.20 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.20 |
| CCCTCACCAGCCACCAGGGCCTCTGTGCCTGCTAGGATCTCTTCCCACTATATAGTCTGCCTCCAGGTGCCCATGGCTCCCAGGAGTGGGTGAATGAATAAATGAATGAGTGAATGAATGAAAGGATAAAGAGATGCAGGACCTACAGGAAGGAAGTGATACCGGCCCAATTCGGCCCTGACTCTCATTCCTTTCTGTAGTCAGCCTTCGAGGCCGAGGTGTCTGAGATTGCCATCAGTCAGGCCGAGGT ..............................................................................................................................................(((((((((((((..((....((((......)))).....))...))))))))))))).................................................. ..........................................................................................................................................139..........................................................200................................................ | Size | Perfect hit | Total Norm | Perfect Norm | SRR546155(SRX180174) Global profiling of miRNA and the hairpin pre. (ago2 Neuroblastoma) | SRR042459(GSM539851) mouse neutrophil cells replicate 1 [09-002]. (blood) | SRR346424(SRX098266) Global profiling of miRNA and the hairpin pre. (Neuroblastoma) | mjTestesWT3() Testes Data. (testes) | SRR346425(SRX098267) Global profiling of miRNA and the hairpin pre. (Neuroblastoma) | mjLiverKO1() Liver Data. (Zcchc11 liver) | SRR553582(SRX182788) source: Brain. (Brain) | mjLiverKO3() Liver Data. (Zcchc11 liver) | SRR553602(SRX182808) source: Sertoli cells. (Sertoli cells) | GSM519104(GSM519104) mouse_granulocyte_nuclei_smallRNAs. (cell line) | SRR042460(GSM539852) mouse neutrophil cells replicate 2 [09-002]. (blood) | SRR248525(GSM733813) cell type: Thy1- spermatogonial stem cellstra. (testes) | SRR346423(SRX098265) Global profiling of miRNA and the hairpin pre. (Brain) | SRR346417(SRX098258) Global profiling of miRNA and the hairpin pre. (Brain) | mjTestesWT1() Testes Data. (testes) | SRR248526(GSM733814) cell type: Thy1- spermatogonial stem cellstra. (testes) | SRR042447(GSM539839) mouse mature B cells (spleen) replicate 2 [09-002]. (b cell) | mjTestesKO7() Testes Data. (Zcchc11 testes) | SRR042483(GSM539875) mouse muscle tissue [09-002]. (muscle) | SRR346419(SRX098260) Global profiling of miRNA and the hairpin pre. (Lung) | mjTestesKO6() Testes Data. (Zcchc11 testes) | SRR685339(GSM1079783) Small RNAs (15-50 nts in length) from immorta. (cell line) | SRR038742(GSM527277) small RNA-Seq. (dgcr8 brain) | SRR029042(GSM433294) 18.5dpc_hetero_tdrd1-KO. (tdrd1 testes) | SRR042488(GSM539880) mouse BclXL germinal center B cells [BalbC] [09-002]. (B cell) | SRR346414(SRX098255) Global profiling of miRNA and the hairpin pre. (Spleen) | SRR038741(GSM527276) small RNA-Seq. (brain) | mjLiverWT3() Liver Data. (liver) | SRR059769(GSM562831) Treg_Drosha. (spleen) | mjTestesKO5() Testes Data. (Zcchc11 testes) | SRR069809(GSM610965) small RNA sequencing; sample 1. (testes) | SRR206940(GSM723281) other. (brain) | SRR042455(GSM539847) mouse plasma cells [09-002]. (blood) | SRR042452(GSM539844) mouse B1 B cells [09-002]. (b cell) | SRR039610(GSM527274) small RNA-Seq. (brain) | SRR346418(SRX098259) Global profiling of miRNA and the hairpin pre. (Liver) | SRR038743(GSM527278) small RNA-Seq. (dicer brain) | SRR553583(SRX182789) source: Cerebellum. (Cerebellum) | SRR042466(GSM539858) mouse CD8+ T cells (spleen) [09-002]. (spleen) | SRR346415(SRX098256) source: Testis. (Testes) | SRR042450(GSM539842) mouse B cells activated in vitro with LPS/IL4 replicate 3 [09-002]. (b cell) | SRR029043(GSM433295) 18.5dpc_homo_tdrd1-KO. (tdrd1 testes) | SRR346413(SRX098254) Global profiling of miRNA and the hairpin pre. (Heart) | SRR525242(SRA056111/SRX170318) Mus musculus domesticus miRNA sequencing. (ago2 Blood) | GSM640583(GSM640583) small RNA in the liver with paternal Low prot. (liver) | SRR402762(SRX117945) source: ES E14 male cells. (ESC) | SRR042486(GSM539878) mouse ovaries [09-002]. (ovary) | SRR042485(GSM539877) mouse testicular tissue [09-002]. (testes) | SRR037905(GSM510441) brain_rep2. (brain) | SRR042474(GSM539866) mouse embryonic stem cells [09-002]. (ESC) | GSM314557(GSM314557) ESC dgcr8 (Illumina). (ESC) | SRR279903(GSM689053) cell type: mouse embryonic stem cellcell line. (ESC) | SRR345197(SRX097258) source: size fractionated RNA from mouse hipp. (brain) | SRR391853(GSM852148) gender: femalegenotype/variation: ADAR2-/-/AD. (embryo) | SRR042482(GSM539874) mouse skin tissue [09-002]. (skin) | SRR553604(SRX182810) source: Spermatocytes. (Spermatocytes) | SRR038745(GSM527280) small RNA-Seq. (dgcr8 brain) | SRR014231(GSM319955) 16.5 dpc total. (testes) | SRR279904(GSM689054) cell type: mouse embryonic stem cellcell line. (ESC) | SRR032476(GSM485234) sRNA_delayed_deep_sequencing. (uterus) | SRR306528(GSM750571) 19-24nt. (ago2 brain) | SRR065058(SRR065058) Tissue-specific Regulation of Mouse MicroRNA . (pancreas) | SRR040488(GSM533911) E18.5 wild type LIVER small RNA. (liver) | SRR391846(GSM852141) gender: femalegenotype/variation: ADAR2-/-tis. (embryo) | SRR029036(GSM433288) 18dpp_hetero_tdrd6-KO. (tdrd6 testes) | SRR346416(SRX098257) Global profiling of miRNA and the hairpin pre. (Kidney) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| .......................................................................................................................GAAAGGATAAAGAGATTT................................................................................................................. | 18 | 2.00 | 0.00 | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ................................................................................................................................................................................CCTGACTCTCATTCCTTC........................................................ | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .......................................................................CATGGCTCCCAGGAGTGGGTGAATGA......................................................................................................................................................... | 26 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - |
| .......................................................................................................GAATGAGTGAATGAATGAAAG.............................................................................................................................. | 21 | 2 | 0.50 | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.50 | - |