ID: uc008dha.11
GENE: Ddx11(12)
chr17:66489524-66489740+


(1)
AGO.mut 		(2)
AGO1.ip 		(11)
AGO2.ip 		(2)
AGO3.ip 		(8)
B-CELL 		(16)
BRAIN 		(4)
CELL-LINE 		(2)
DCR.mut 		(2)
DGCR8.mut 		(10)
EMBRYO 		(11)
ESC 		(5)
FIBROBLAST 		(5)
HEART 		(2)
KIDNEY 		(16)
LIVER 		(1)
LUNG 		(4)
LYMPH 		(25)
OTHER 		(9)
OTHER.mut 		(1)
OVARY 		(1)
PANCREAS 		(3)
PIWI.ip 		(5)
SKIN 		(8)
SPLEEN 		(23)
TESTES 		(3)
THYMUS 		(1)
UTERUS

Sense strand
TTTAGGTAATGTTAAGCAAAATCCTACTACACAGAGCCTGTCTCAAACAGGTGAGGAGGTTGCTGTCAAGGGTGGGAGGTGGTGTGAGCCACCCAGAGCTTACCAGATAGAACTGGGCTGAGAGGACTTGGTAAGGTACAAAACCAGCGTCCTTTGTCTGCTCACAGGGTCTGAGCTGAAGAGCATCAACGACTTTCTCTTTCAGAGCCAGGTGGAC
.................................................................................................................(((((.(((((((((((((..........))))).))))))..)).))))).....................................................
.........................................................................................................106..........................................................167................................................
SizePerfect hitTotal NormPerfect NormSRR546155(SRX180174)
Global profiling of miRNA and the hairpin pre. (ago2 Neuroblastoma)		SRR402760(SRX117943)
source: ES E14 male cells. (ESC)		SRR391852(GSM852147)
gender: femalegenotype/variation: ADAR2-/-tis. (embryo)		SRR346424(SRX098266)
Global profiling of miRNA and the hairpin pre. (Neuroblastoma)		SRR391853(GSM852148)
gender: femalegenotype/variation: ADAR2-/-/AD. (embryo)		SRR279907(GSM689057)
cell type: mouse embryonic stem cellcell line. (ESC)		SRR391851(GSM852146)
gender: femalegenotype/variation: wild typeti. (embryo)		SRR248526(GSM733814)
cell type: Thy1- spermatogonial stem cellstra. (testes)		SRR248525(GSM733813)
cell type: Thy1- spermatogonial stem cellstra. (testes)		SRR553602(SRX182808)
source: Sertoli cells. (Sertoli cells)		SRR346425(SRX098267)
Global profiling of miRNA and the hairpin pre. (Neuroblastoma)		SRR390299(GSM849857)
cell line: NIH-3T3cell type: fibroblastip ant. (ago2 fibroblast)		SRR402762(SRX117945)
source: ES E14 male cells. (ESC)		mjTestesWT4()
Testes Data. (testes)		mjTestesWT2()
Testes Data. (testes)		SRR279904(GSM689054)
cell type: mouse embryonic stem cellcell line. (ESC)		SRR391845(GSM852140)
gender: femalegenotype/variation: wild typeti. (embryo)		mjTestesKO7()
Testes Data. (Zcchc11 testes)		mjTestesWT1()
Testes Data. (testes)		mjTestesKO6()
Testes Data. (Zcchc11 testes)		SRR391848(GSM852143)
gender: femalegenotype/variation: wild typeti. (embryo)		mjLiverKO2()
Liver Data. (Zcchc11 liver)		SRR553583(SRX182789)
source: Cerebellum. (Cerebellum)		GSM519104(GSM519104)
mouse_granulocyte_nuclei_smallRNAs. (cell line)		SRR390297(GSM849855)
cell line: NIH-3T3cell type: fibroblastip ant. (fibroblast)		SRR391846(GSM852141)
gender: femalegenotype/variation: ADAR2-/-tis. (embryo)		SRR346414(SRX098255)
Global profiling of miRNA and the hairpin pre. (Spleen)		SRR391847(GSM852142)
gender: femalegenotype/variation: ADAR2-/-/AD. (embryo)		mjLiverKO3()
Liver Data. (Zcchc11 liver)		SRR390300(GSM849858)
cell line: NIH-3T3cell type: fibroblastinfect. (ago2 fibroblast)		SRR346417(SRX098258)
Global profiling of miRNA and the hairpin pre. (Brain)		SRR685340(GSM1079784)
Small RNAs (15-50 nts in length) from immorta. (dicer cell line)		SRR346415(SRX098256)
source: Testis. (Testes)		SRR248524(GSM733812)
cell type: Thy1+ spermatogonial stem cellstra. (testes)		SRR248523(GSM733811)
cell type: Thy1+ spermatogonial stem cellstra. (testes)		SRR059766(GSM562828)
DN3_Drosha. (thymus)		mjTestesKO8()
Testes Data. (Zcchc11 testes)		mjTestesWT3()
Testes Data. (testes)		mjLiverWT3()
Liver Data. (liver)		SRR059769(GSM562831)
Treg_Drosha. (spleen)		mjLiverWT1()
Liver Data. (liver)		SRR042483(GSM539875)
mouse muscle tissue [09-002]. (muscle)		SRR553604(SRX182810)
source: Spermatocytes. (Spermatocytes)		GSM640580(GSM640580)
small RNA in the liver with paternal Low pro. (liver)		SRR248527(GSM733815)
cell type: spermatogonial stem cell enriched . (testes)		SRR346418(SRX098259)
Global profiling of miRNA and the hairpin pre. (Liver)		SRR391849(GSM852144)
gender: femalegenotype/variation: ADAR2-/-tis. (embryo)		SRR391850(GSM852145)
gender: femalegenotype/variation: ADAR2-/-/AD. (embryo)		SRR402761(SRX117944)
source: ES E14 male cells. (ESC)		SRR553585(SRX182791)
source: Kidney. (Kidney)		mjTestesKO5()
Testes Data. (Zcchc11 testes)		SRR042464(GSM539856)
mouse CD4+CD8+ T cells (thymus) [09-002]. (thymus)		SRR042459(GSM539851)
mouse neutrophil cells replicate 1 [09-002]. (blood)		mjLiverKO1()
Liver Data. (Zcchc11 liver)		SRR042451(GSM539843)
mouse B cells activated in vitro with LPS/aIgD-Dextran [09-002]. (b cell)		SRR116846(GSM678422)
Small RNA deep sequencing from mouse epididym. (epididymis)		SRR059765(GSM562827)
DN3_control. (thymus)		GSM314557(GSM314557)
ESC dgcr8 (Illumina). (ESC)		GSM640579(GSM640579)
small RNA in the liver with paternal Low pro. (liver)		SRR279903(GSM689053)
cell type: mouse embryonic stem cellcell line. (ESC)		Ago2IP504(Rui)
Quantitative functions of Argonaute proteins . (ago2 skin)		SRR038742(GSM527277)
small RNA-Seq. (dgcr8 brain)		SRR346422(SRX098264)
Global profiling of miRNA and the hairpin pre. (Muscle)		SRR346419(SRX098260)
Global profiling of miRNA and the hairpin pre. (Lung)		Ago2IP517(Rui)
Quantitative functions of Argonaute proteins . (ago2 skin)		SRR039186(GSM485326)
shLuc.1309;ROSA-rtTA (+dox). (fibroblast)		SRR039184(GSM485324)
shLuc.1309 (+dox). (fibroblast)		SRR065053(SRR065053)
Tissue-specific Regulation of Mouse MicroRNA . (jejunum)		SRR073954(GSM629280)
total RNA. (blood)		SRR553584(SRX182790)
source: Heart. (Heart)		SRR042460(GSM539852)
mouse neutrophil cells replicate 2 [09-002]. (blood)		SRR095855BC8(SRX039178)
sequencing of miRNA from wild type and diseas. (heart)		SRR042472(GSM539864)
mouse iTreg cells [09-002]. (lymph)		SRR306536(GSM750579)
19-24nt. (ago2 brain)		SRR685339(GSM1079783)
Small RNAs (15-50 nts in length) from immorta. (cell line)		SRR042456(GSM539848)
mouse hematopoetic progenitor cells [09-002]. (bone marrow)		SRR402766(SRX117949)
source: ES PGK female cells. (ESC)		SRR206940(GSM723281)
other. (brain)		SRR042447(GSM539839)
mouse mature B cells (spleen) replicate 2 [09-002]. (b cell)		SRR040489(GSM533912)
E18.5 Ago2 catalytically inactive LIVER small RNA. (ago2 liver)		GSM475280(GSM475280)
Mili-IP. (mili testes)		SRR014232(GSM319956)
16.5 dpc MILI. (mili testes)		SRR042466(GSM539858)
mouse CD8+ T cells (spleen) [09-002]. (spleen)		GSM509280(GSM509280)
small RNA cloning by length. (testes)		SRR034121(GSM466731)
Mili IP_Tdrd9-/- replicate2. (mili testes)		SRR345200(SRX097261)
source: size fractionated RNA from mouse hipp. (brain)		SRR042471(GSM539863)
mouse TFHS cells [09-002]. (spleen)		SRR042469(GSM539861)
mouse Th2 cells [09-002]. (lymph)		SRR029037(GSM433289)
18dpp_homo_tdrd6-KO. (tdrd6 testes)		SRR279906(GSM689056)
cell type: mouse embryonic stem cellcell line. (ESC)		SRR553586(SRX182792)
source: Testis. (testes)		GSM640581(GSM640581)
small RNA in the liver with paternal control. (liver)		SRR525244(SRA056111/SRX170320)
Mus musculus domesticus miRNA sequencing. (ago2 Blood)		GSM640578(GSM640578)
small RNA in the liver with paternal control. (liver)		SRR553582(SRX182788)
source: Brain. (Brain)		SRR042473(GSM539865)
mouse nTreg cells [09-002]. (lymph)		SRR059774(GSM562836)
MEF_control. (MEF)		SRR077865(GSM637802)
18-30 nt small RNAs. (liver)		SRR042463(GSM539855)
mouse natural killer cells [09-002]. (spleen)		SRR038745(GSM527280)
small RNA-Seq. (dgcr8 brain)		SRR014231(GSM319955)
16.5 dpc total. (testes)		SRR037921(GSM510459)
e12p5_rep3. (embryo)		SRR346420(SRX098261)
Global profiling of miRNA and the hairpin pre. (Uterus)		SRR059775(GSM562837)
MEF_Drosha. (MEF)		GSM361398(GSM361398)
CGNP_P6_p53--_Ink4c--_rep1. (brain)		SRR077864(GSM637801)
18-30 nt small RNAs. (liver)		SRR306527(GSM750570)
19-24nt. (ago2 brain)		SRR042444(GSM539836)
mouse pre B cells [09-002]. (b cell)		SRR069834(GSM304914)
Analysis of small RNAs in murine neutrophils cultured in vitro by Solexa/Illumina genome analyzer. (blood)		SRR029042(GSM433294)
18.5dpc_hetero_tdrd1-KO. (tdrd1 testes)		SRR306541(GSM750584)
19-24nt. (ago2 brain)		SRR525239(SRA056111/SRX170315)
Mus musculus domesticus miRNA sequencing. (ago1 Blood)		GSM361395(GSM361395)
CGNP_P6_wt_rep2. (brain)		Ago1IP812(Rui)
Quantitative functions of Argonaute proteins . (ago1 skin)		Ago3IP812(Rui)
Quantitative functions of Argonaute proteins . (ago3 skin)		SRR042488(GSM539880)
mouse BclXL germinal center B cells [BalbC] [09-002]. (B cell)		SRR206939(GSM723280)
other. (brain)		SRR065052(SRR065052)
Tissue-specific Regulation of Mouse MicroRNA . (jejunum)		SRR042474(GSM539866)
mouse embryonic stem cells [09-002]. (ESC)		SRR059770(GSM562832)
Treg_Dicer. (spleen)		SRR095855BC6(SRX039178)
sequencing of miRNA from wild type and diseas. (heart)		SRR042446(GSM539838)
mouse mature B cells (spleen) replicate 1 [09-002]. (b cell)		SRR039153(GSM471930)
HL1_siSrf1_smallRNAseq. (muscle)		SRR059771(GSM562833)
CD4_control. (spleen)		SRR042454(GSM539846)
mouse germinal center B cells (lymph node) [09-002]. (b cell)		SRR042465(GSM539857)
mouse CD4+ T cells (spleen) [09-002]. (spleen)		SRR345204(SRX097265)
source: size fractionated RNA from mouse hipp. (brain)		SRR042449(GSM539841)
mouse B cells activated in vitro with LPS/IL4 replicate 2 [09-002]. (b cell)		SRR042470(GSM539862)
mouse Th17 cells [09-002]. (lymph)		GSM509279(GSM509279)
MVH-/- E16.5 small RNA. (testes)		SRR042481(GSM539873)
mouse pancreatic tissue [09-002]. (pancreas)		SRR525243(SRA056111/SRX170319)
Mus musculus domesticus miRNA sequencing. (ago2 Blood)		GSM361402(GSM361402)
CGNP_P6_p53--_Ink4c--_rep5. (brain)		Ago3IP805(Rui)
Quantitative functions of Argonaute proteins . (ago3 skin)		SRR040488(GSM533911)
E18.5 wild type LIVER small RNA. (liver)		SRR095855BC7(SRX039178)
sequencing of miRNA from wild type and diseas. (heart)		SRR065050(SRR065050)
Tissue-specific Regulation of Mouse MicroRNA . (liver)		SRR346416(SRX098257)
Global profiling of miRNA and the hairpin pre. (Kidney)		SRR038743(GSM527278)
small RNA-Seq. (dicer brain)		SRR059776(GSM562838)
MEF_Dicer. (MEF)		SRR042448(GSM539840)
mouse B cells activated in vitro with LPS/IL4 replicate 1 [09-002]. (b cell)		SRR306533(GSM750576)
19-24nt. (ago2 brain)		SRR346413(SRX098254)
Global profiling of miRNA and the hairpin pre. (Heart)		SRR553603(SRX182809)
source: Spermatids. (Spermatids)		GSM314552(GSM314552)
ESC wild type (Illumina). (ESC)		SRR525237(SRA056111/SRX170313)
Mus musculus domesticus miRNA sequencing. (Blood)		SRR042486(GSM539878)
mouse ovaries [09-002]. (ovary)		SRR037937(GSM510475)
293cand2. (cell line)		GSM640583(GSM640583)
small RNA in the liver with paternal Low prot. (liver)
..............................................................................................................AACTGGGCTGAGAGGACTTGGT.....................................................................................221501.00501.00159.0023.0022.0017.0017.0026.0016.0018.009.0014.0012.0021.0010.004.008.0014.008.003.0010.004.008.00-3.001.00-5.004.005.003.00-2.00-5.003.004.001.00--3.003.00--1.001.002.001.001.001.002.00-1.001.00---2.001.001.00-2.002.001.001.00-1.002.001.00-3.00--1.00--2.00------------------1.00----------------1.00--1.00-------------------1.00-1.00-------------
...............................................................................................................ACTGGGCTGAGAGGACTTGGT.....................................................................................211409.00409.00113.0048.0013.0019.0012.0013.0013.0011.0017.0010.003.002.009.008.005.005.001.002.009.004.005.00-4.001.0012.005.002.003.00--5.00-1.002.002.001.003.005.002.00---3.001.003.001.001.002.001.002.00----1.001.00-2.001.001.00-1.00--2.00----1.00-1.00----1.00-----1.001.00----1.001.002.00--1.001.00-1.00-----1.00-----------------1.00----------------1.00----1.00------
................................................................................................................CTGGGCTGAGAGGACTTGGT.....................................................................................20184.0084.0030.0014.002.001.002.004.005.001.003.002.001.00-1.00-1.002.00---5.00---1.00---1.001.00---------1.00----------1.00---2.00------1.00-----------------------------------------------------1.00-------------------1.00--------------
..............................................................................................................AACTGGGCTGAGAGGACTTGG......................................................................................21183.0083.0022.006.003.004.001.003.00-5.004.004.002.001.002.00-2.00--6.00-2.002.00-1.00-------1.00-1.001.00-1.001.00------1.001.00---1.00------1.00-----1.001.00------1.00-------------------------------1.00-----------------------------------------------
...............................................................................................................ACTGGGCTGAGAGGACTTGG......................................................................................20164.0064.0016.0010.001.003.003.003.003.00-3.00-3.001.00--3.00--1.00--------1.00-4.00-----1.00---------------------1.00----------------2.00---------1.00---------------1.00----------------1.00------------1.00--------1.00----------
...............................................................................................................ACTGGGCTGAGAGGACTTGGTA....................................................................................22146.0046.0010.00-3.001.004.00-2.001.00-1.00--2.005.001.00-1.003.00-2.00--------2.002.00-----2.00----------------1.00-1.00---1.00------------------1.00-----------------------------------------------------------------------
..............................................................................................................AACTGGGCTGAGAGGACTTGGTA....................................................................................23135.0035.008.00-1.004.003.00-4.00-1.00--2.00-----3.00----1.001.00--------2.00---------1.00---------1.00-1.00--------1.00----------------------------------------------------------------------------1.00--------
..............................................................................................................AACTGGGCTGAGAGGACTTGGTAT...................................................................................24132.0035.001.00-1.00---1.002.00--1.00-----2.00------1.00---------------2.007.002.00----1.00-----------1.00-------------1.00----1.00--------1.002.00-------1.00---------------1.00------1.00---------1.00----------------1.00---
...............................................................................................................ACTGGGCTGAGAGGACTTGGTAT...................................................................................23130.0046.001.00-2.00---1.002.001.00-----------2.00---------1.00----------4.00-1.00-----1.00-2.001.00-1.00---------------1.00-1.00--1.00--1.00-------------1.00--1.00-----------------------1.00-1.00--------------1.00---------1.00--
..............................................................................................................AACTGGGCTGAGAGGACTTGGA.....................................................................................22122.0083.003.00-2.003.001.00-3.001.001.001.00-------2.00----1.001.00------1.00----1.00---------------------------------------------------------------------1.00-------------------------------------------
...............................................................................................................ACTGGGCTGAGAGGACTTGGTAA...................................................................................23119.0019.00--3.001.00--------1.00---3.00-----1.00--1.00---------1.00----------1.00--------------------------------2.00------------1.00----1.001.00-------1.00--1.00---------------------------------------
...............................................................................................................ACTGGGCTGAGAGGACTTGGTT....................................................................................22118.00409.005.00---3.00--2.00-1.00-----1.001.00-----1.00---1.00------------------1.00----------------------------------------------------------------------------1.00----1.00---------------------
...............................................................................................................ACTGGGCTGAGAGGACTTGGA.....................................................................................21117.0064.004.00-1.001.00-3.00-2.00-------1.00-1.00----1.001.00----------1.00-1.00----------------------------------------------------------------------------------------------------------------
...............................................................................................................ACTGGGCTGAGAGGACTTGAAA....................................................................................2214.000.00---------------------14.00-------------------------------------------------------------------------------------------------------------------------------
..............................................................................................................AACTGGGCTGAGAGGACTTGGTT....................................................................................23114.00501.001.00--2.001.00--2.00------1.00-----------1.00--------------------1.00--------1.00------1.00---1.00-------------2.00-------------------------------------------------------------------
..............................................................................................................AACTGGGCTGAGAGGACTTGGTAA...................................................................................24113.0013.00--3.00-1.00--1.00-------------------1.00--------2.00-----------1.00-1.00----------------2.00----------1.00----------------------------------------------------------------------
................................................................................................................CTGGGCTGAGAGGACTTGGTA....................................................................................21111.0011.004.00-2.00--3.001.00----------------------------------------------------------------------------------1.00-----------------------------------------------------------
................................................................................................................CTGGGCTGAGAGGACTTGGTT....................................................................................21110.0084.004.00-3.00------1.00-------------1.00----------------------------------------------------------------1.00------------------------------------------------------------
.............................................................................................................................................AACCAGCGTCCTTTGTCTGCTCACA...................................................2519.009.00-------------------------------9.00---------------------------------------------------------------------------------------------------------------------
................................................................................................................CTGGGCTGAGAGGACTTGGTAA...................................................................................2219.009.002.00---3.00-1.00----------------------1.00----------------------------------------------1.00-----------------------------------------------------1.00------------------
................................................................................................................CTGGGCTGAGAGGACTTGG......................................................................................1918.008.00-3.00----1.00------3.00-----------------------------------------------------------------------------------------------------1.00---------------------------------
...........................................................................................................TAGAACTGGGCTGAGAGGACTTGGT.....................................................................................2517.007.00-----------------------------7.00-----------------------------------------------------------------------------------------------------------------------
..............................................................................................................AACTGGGCTGAGAGGACTTGGTAAT..................................................................................2517.0013.00-------------6.00---------1.00-----------------------------------------------------------------------------------------------------------------------------
.............................................................................................................GAACTGGGCTGAGAGGACTTGGT.....................................................................................2316.006.00-4.00-1.00-----------------------------1.00-------------------------------------------------------------------------------------------------------------------
...............................................................................................................ACTGGGCTGAGAGGACTTGGAA....................................................................................2215.0064.002.00---------------2.00-----------------------------------------------------------------1.00------------------------------------------------------------------
...............................................................................................................ACTGGGCTGAGAGGACTTGGTTT...................................................................................2315.00409.00----------------1.00---------1.00------------------1.00------1.00------------------------------------------------------------------------1.00-----------------------
................................................................................................................CTGGGCTGAGAGGACTTGGTAT...................................................................................2215.0011.001.00--2.00-----------------------------1.00------------------------------------1.00------------------------------------------------------------------------------
..............................................................................................................AACTGGGCTGAGAGGACTTGGTTT...................................................................................2415.00501.00---------------------------------1.00-----1.00------1.00---------1.00------------------1.00-------------------------------------------------------------------------
...............................................................................................................ACTGGGCTGAGAGGACTTGGTAAT..................................................................................2414.0019.00--1.00--------------------1.00----1.00--------------------------------------------------------------1.00---------------------------------------------------------
.................................................................................................................TGGGCTGAGAGGACTTGGTAT...................................................................................214.000.002.00--1.00------1.00------------------------------------------------------------------------------------------------------------------------------------------
..............................................................................................................AACTGGGCTGAGAGGACTTGA......................................................................................2114.004.002.00---------1.00----------------------------------1.00-------------------------------------------------------------------------------------------------------
..............................................................................................................AACTGGGCTGAGAGGACTTG.......................................................................................2014.004.001.00--------1.00------1.00------------------------------------------------1.00-----------------------------------------------------------------------------------
..............................................................................................................AACTGGGCTGAGAGGACTTGGTTA...................................................................................2413.00501.00-------------------------------------------2.00----------------------1.00----------------------------------------------------------------------------------
.................................................................................................................TGGGCTGAGAGGACTTGGT.....................................................................................1913.003.00---1.00------------1.00----------------------------------------------------------------------------------------------------------1.00-------------------------
..............................................................................................................AACTGGGCTGAGAGGACTT........................................................................................1913.003.001.00---------1.00-------------------------------------------------------------------------------------------------------------------------------------1.00----
................................................................................................................CTGGGCTGAGAGGACTTGGTAAAA.................................................................................2413.009.00--2.00------1.00-------------------------------------------------------------------------------------------------------------------------------------------
..............................................................................................................AACTGGGCTGAGAGGACTTGGTG....................................................................................2313.00501.00----1.00---------1.00-------------------------------1.00------------------------------------------------------------------------------------------------------
...............................................................................................................ACTGGGCTGAGAGGACT.........................................................................................1713.003.00------------2.00---------------------------------------------------------------------------------------------------------------------------------------1.00
..............................................................................................................AACTGGGCTGAGAGGACTTGGG.....................................................................................2213.0083.002.00-----------------------------------1.00----------------------------------------------------------------------------------------------------------------
..............................................................................................................AACTGGGCTGAGAGGACTTGT......................................................................................2112.004.00----------1.00-----------------------------------------------------------------------------------1.00------------------------------------------------------
...............................................................................................................ACTGGGCTGAGAGGACTT........................................................................................1812.002.00-------1.00-------------------1.00-------------------------------------------------------------------------------------------------------------------------
..............................................................................................................AACTGGGCTGAGAGGACTTGGCA....................................................................................2312.0083.001.00--1.00-------------------------------------------------------------------------------------------------------------------------------------------------
..............................................................................................................AACTGGGCTGAGAGGACTTGGTGT...................................................................................2412.00501.00----------------------1.00------------1.00-----------------------------------------------------------------------------------------------------------------
..............................................................................................................AACTGGGCTGAGAGGACTTGGTAG...................................................................................2412.0035.00---------------------------------------------------------------------1.00----------------1.00--------------------------------------------------------------
...............................................................................................................ACTGGGCTGAGAGGACTTCGT.....................................................................................2112.002.001.00------------------------------------------------------------------------------------------1.00---------------------------------------------------------
...............................................................................................................ACTGGGCTGAGAGGACTTGGTTA...................................................................................2312.00409.00--2.00--------------------------------------------------------------------------------------------------------------------------------------------------
................................................................................................................CTGGGCTGAGAGGACTTGGTTT...................................................................................2212.0084.001.00-----1.00----------------------------------------------------------------------------------------------------------------------------------------------
................................................................................................................CTGGGCTGAGAGGACTTGGA.....................................................................................2012.008.00---1.00----------------------------------1.00--------------------------------------------------------------------------------------------------------------
..............................................................................................................AACTGGGCTGAGAGGACTTGGTACC..................................................................................2512.0035.002.00----------------------------------------------------------------------------------------------------------------------------------------------------
...............................................................................................................ACTGGGCTGAGAGGACTTGGTAG...................................................................................2312.0046.00---------------------------------------------1.00----1.00--------------------------------------------------------------------------------------------------
..............................................................................................................AACTGGGCTGAGAGGACT.........................................................................................1812.002.00---------------------------------------------------1.00-------------------------------------------------------1.00-----------------------------------------
............................................................................................................AGAACTGGGCTGAGAGGACTTGGT.....................................................................................2412.002.00--1.00--------------------------------------------1.00-----------------------------------------------------------------------------------------------------
..............................................................................................................AACTGGGCTGAGAGGACTTGGTAAAT.................................................................................2612.0013.00-----------------------------------------------------2.00-----------------------------------------------------------------------------------------------
.........................................................................................................................................................TTGTCTGCTCACAGGGTCTGAGCTG.......................................2512.002.00-------------------------------------2.00---------------------------------------------------------------------------------------------------------------
................................................................................................................................................CAGCGTCCTTTGTCTGCTCACAG..................................................2312.002.00----2.00------------------------------------------------------------------------------------------------------------------------------------------------
..............................................................................................................AACTGGGCTGAGAGGACTTGGTATAT.................................................................................2611.0035.001.00----------------------------------------------------------------------------------------------------------------------------------------------------
..............................................................................................................AACTGGGCTGAGAGGACTTGGAAAG..................................................................................2511.0083.001.00----------------------------------------------------------------------------------------------------------------------------------------------------
.................................................................................................................TGGGCTGAGAGGACTTGGTTT...................................................................................2111.003.00-------------------------------------------------------------------------------------------------------1.00---------------------------------------------
...............................................................................................................ACTGGGCTGAGAGGACTTGGTATAT.................................................................................2511.0046.00------------------------------------------------------------------------------------------------------------1.00----------------------------------------
.................................................................................................................TGGGCTGAGAGGACTTGGTAAGGTACAAAT..........................................................................301.000.00-----------------------------------------------------------------------------------------------------------------------------------------------1.00-----
................................................................................................................CTGGGCTGAGAGGACTTGGTTAGA.................................................................................2411.0084.00----1.00------------------------------------------------------------------------------------------------------------------------------------------------
..............................................................................................................AACTGGGCTGAGAGGACTTGGTATT..................................................................................2511.0035.00-----------------------1.00-----------------------------------------------------------------------------------------------------------------------------
..............................................................................................................AACTGGGCTGAGAGGACTTGGTGA...................................................................................2411.00501.00-----------------1.00-----------------------------------------------------------------------------------------------------------------------------------
..............................................................................................................AACTGGGCTGAGAGGACTGGGT.....................................................................................2211.002.001.00----------------------------------------------------------------------------------------------------------------------------------------------------
...............................................................................................................ACTGGGCTGAGAGGACTTGGTAAAT.................................................................................2511.0019.00------1.00----------------------------------------------------------------------------------------------------------------------------------------------
..............................................................................................................AACTGGGCTGAGAGGACTTGGAAA...................................................................................2411.0083.00--------------------------------------------------1.00--------------------------------------------------------------------------------------------------
...............................................................................................................ACTGGGCTGAGAGGACTTA.......................................................................................1911.002.00---1.00-------------------------------------------------------------------------------------------------------------------------------------------------
.................................................................................................................TGGGCTGAGAGGACTTGGGAAT..................................................................................221.000.00----------1.00------------------------------------------------------------------------------------------------------------------------------------------
...........................................................................................................TAGAACTGGGCTGAGAGGGGGA........................................................................................221.000.00------------------------------------------------------------------------------------------------------------------------------1.00----------------------
...............................................................................................................ACTGGGCTGAGAGGACTTGGTGT...................................................................................2311.00409.00---1.00-------------------------------------------------------------------------------------------------------------------------------------------------
...................................................................AAGGGTGGGAGGTGGTGTT...................................................................................................................................191.000.00-------------------------------------------------------------------------------------1.00---------------------------------------------------------------
.............................................................................................................................................AACCAGCGTCCTTTGTCTGCTAACA...................................................251.000.00-------------------------------1.00---------------------------------------------------------------------------------------------------------------------
..............................................................................................................AACTGGGCTGAGAGGACTTGGTAGA..................................................................................2511.0035.00-------------------1.00---------------------------------------------------------------------------------------------------------------------------------
.........................................................................................................................................................................TCTGAGCTGAAGAGCATCAACGACTTTC....................2811.001.00------------------------------------------------------------------------------------1.00----------------------------------------------------------------
.............................................................................................................GAACTGGGCTGAGAGGACTTGGTAT...................................................................................251.000.00----------1.00------------------------------------------------------------------------------------------------------------------------------------------
................................................................................................................CTGGGCTGAGAGGACTTGGAAA...................................................................................2211.008.00--1.00--------------------------------------------------------------------------------------------------------------------------------------------------
................................................................................................................CTGGGCTGAGAGGACTTGGTATT..................................................................................2311.0011.00---------1.00-------------------------------------------------------------------------------------------------------------------------------------------
...............................................................................................................ACTGGGCTGAGAGGACTTGA......................................................................................201.000.001.00----------------------------------------------------------------------------------------------------------------------------------------------------
.......................................................................................................................................................................................CATCAACGACTTTCTCTTTCAGAGCC........2611.001.00------------------------------------------1.00----------------------------------------------------------------------------------------------------------
...........................................................................................................................................................................TGAGCTGAAGAGCATCAACGACTTTC....................2611.001.00------------------------------------------------------------------------------------1.00----------------------------------------------------------------
................................................................................................................CTGGGCTGAGAGGACTTGGATA...................................................................................2211.008.00-----------------------1.00-----------------------------------------------------------------------------------------------------------------------------
...............................................................................................................ACTGGGCTGAGAGGACTTGGTAGA..................................................................................2411.0046.00---------------------------------------------------------------1.00-------------------------------------------------------------------------------------
..............................................................................................................AACTGGGCTGAGAGGACTTGGTAAC..................................................................................2511.0013.00---------1.00-------------------------------------------------------------------------------------------------------------------------------------------
.........TGTTAAGCAAAATCCTACTACACAGAGC....................................................................................................................................................................................2811.001.00--------------------------------------------------------------------------------1.00--------------------------------------------------------------------
..............................................................................................................AACTGGGCTGAGAGGACTTGAG.....................................................................................2211.004.001.00----------------------------------------------------------------------------------------------------------------------------------------------------
...............................................................................................................ACTGGGCTGAGAGGACTTGGAAA...................................................................................2311.0064.00------------------------------------------------------------------1.00----------------------------------------------------------------------------------
.................................................................................................................TGGGCTGAGAGGACTTGGTAA...................................................................................2111.001.00-------------------------------------------------------------------------------------------------------------------------------------------1.00---------
...............GCAAAATCCTACTACACAGAGCCTGTCTC.............................................................................................................................................................................2911.001.00--------------------------------------------------------------------------------1.00--------------------------------------------------------------------
..............................................................................................................AACTGGGCTGAGAGGACTTGGAA....................................................................................2311.0083.00---------------------------------------1.00-------------------------------------------------------------------------------------------------------------
.....................................................................................................................................................................AGGGTCTGAGCTGAAGAGCAT...............................2111.001.00--1.00--------------------------------------------------------------------------------------------------------------------------------------------------
.............................................................................................................GAACTGGGCTGAGAGGACTTGG......................................................................................2211.001.00---1.00-------------------------------------------------------------------------------------------------------------------------------------------------
.................................................................................................................TGGGCTGAGAGGACTTGGTT....................................................................................2011.003.00----------------1.00------------------------------------------------------------------------------------------------------------------------------------
...............................................................................................................ACTGGGCTGAGAGGACTTGGTATAAG................................................................................2611.0046.00---------------------------------------------------------------------------------------------------------------------1.00-------------------------------
..............................................................................................................AACTGGGCTGAGAGGACTTGGTAGAAT................................................................................2711.0035.00--------------1.00--------------------------------------------------------------------------------------------------------------------------------------
..............................................................................................................AACTGGGCTGAGAGGACTAGGT.....................................................................................2211.002.00----------------------------------1.00------------------------------------------------------------------------------------------------------------------
..............................................................................................................AACTGGGCTGAGAGGACTTGGTTTA..................................................................................2511.00501.00----------------------------------------------------------------------------------------------------1.00------------------------------------------------
................................................................................................................CTGGGCTGAGAGGACTTGAA.....................................................................................201.000.00-----------------------1.00-----------------------------------------------------------------------------------------------------------------------------
...............................................................................................................ACTGGGCTGAGAGGACTTGGTATT..................................................................................2411.0046.00--------------------------1.00--------------------------------------------------------------------------------------------------------------------------
................................................................................................................CTGGGCTGAGAGGACTTGGTAAA..................................................................................2311.009.00---------------------------------------------------------------------------------------------------------------------------------------------1.00-------
..............................ACAGAGCCTGTCTCAAACAGGT.....................................................................................................................................................................2211.001.00--1.00--------------------------------------------------------------------------------------------------------------------------------------------------
................................................................................................................CTGGGCTGAGAGGACTTGTT.....................................................................................201.000.00------1.00----------------------------------------------------------------------------------------------------------------------------------------------
...............................................................................................................ACTGGGCTGAGAGGACTTGTT.....................................................................................211.000.001.00----------------------------------------------------------------------------------------------------------------------------------------------------
...................................................................................................................................................................ACAGGGTCTGAGCTGAAGAGCATA..............................241.000.00----------------------------------------------------------------------------------------------------------------------------1.00------------------------
...............................................................................................................ACTGGGCTGAGAGGACTTTGT.....................................................................................2111.002.001.00----------------------------------------------------------------------------------------------------------------------------------------------------
...............................................................................................................ACTGGGCTGAGAGGACTTTG......................................................................................2011.002.001.00----------------------------------------------------------------------------------------------------------------------------------------------------
..............................................................................................................AACTGGGCTGAGAGGACTTGTAT....................................................................................2311.004.00--------------------------------------------------------------1.00--------------------------------------------------------------------------------------
.......AATGTTAAGCAAAATCCTCGT.............................................................................................................................................................................................211.000.00-------------------------------------------------------------------------------------1.00---------------------------------------------------------------
...............................................................................................................ACTGGGCTGAGAGGACTTGGCAT...................................................................................2311.0064.00-----------------------------------------------------------------------------------------------------------------------------------1.00-----------------
..............................................................................................................AACTGGGCTGAGAGGA...........................................................................................1650.200.20---------------------------------------------------------0.20-------------------------------------------------------------------------------------------

Antisense strand
TTTAGGTAATGTTAAGCAAAATCCTACTACACAGAGCCTGTCTCAAACAGGTGAGGAGGTTGCTGTCAAGGGTGGGAGGTGGTGTGAGCCACCCAGAGCTTACCAGATAGAACTGGGCTGAGAGGACTTGGTAAGGTACAAAACCAGCGTCCTTTGTCTGCTCACAGGGTCTGAGCTGAAGAGCATCAACGACTTTCTCTTTCAGAGCCAGGTGGAC
.................................................................................................................(((((.(((((((((((((..........))))).))))))..)).))))).....................................................
.........................................................................................................106..........................................................167................................................
SizePerfect hitTotal NormPerfect NormSRR546155(SRX180174)
Global profiling of miRNA and the hairpin pre. (ago2 Neuroblastoma)		SRR402760(SRX117943)
source: ES E14 male cells. (ESC)		SRR391852(GSM852147)
gender: femalegenotype/variation: ADAR2-/-tis. (embryo)		SRR346424(SRX098266)
Global profiling of miRNA and the hairpin pre. (Neuroblastoma)		SRR391853(GSM852148)
gender: femalegenotype/variation: ADAR2-/-/AD. (embryo)		SRR279907(GSM689057)
cell type: mouse embryonic stem cellcell line. (ESC)		SRR391851(GSM852146)
gender: femalegenotype/variation: wild typeti. (embryo)		SRR248526(GSM733814)
cell type: Thy1- spermatogonial stem cellstra. (testes)		SRR248525(GSM733813)
cell type: Thy1- spermatogonial stem cellstra. (testes)		SRR553602(SRX182808)
source: Sertoli cells. (Sertoli cells)		SRR346425(SRX098267)
Global profiling of miRNA and the hairpin pre. (Neuroblastoma)		SRR390299(GSM849857)
cell line: NIH-3T3cell type: fibroblastip ant. (ago2 fibroblast)		SRR402762(SRX117945)
source: ES E14 male cells. (ESC)		mjTestesWT4()
Testes Data. (testes)		mjTestesWT2()
Testes Data. (testes)		SRR279904(GSM689054)
cell type: mouse embryonic stem cellcell line. (ESC)		SRR391845(GSM852140)
gender: femalegenotype/variation: wild typeti. (embryo)		mjTestesKO7()
Testes Data. (Zcchc11 testes)		mjTestesWT1()
Testes Data. (testes)		mjTestesKO6()
Testes Data. (Zcchc11 testes)		SRR391848(GSM852143)
gender: femalegenotype/variation: wild typeti. (embryo)		mjLiverKO2()
Liver Data. (Zcchc11 liver)		SRR553583(SRX182789)
source: Cerebellum. (Cerebellum)		GSM519104(GSM519104)
mouse_granulocyte_nuclei_smallRNAs. (cell line)		SRR390297(GSM849855)
cell line: NIH-3T3cell type: fibroblastip ant. (fibroblast)		SRR391846(GSM852141)
gender: femalegenotype/variation: ADAR2-/-tis. (embryo)		SRR346414(SRX098255)
Global profiling of miRNA and the hairpin pre. (Spleen)		SRR391847(GSM852142)
gender: femalegenotype/variation: ADAR2-/-/AD. (embryo)		mjLiverKO3()
Liver Data. (Zcchc11 liver)		SRR390300(GSM849858)
cell line: NIH-3T3cell type: fibroblastinfect. (ago2 fibroblast)		SRR346417(SRX098258)
Global profiling of miRNA and the hairpin pre. (Brain)		SRR685340(GSM1079784)
Small RNAs (15-50 nts in length) from immorta. (dicer cell line)		SRR346415(SRX098256)
source: Testis. (Testes)		SRR248524(GSM733812)
cell type: Thy1+ spermatogonial stem cellstra. (testes)		SRR248523(GSM733811)
cell type: Thy1+ spermatogonial stem cellstra. (testes)		SRR059766(GSM562828)
DN3_Drosha. (thymus)		mjTestesKO8()
Testes Data. (Zcchc11 testes)		mjTestesWT3()
Testes Data. (testes)		mjLiverWT3()
Liver Data. (liver)		SRR059769(GSM562831)
Treg_Drosha. (spleen)		mjLiverWT1()
Liver Data. (liver)		SRR042483(GSM539875)
mouse muscle tissue [09-002]. (muscle)		SRR553604(SRX182810)
source: Spermatocytes. (Spermatocytes)		GSM640580(GSM640580)
small RNA in the liver with paternal Low pro. (liver)		SRR248527(GSM733815)
cell type: spermatogonial stem cell enriched . (testes)		SRR346418(SRX098259)
Global profiling of miRNA and the hairpin pre. (Liver)		SRR391849(GSM852144)
gender: femalegenotype/variation: ADAR2-/-tis. (embryo)		SRR391850(GSM852145)
gender: femalegenotype/variation: ADAR2-/-/AD. (embryo)		SRR402761(SRX117944)
source: ES E14 male cells. (ESC)		SRR553585(SRX182791)
source: Kidney. (Kidney)		mjTestesKO5()
Testes Data. (Zcchc11 testes)		SRR042464(GSM539856)
mouse CD4+CD8+ T cells (thymus) [09-002]. (thymus)		SRR042459(GSM539851)
mouse neutrophil cells replicate 1 [09-002]. (blood)		mjLiverKO1()
Liver Data. (Zcchc11 liver)		SRR042451(GSM539843)
mouse B cells activated in vitro with LPS/aIgD-Dextran [09-002]. (b cell)		SRR116846(GSM678422)
Small RNA deep sequencing from mouse epididym. (epididymis)		SRR059765(GSM562827)
DN3_control. (thymus)		GSM314557(GSM314557)
ESC dgcr8 (Illumina). (ESC)		GSM640579(GSM640579)
small RNA in the liver with paternal Low pro. (liver)		SRR279903(GSM689053)
cell type: mouse embryonic stem cellcell line. (ESC)		Ago2IP504(Rui)
Quantitative functions of Argonaute proteins . (ago2 skin)		SRR038742(GSM527277)
small RNA-Seq. (dgcr8 brain)		SRR346422(SRX098264)
Global profiling of miRNA and the hairpin pre. (Muscle)		SRR346419(SRX098260)
Global profiling of miRNA and the hairpin pre. (Lung)		Ago2IP517(Rui)
Quantitative functions of Argonaute proteins . (ago2 skin)		SRR039186(GSM485326)
shLuc.1309;ROSA-rtTA (+dox). (fibroblast)		SRR039184(GSM485324)
shLuc.1309 (+dox). (fibroblast)		SRR065053(SRR065053)
Tissue-specific Regulation of Mouse MicroRNA . (jejunum)		SRR073954(GSM629280)
total RNA. (blood)		SRR553584(SRX182790)
source: Heart. (Heart)		SRR042460(GSM539852)
mouse neutrophil cells replicate 2 [09-002]. (blood)		SRR095855BC8(SRX039178)
sequencing of miRNA from wild type and diseas. (heart)		SRR042472(GSM539864)
mouse iTreg cells [09-002]. (lymph)		SRR306536(GSM750579)
19-24nt. (ago2 brain)		SRR685339(GSM1079783)
Small RNAs (15-50 nts in length) from immorta. (cell line)		SRR042456(GSM539848)
mouse hematopoetic progenitor cells [09-002]. (bone marrow)		SRR402766(SRX117949)
source: ES PGK female cells. (ESC)		SRR206940(GSM723281)
other. (brain)		SRR042447(GSM539839)
mouse mature B cells (spleen) replicate 2 [09-002]. (b cell)		SRR040489(GSM533912)
E18.5 Ago2 catalytically inactive LIVER small RNA. (ago2 liver)		GSM475280(GSM475280)
Mili-IP. (mili testes)		SRR014232(GSM319956)
16.5 dpc MILI. (mili testes)		SRR042466(GSM539858)
mouse CD8+ T cells (spleen) [09-002]. (spleen)		GSM509280(GSM509280)
small RNA cloning by length. (testes)		SRR034121(GSM466731)
Mili IP_Tdrd9-/- replicate2. (mili testes)		SRR345200(SRX097261)
source: size fractionated RNA from mouse hipp. (brain)		SRR042471(GSM539863)
mouse TFHS cells [09-002]. (spleen)		SRR042469(GSM539861)
mouse Th2 cells [09-002]. (lymph)		SRR029037(GSM433289)
18dpp_homo_tdrd6-KO. (tdrd6 testes)		SRR279906(GSM689056)
cell type: mouse embryonic stem cellcell line. (ESC)		SRR553586(SRX182792)
source: Testis. (testes)		GSM640581(GSM640581)
small RNA in the liver with paternal control. (liver)		SRR525244(SRA056111/SRX170320)
Mus musculus domesticus miRNA sequencing. (ago2 Blood)		GSM640578(GSM640578)
small RNA in the liver with paternal control. (liver)		SRR553582(SRX182788)
source: Brain. (Brain)		SRR042473(GSM539865)
mouse nTreg cells [09-002]. (lymph)		SRR059774(GSM562836)
MEF_control. (MEF)		SRR077865(GSM637802)
18-30 nt small RNAs. (liver)		SRR042463(GSM539855)
mouse natural killer cells [09-002]. (spleen)		SRR038745(GSM527280)
small RNA-Seq. (dgcr8 brain)		SRR014231(GSM319955)
16.5 dpc total. (testes)		SRR037921(GSM510459)
e12p5_rep3. (embryo)		SRR346420(SRX098261)
Global profiling of miRNA and the hairpin pre. (Uterus)		SRR059775(GSM562837)
MEF_Drosha. (MEF)		GSM361398(GSM361398)
CGNP_P6_p53--_Ink4c--_rep1. (brain)		SRR077864(GSM637801)
18-30 nt small RNAs. (liver)		SRR306527(GSM750570)
19-24nt. (ago2 brain)		SRR042444(GSM539836)
mouse pre B cells [09-002]. (b cell)		SRR069834(GSM304914)
Analysis of small RNAs in murine neutrophils cultured in vitro by Solexa/Illumina genome analyzer. (blood)		SRR029042(GSM433294)
18.5dpc_hetero_tdrd1-KO. (tdrd1 testes)		SRR306541(GSM750584)
19-24nt. (ago2 brain)		SRR525239(SRA056111/SRX170315)
Mus musculus domesticus miRNA sequencing. (ago1 Blood)		GSM361395(GSM361395)
CGNP_P6_wt_rep2. (brain)		Ago1IP812(Rui)
Quantitative functions of Argonaute proteins . (ago1 skin)		Ago3IP812(Rui)
Quantitative functions of Argonaute proteins . (ago3 skin)		SRR042488(GSM539880)
mouse BclXL germinal center B cells [BalbC] [09-002]. (B cell)		SRR206939(GSM723280)
other. (brain)		SRR065052(SRR065052)
Tissue-specific Regulation of Mouse MicroRNA . (jejunum)		SRR042474(GSM539866)
mouse embryonic stem cells [09-002]. (ESC)		SRR059770(GSM562832)
Treg_Dicer. (spleen)		SRR095855BC6(SRX039178)
sequencing of miRNA from wild type and diseas. (heart)		SRR042446(GSM539838)
mouse mature B cells (spleen) replicate 1 [09-002]. (b cell)		SRR039153(GSM471930)
HL1_siSrf1_smallRNAseq. (muscle)		SRR059771(GSM562833)
CD4_control. (spleen)		SRR042454(GSM539846)
mouse germinal center B cells (lymph node) [09-002]. (b cell)		SRR042465(GSM539857)
mouse CD4+ T cells (spleen) [09-002]. (spleen)		SRR345204(SRX097265)
source: size fractionated RNA from mouse hipp. (brain)		SRR042449(GSM539841)
mouse B cells activated in vitro with LPS/IL4 replicate 2 [09-002]. (b cell)		SRR042470(GSM539862)
mouse Th17 cells [09-002]. (lymph)		GSM509279(GSM509279)
MVH-/- E16.5 small RNA. (testes)		SRR042481(GSM539873)
mouse pancreatic tissue [09-002]. (pancreas)		SRR525243(SRA056111/SRX170319)
Mus musculus domesticus miRNA sequencing. (ago2 Blood)		GSM361402(GSM361402)
CGNP_P6_p53--_Ink4c--_rep5. (brain)		Ago3IP805(Rui)
Quantitative functions of Argonaute proteins . (ago3 skin)		SRR040488(GSM533911)
E18.5 wild type LIVER small RNA. (liver)		SRR095855BC7(SRX039178)
sequencing of miRNA from wild type and diseas. (heart)		SRR065050(SRR065050)
Tissue-specific Regulation of Mouse MicroRNA . (liver)		SRR346416(SRX098257)
Global profiling of miRNA and the hairpin pre. (Kidney)		SRR038743(GSM527278)
small RNA-Seq. (dicer brain)		SRR059776(GSM562838)
MEF_Dicer. (MEF)		SRR042448(GSM539840)
mouse B cells activated in vitro with LPS/IL4 replicate 1 [09-002]. (b cell)		SRR306533(GSM750576)
19-24nt. (ago2 brain)		SRR346413(SRX098254)
Global profiling of miRNA and the hairpin pre. (Heart)		SRR553603(SRX182809)
source: Spermatids. (Spermatids)		GSM314552(GSM314552)
ESC wild type (Illumina). (ESC)		SRR525237(SRA056111/SRX170313)
Mus musculus domesticus miRNA sequencing. (Blood)		SRR042486(GSM539878)
mouse ovaries [09-002]. (ovary)		SRR037937(GSM510475)
293cand2. (cell line)		GSM640583(GSM640583)
small RNA in the liver with paternal Low prot. (liver)
...............................................................................................................ACTGGGCTGAGAGGACTTGG...................................................................................... 2012.002.00----------------------------------------------------------------------------------------------------------------1.00-------------------1.00----------------
...............................................................................................................ACTGGGCTGAGAGGACTTGGTAA................................................................................... 2311.001.00--------------------------------------------------------------------------------------------------------1.00--------------------------------------------
...............................................................TGTCAAGGGTGGGAGCCA........................................................................................................................................ 181.000.00---------------------------------------------------------------------------------------------------------------------------------------------------1.00-