ID: uc007qhn.31
GENE: Kif13a(31)
chr13:46922100-46922349-


(2)
AGO1.ip 		(12)
AGO2.ip 		(1)
AGO3.ip 		(1)
B-CELL 		(29)
BRAIN 		(6)
CELL-LINE 		(1)
DCR.mut 		(1)
DGCR8.mut 		(9)
EMBRYO 		(8)
ESC 		(4)
FIBROBLAST 		(4)
HEART 		(1)
KIDNEY 		(3)
LIVER 		(1)
LUNG 		(1)
LYMPH 		(12)
OTHER 		(3)
OTHER.mut 		(2)
PANCREAS 		(1)
PIWI.ip 		(5)
SKIN 		(2)
SPLEEN 		(9)
TESTES 		(4)
TOTAL-RNA 		(1)
UTERUS

Sense strand
AATAGTATCACTGTTTGAAATCAGAGTCTAAGGCATTTCTCATGCAGAGTGCTGCTTTGCTATAAAGTGGCCATTAAAGCACCTTCTAATCACTAAAAGACCCTTTTGAGTTTGTAATCTGAATGTCTAAGTGCTTGGGAGAAAGGAGAATCCCCCAAGTGTGGTAAGATTCACCCACTTGATTCTTCTTCCTCCCCTAGGAGCAGGCAGTCTCTGAAAGTCCGAGAGCATAAGGTCCTGGGGCCGTATG
........................................................................................................................................(((((.((((((((((....(((((.(((.......)))))))))))))))))).)))))......................................................
................................................................................................................................129....................................................................200................................................
SizePerfect hitTotal NormPerfect NormSRR546155(SRX180174)
Global profiling of miRNA and the hairpin pre. (ago2 Neuroblastoma)		SRR279904(GSM689054)
cell type: mouse embryonic stem cellcell line. (ESC)		mjLiverWT1()
Liver Data. (liver)		SRR038742(GSM527277)
small RNA-Seq. (dgcr8 brain)		SRR391852(GSM852147)
gender: femalegenotype/variation: ADAR2-/-tis. (embryo)		GSM314557(GSM314557)
ESC dgcr8 (Illumina). (ESC)		SRR402762(SRX117945)
source: ES E14 male cells. (ESC)		SRR553583(SRX182789)
source: Cerebellum. (Cerebellum)		SRR206941(GSM723282)
other. (brain)		Ago1IP517(Rui)
Quantitative functions of Argonaute proteins . (ago1 skin)		SRR391853(GSM852148)
gender: femalegenotype/variation: ADAR2-/-/AD. (embryo)		GSM510444(GSM510444)
brain_rep5. (brain)		SRR391851(GSM852146)
gender: femalegenotype/variation: wild typeti. (embryo)		SRR306542(GSM750585)
19-24nt. (ago2 brain)		SRR345200(SRX097261)
source: size fractionated RNA from mouse hipp. (brain)		SRR402760(SRX117943)
source: ES E14 male cells. (ESC)		SRR390300(GSM849858)
cell line: NIH-3T3cell type: fibroblastinfect. (ago2 fibroblast)		Ago3IP812(Rui)
Quantitative functions of Argonaute proteins . (ago3 skin)		Ago1IP812(Rui)
Quantitative functions of Argonaute proteins . (ago1 skin)		SRR685339(GSM1079783)
Small RNAs (15-50 nts in length) from immorta. (cell line)		SRR206940(GSM723281)
other. (brain)		SRR345198(SRX097259)
source: size fractionated RNA from mouse hipp. (brain)		SRR391845(GSM852140)
gender: femalegenotype/variation: wild typeti. (embryo)		SRR391848(GSM852143)
gender: femalegenotype/variation: wild typeti. (embryo)		SRR038743(GSM527278)
small RNA-Seq. (dicer brain)		SRR345203(SRX097264)
source: size fractionated RNA from mouse hipp. (brain)		SRR346421(SRX098263)
Global profiling of miRNA and the hairpin pre. (mixture)		SRR346423(SRX098265)
Global profiling of miRNA and the hairpin pre. (Brain)		SRR248523(GSM733811)
cell type: Thy1+ spermatogonial stem cellstra. (testes)		SRR346422(SRX098264)
Global profiling of miRNA and the hairpin pre. (Muscle)		SRR040488(GSM533911)
E18.5 wild type LIVER small RNA. (liver)		SRR391846(GSM852141)
gender: femalegenotype/variation: ADAR2-/-tis. (embryo)		SRR042459(GSM539851)
mouse neutrophil cells replicate 1 [09-002]. (blood)		SRR037906(GSM510442)
brain_rep3. (brain)		SRR279903(GSM689053)
cell type: mouse embryonic stem cellcell line. (ESC)		SRR038741(GSM527276)
small RNA-Seq. (brain)		SRR206939(GSM723280)
other. (brain)		SRR059773(GSM562835)
CD4_Dicer. (spleen)		SRR306526(GSM750569)
19-24nt. (ago2 brain)		SRR346417(SRX098258)
Global profiling of miRNA and the hairpin pre. (Brain)		SRR206942(GSM723283)
other. (brain)		SRR391849(GSM852144)
gender: femalegenotype/variation: ADAR2-/-tis. (embryo)		SRR346419(SRX098260)
Global profiling of miRNA and the hairpin pre. (Lung)		SRR346416(SRX098257)
Global profiling of miRNA and the hairpin pre. (Kidney)		SRR345207(SRX097268)
source: size fractionated RNA from mouse hipp. (brain)		GSM510456(GSM510456)
newborn_rep12. (total RNA)		SRR402761(SRX117944)
source: ES E14 male cells. (ESC)		SRR346424(SRX098266)
Global profiling of miRNA and the hairpin pre. (Neuroblastoma)		SRR037907(GSM510443)
brain_rep4. (brain)		SRR042469(GSM539861)
mouse Th2 cells [09-002]. (lymph)		SRR042449(GSM539841)
mouse B cells activated in vitro with LPS/IL4 replicate 2 [09-002]. (b cell)		SRR038744(GSM527279)
small RNA-Seq. (brain)		SRR037929(GSM510467)
e7p5_rep3. (embryo)		SRR306536(GSM750579)
19-24nt. (ago2 brain)		SRR345199(SRX097260)
source: size fractionated RNA from mouse hipp. (brain)		SRR095855BC3(SRX039178)
sequencing of miRNA from wild type and diseas. (heart)		SRR306528(GSM750571)
19-24nt. (ago2 brain)		SRR073954(GSM629280)
total RNA. (blood)		SRR065058(SRR065058)
Tissue-specific Regulation of Mouse MicroRNA . (pancreas)		SRR042481(GSM539873)
mouse pancreatic tissue [09-002]. (pancreas)		SRR306527(GSM750570)
19-24nt. (ago2 brain)		SRR073955(GSM629281)
total RNA. (blood)		GSM509279(GSM509279)
MVH-/- E16.5 small RNA. (testes)		SRR039184(GSM485324)
shLuc.1309 (+dox). (fibroblast)		SRR306540(GSM750583)
19-24nt. (ago2 brain)		SRR306537(GSM750580)
19-24nt. (ago2 brain)		GSM519104(GSM519104)
mouse_granulocyte_nuclei_smallRNAs. (cell line)		SRR042471(GSM539863)
mouse TFHS cells [09-002]. (spleen)		SRR039154(GSM471931)
HL1_siSrf2_smallRNAseq. (muscle)		SRR391850(GSM852145)
gender: femalegenotype/variation: ADAR2-/-/AD. (embryo)		GSM510453(GSM510453)
newborn_rep9. (total RNA)		SRR279905(GSM689055)
cell type: mouse embryonic stem cellcell line. (ESC)		SRR039186(GSM485326)
shLuc.1309;ROSA-rtTA (+dox). (fibroblast)		SRR095855BC2(SRX039178)
sequencing of miRNA from wild type and diseas. (heart)		SRR346413(SRX098254)
Global profiling of miRNA and the hairpin pre. (Heart)		SRR029043(GSM433295)
18.5dpc_homo_tdrd1-KO. (tdrd1 testes)		GSM510450(GSM510450)
newborn_rep6. (total RNA)		SRR023851(GSM307160)
ZHBT-c412hsmallrna_rep1. (cell line)		SRR042484(GSM539876)
mouse salivary gland tissue [09-002]. (salivary gland)		SRR023850(GSM307159)
ZHBT-c40hsmallrna_rep1. (cell line)		SRR037905(GSM510441)
brain_rep2. (brain)		SRR042474(GSM539866)
mouse embryonic stem cells [09-002]. (ESC)		mjTestesKO8()
Testes Data. (Zcchc11 testes)		SRR023852(GSM307161)
ZHBT-c424hsmallrna_rep1. (cell line)		SRR306541(GSM750584)
19-24nt. (ago2 brain)		RuiDcrWT(Rui)
DGCR8-dependent microRNA biogenesis is essent. (skin)		SRR039183(GSM485323)
shLuc.1309 (-dox). (fibroblast)		GSM261957(GSM261957)
oocytesmallRNA-19to24. (oocyte)		SRR039610(GSM527274)
small RNA-Seq. (brain)		SRR346418(SRX098259)
Global profiling of miRNA and the hairpin pre. (Liver)		SRR306534(GSM750577)
19-24nt. (ago2 brain)		SRR029123(GSM416611)
NIH3T3. (cell line)		SRR014232(GSM319956)
16.5 dpc MILI. (mili testes)		mjTestesWT3()
Testes Data. (testes)		Ago2IP517(Rui)
Quantitative functions of Argonaute proteins . (ago2 skin)		SRR116846(GSM678422)
Small RNA deep sequencing from mouse epididym. (epididymis)		SRR346420(SRX098261)
Global profiling of miRNA and the hairpin pre. (Uterus)		SRR346415(SRX098256)
source: Testis. (Testes)		SRR037914(GSM510451)
newborn_rep7. (total RNA)		SRR553584(SRX182790)
source: Heart. (Heart)		mjTestesKO7()
Testes Data. (Zcchc11 testes)		SRR248525(GSM733813)
cell type: Thy1- spermatogonial stem cellstra. (testes)
...................................................................................................................................................................................TGATTCTTCTTCCTCCCCTAGT.................................................22150.0017.0011.001.006.002.00-1.00-1.00--1.00------1.00--2.00-1.00----1.00-2.001.001.002.00-1.001.00--1.00-1.00----------1.00-----1.00--1.00---1.001.00---------1.00--1.001.00---1.001.00---1.00--1.00----------
..................................................................................................................................................................................TTGATTCTTCTTCCTCCCCTAGA.................................................23129.0010.002.003.00--2.003.005.001.00-3.002.003.001.00-----1.00--------------1.00--1.00------------------------------------------------1.00----------------
...................................................................................................................................................................................TGATTCTTCTTCCTCCCCTAGA.................................................22129.0017.004.00--1.002.001.002.00-2.002.002.00-1.00---4.002.00-3.00---1.00-----------------------------------------------------1.00----1.00-------------------
..................................................................................................................................................................................TTGATTCTTCTTCCTCCCCTAGT.................................................23126.0010.007.001.00-1.001.002.00-1.002.001.00--1.001.00----2.00----1.001.00-----------1.00----------1.00----------1.00-------------------------------1.00-----------
...................................................................................................................................................................................TGATTCTTCTTCCTCCCCTAG..................................................21117.0017.001.001.005.00---1.00--------4.00-----------1.00-----------1.00---1.00-1.00--------------------1.00-----------------------------------
..................................................................................................................................................................................TTGATTCTTCTTCCTCCCCTAG..................................................22110.0010.00-3.00-----1.001.00--1.00-----1.00---------------1.00-------------------------1.00----------------------------------1.00-------
.................................................................................................................................................................................CTTGATTCTTCTTCCTCCCCTAG..................................................2315.005.00---1.00---3.00--------------------------1.00-------------------------------------------------------------------
.................................................................................................................................................................................CTTGATTCTTCTTCCTCCCCTAGT.................................................2415.005.00---1.00---1.00----------------1.00--------------------------------------1.00----------1.00---------------------------
.................................................................................................................................................................................CTTGATTCTTCTTCCTCCCCTA...................................................2213.003.00------------------1.00-------------------------------------1.00--------------1.00------------------------------
..................................................................................................................................................................................TTGATTCTTCTTCCTCCCCTAGAA................................................2413.0010.00----2.00-----------------------------------------1.00-------------------------------------------------------
..................................................................................................................................................................................TTGATTCTTCTTCCTCCCCTA...................................................2113.003.00--------1.00----2.00----------------------------------------------------------------------------------------
...................................................................................................................................................................................TGATTCTTCTTCCTCCCCTAGAA................................................2313.0017.00-3.00----------------------------------------------------------------------------------------------------
.................................................................................................................................................................................CTTGATTCTTCTTCCTCCCCTT...................................................2213.002.001.00------------------------2.00----------------------------------------------------------------------------
......................................................................................................................................................................................................AGGAGCAGGCAGTCTGTTT.................................193.000.00--------------2.00------1.00--------------------------------------------------------------------------------
...................................................................................................................................................................................TGATTCTTCTTCCTCCCCTAGTA................................................2313.0017.001.00----1.00----------------------------------------------------------------1.00-------------------------------
............................................................................................................................................................................................................AGGCAGTCTCTGAAAGTCCGAGAGC.....................2513.003.00----1.00-----1.00-1.00-----------------------------------------------------------------------------------------
..................................................................................................................................................................................TTGATTCTTCTTCCTCCCCTAGC.................................................2312.0010.002.00-----------------------------------------------------------------------------------------------------
.....................................................................................................................................CTTGGGAGAAAGGAGAATCCC................................................................................................2112.002.00----1.00---------------------------------------------------------------------------------1.00---------------
...................................................................................................................................................................................TGATTCTTCTTCCTCCCCTAGAT................................................2312.0017.00----1.00------------------------------1.00------------------------------------------------------------------
.................................................................................................................................................................................CTTGATTCTTCTTCCTCCCC.....................................................2012.002.00----------------------------------------1.00-----------------------------------1.00-------------------------
.....................................................................................................................................................................................................................CTGAAAGTCCGAGAGCAT...................1812.002.00-------------------------------------2.00----------------------------------------------------------------
......................................................................................................................................................................................................AGGAGCAGGCAGTCTGCGT.................................192.000.00--------------1.00------1.00--------------------------------------------------------------------------------
..................................................................................................................................................................................TTGATTCTTCTTCCTCCCCTAGTA................................................2412.0010.00-----------1.00---------------------------1.00--------------------------------------------------------------
..................................................................................................................................................................................TTGATTCTTCTTCCTCCCCTAGAT................................................2412.0010.00------------1.00-------------------------------------------------------------------------------1.00---------
......................................................................................................................................................................................................................TGAAAGTCCGAGAGCATAAGGTCCTG..........2612.002.00----------------------------1.00---------------------------------1.00---------------------------------------
...................................................................................................................................................................................TGATTCTTCTTCCTCCCCTAGTAG...............................................2412.0017.00---1.00-------------------------------------------------------------------------------------1.00------------
.................................................................................................................................................................................CTTGATTCTTCTTCCTCCCCTAT..................................................2312.003.001.00--1.00--------------------------------------------------------------------------------------------------
.................................................................................................................................................................................CTTGATTCTTCTTCCTCCCCT....................................................2112.002.00-----------1.00-----------------------------------------1.00------------------------------------------------
......................................................................................................................................................................................................AGGAGCAGGCAGTCTCTG..................................1821.501.50--------------1.50---------------------------------------------------------------------------------------
...................................................................................................................................................................................TGATTCTTCTTCCTCCCCTAT..................................................211.000.00-------------------------------------------------------------------------1.00----------------------------
...................................................................................................................................................................................TGATTCTTCTTCCTCCCCTAGATT...............................................2411.0017.00-----------------------------------------------------------------------------------------------1.00------
........................................................................................................................................................................................CTTCTTCCTCCCCTATAA................................................181.000.00------------------------------------------------1.00-----------------------------------------------------
..................................................................................................................................................................................TTGATTCTTCTTCCTCCCCTAGTTC...............................................2511.0010.001.00-----------------------------------------------------------------------------------------------------
.....................................................................................................................................CTTGGGAGAAAGGAGAATCCCCCAAGTGTGGTAAGATTCACCCACTTGATTCTTCTTCCTCCCCTAG..................................................6711.001.00--------------------------1.00---------------------------------------------------------------------------
......................................................................................................................................TTGGGAGAAAGGAGAATCCCCCAAGT..........................................................................................2611.001.00-----1.00------------------------------------------------------------------------------------------------
.....................................................................................................................................CTTGGGAGAAAGGAGAATCCCCCA.............................................................................................2411.001.00---------------------------------------------------------------------------------------------1.00--------
..................................................................................................................................................................................TTGATTCTTCTTCCTCCCCTAGTAA...............................................2511.0010.00----------------------1.00-------------------------------------------------------------------------------
...................................................................................................................................................................................................................................GCATAAGGTCCTGGGTTAT....191.000.00--------------------------------------------------1.00---------------------------------------------------
............................................CAGAGTGCTGCTTTGTGTT...........................................................................................................................................................................................191.000.00------------------------------1.00-----------------------------------------------------------------------
.......................................................................................................................................TGGGAGAAAGGAGAATCCCCCAAG...........................................................................................2411.001.00---------------------------------------------------------------------1.00--------------------------------
....................................................................................................................................................................................................................TCTGAAAGTCCGAGAGCATAAGGTCAT...........271.000.00----------------------------1.00-------------------------------------------------------------------------
..................................................................................................................................................................................TTGATTCTTCTTCCTCCCCTAA..................................................2211.003.00---1.00--------------------------------------------------------------------------------------------------
...................................................................................................................................................................................TGATTCTTCTTCCTCCCCTAGC.................................................2211.0017.00-----1.00------------------------------------------------------------------------------------------------
...................................................................................................................................................................................TGATTCTTCTTCCTCCCCTAGCAG...............................................2411.0017.00------------1.00-----------------------------------------------------------------------------------------
..................................................................................................................................................................................TTGATTCTTCTTCCTCCCCT....................................................2011.001.00------------------------1.00-----------------------------------------------------------------------------
.................................................................................................................................................................................CTTGATTCTTCTTCCTCCCCTAC..................................................2311.003.00-------------1.00----------------------------------------------------------------------------------------
..................................................................................................................................................................................TTGATTCTTCTTCCTCCCCTATT.................................................2311.003.00--------------------1.00---------------------------------------------------------------------------------
...................................................................................................................................................................................TGATTCTTCTTCCTCCCCTAGTAA...............................................2411.0017.00-------------------------------1.00----------------------------------------------------------------------
.........................................................................................................................................................................................................AGCAGGCAGTCTCTGAAAGTCCGAGA.......................2611.001.00-------------------------------------------------1.00----------------------------------------------------
..................................................................................................................................................................................TTGATTCTTCTTCCTCCCCTAGTT................................................2411.0010.00-------------------------------------------------------------1.00----------------------------------------
..................................................................................................................................................................................TTGATTCTTCTTCCTCCCCTAGAAT...............................................2511.0010.00----------------------1.00-------------------------------------------------------------------------------
......................................................................................................................................................................................................AGGAGCAGGCAGTCTGT...................................171.000.00---------------------1.00--------------------------------------------------------------------------------
.......................................................................................................................................TGGGAGAAAGGAGAATCCCCCAAGTG.........................................................................................2611.001.00----------------------------------------------------1.00-------------------------------------------------
...................................................................................................................................................................................TGATTCTTCTTCCTCCCCTAGTGT...............................................2411.0017.00--------1.00---------------------------------------------------------------------------------------------
.......................................................................................................................................TGGGAGAAAGGAGAATCCCCC..............................................................................................2111.001.00--------------------------------------------------------------------------------1.00---------------------
......................................................................................................................................................................................TTCTTCTTCCTCCCCTAGT.................................................1921.000.50-------------1.00----------------------------------------------------------------------------------------
.......................................................................................................................................................................................................GGAGCAGGCAGTCTCTGAA................................1911.001.00---------------------------------------------------------------------------------1.00--------------------
..........................................................................................................TGAGTTTGTAATCTGAATGTCTAAGTGCTTGGGAGAAAGGAGAATCCCCCAAGTGTGGTAAGATTCACCCACTTGATTCTTCTTCCTCCCCTAG..................................................9411.001.00--------------------------1.00---------------------------------------------------------------------------
...................................................................................................................................................................................TGATTCTTCTTCCTCCCCTAGG.................................................2211.001.00-----------------------1.00------------------------------------------------------------------------------
.....................................................................................................................................................................................................................CTGAAAGTCCGAGAGCTCTG.................201.000.00------------------------------------------------------1.00-----------------------------------------------
.................................................................................................................................................................................CTTGATTCTTCTTCCTCCCCTAA..................................................2311.003.001.00-----------------------------------------------------------------------------------------------------
.......................................................................................................................................TGGGAGAAAGGAGAATCC.................................................................................................1811.001.00------------------------------------------------------------------------1.00-----------------------------
..................................................................................................................................................................................TTGATTCTTCTTCCTCCCCTAAA.................................................2311.003.001.00-----------------------------------------------------------------------------------------------------
...................................................................................................................................................................................TGATTCTTCTTCCTCCCCTGGT.................................................221.000.00--------------------------------------1.00---------------------------------------------------------------
.....................................................................................................................TCTGAATGTCTAAGTG.....................................................................................................................1651.001.00------------------------------------------0.200.20----------------------------------------------------0.400.20----
...................................................................................................................................................................................................................................GCATAAGGTCCTGGGTTA.....181.000.00---------------------------------------------------------------------------------------1.00--------------
...................................................................................................................................................................................TGATTCTTCTTCCTCCCCTAGTTT...............................................2411.0017.00-------------------------------------------------------1.00----------------------------------------------
.......................................................................................................................................................................................................................................AAGGTCCTGGGGCCGTAT.1811.001.00-----------------------------------------1.00------------------------------------------------------------
..............................................................................................AAAAGACCCTTTTGAGTTTGT.......................................................................................................................................2111.001.00-----------------------------------------1.00------------------------------------------------------------
.......TCACTGTTTGAAATCAGTGTT..............................................................................................................................................................................................................................211.000.00---1.00--------------------------------------------------------------------------------------------------
......................................................................................................................................TTGGGAGAAAGGAGAATC..................................................................................................1811.001.00-------------------------------------------------------------------1.00----------------------------------
..................................................................................................................................................................................TTGATTCTTCTTCCTCCCCTAT..................................................2211.003.001.00-----------------------------------------------------------------------------------------------------
............................................................................AAGCACCTTCTAATCTAG............................................................................................................................................................181.000.00-------------------------1.00----------------------------------------------------------------------------
...................................................................................................................................................................................TGATTCTTCTTCCTCCCCTAGTAT...............................................2411.0017.00------------------------------------------1.00-----------------------------------------------------------
......................................................................................................................................................................................TTCTTCTTCCTCCCCTAG..................................................1820.500.50--------------------------------------------------------------------------------------------------0.50---
........................................................................................................................................................................................................................................AGGTCCTGGGGCCGT...1520.500.50---------------------------------------------------------------------------------------------------0.50--
......................................................................................................................CTGAATGTCTAAGTG.....................................................................................................................1580.500.50------------------------------------------0.12-----------------------------------------------------0.250.12----
.....................................................................................................................TCTGAATGTCTAAGTGAA...................................................................................................................1850.401.00------------------------------------------------------------------------------------------------0.200.20----
.....................................................................................................................TCTGAATGTCTAAGTGAAGA.................................................................................................................2050.201.00----------------------------------------------------------------------------------------------------0.20-
.....................................................................................................................TCTGAATGTCTAAGTGAAG..................................................................................................................1950.201.00--------------------------------------------0.20---------------------------------------------------------
......................................................................................................................CTGAATGTCTAAGTGAAGA.................................................................................................................1980.120.50-----------------------------------------------------------------------------------------------------0.12

Antisense strand
AATAGTATCACTGTTTGAAATCAGAGTCTAAGGCATTTCTCATGCAGAGTGCTGCTTTGCTATAAAGTGGCCATTAAAGCACCTTCTAATCACTAAAAGACCCTTTTGAGTTTGTAATCTGAATGTCTAAGTGCTTGGGAGAAAGGAGAATCCCCCAAGTGTGGTAAGATTCACCCACTTGATTCTTCTTCCTCCCCTAGGAGCAGGCAGTCTCTGAAAGTCCGAGAGCATAAGGTCCTGGGGCCGTATG
........................................................................................................................................(((((.((((((((((....(((((.(((.......)))))))))))))))))).)))))......................................................
................................................................................................................................129....................................................................200................................................
SizePerfect hitTotal NormPerfect NormSRR546155(SRX180174)
Global profiling of miRNA and the hairpin pre. (ago2 Neuroblastoma)		SRR279904(GSM689054)
cell type: mouse embryonic stem cellcell line. (ESC)		mjLiverWT1()
Liver Data. (liver)		SRR038742(GSM527277)
small RNA-Seq. (dgcr8 brain)		SRR391852(GSM852147)
gender: femalegenotype/variation: ADAR2-/-tis. (embryo)		GSM314557(GSM314557)
ESC dgcr8 (Illumina). (ESC)		SRR402762(SRX117945)
source: ES E14 male cells. (ESC)		SRR553583(SRX182789)
source: Cerebellum. (Cerebellum)		SRR206941(GSM723282)
other. (brain)		Ago1IP517(Rui)
Quantitative functions of Argonaute proteins . (ago1 skin)		SRR391853(GSM852148)
gender: femalegenotype/variation: ADAR2-/-/AD. (embryo)		GSM510444(GSM510444)
brain_rep5. (brain)		SRR391851(GSM852146)
gender: femalegenotype/variation: wild typeti. (embryo)		SRR306542(GSM750585)
19-24nt. (ago2 brain)		SRR345200(SRX097261)
source: size fractionated RNA from mouse hipp. (brain)		SRR402760(SRX117943)
source: ES E14 male cells. (ESC)		SRR390300(GSM849858)
cell line: NIH-3T3cell type: fibroblastinfect. (ago2 fibroblast)		Ago3IP812(Rui)
Quantitative functions of Argonaute proteins . (ago3 skin)		Ago1IP812(Rui)
Quantitative functions of Argonaute proteins . (ago1 skin)		SRR685339(GSM1079783)
Small RNAs (15-50 nts in length) from immorta. (cell line)		SRR206940(GSM723281)
other. (brain)		SRR345198(SRX097259)
source: size fractionated RNA from mouse hipp. (brain)		SRR391845(GSM852140)
gender: femalegenotype/variation: wild typeti. (embryo)		SRR391848(GSM852143)
gender: femalegenotype/variation: wild typeti. (embryo)		SRR038743(GSM527278)
small RNA-Seq. (dicer brain)		SRR345203(SRX097264)
source: size fractionated RNA from mouse hipp. (brain)		SRR346421(SRX098263)
Global profiling of miRNA and the hairpin pre. (mixture)		SRR346423(SRX098265)
Global profiling of miRNA and the hairpin pre. (Brain)		SRR248523(GSM733811)
cell type: Thy1+ spermatogonial stem cellstra. (testes)		SRR346422(SRX098264)
Global profiling of miRNA and the hairpin pre. (Muscle)		SRR040488(GSM533911)
E18.5 wild type LIVER small RNA. (liver)		SRR391846(GSM852141)
gender: femalegenotype/variation: ADAR2-/-tis. (embryo)		SRR042459(GSM539851)
mouse neutrophil cells replicate 1 [09-002]. (blood)		SRR037906(GSM510442)
brain_rep3. (brain)		SRR279903(GSM689053)
cell type: mouse embryonic stem cellcell line. (ESC)		SRR038741(GSM527276)
small RNA-Seq. (brain)		SRR206939(GSM723280)
other. (brain)		SRR059773(GSM562835)
CD4_Dicer. (spleen)		SRR306526(GSM750569)
19-24nt. (ago2 brain)		SRR346417(SRX098258)
Global profiling of miRNA and the hairpin pre. (Brain)		SRR206942(GSM723283)
other. (brain)		SRR391849(GSM852144)
gender: femalegenotype/variation: ADAR2-/-tis. (embryo)		SRR346419(SRX098260)
Global profiling of miRNA and the hairpin pre. (Lung)		SRR346416(SRX098257)
Global profiling of miRNA and the hairpin pre. (Kidney)		SRR345207(SRX097268)
source: size fractionated RNA from mouse hipp. (brain)		GSM510456(GSM510456)
newborn_rep12. (total RNA)		SRR402761(SRX117944)
source: ES E14 male cells. (ESC)		SRR346424(SRX098266)
Global profiling of miRNA and the hairpin pre. (Neuroblastoma)		SRR037907(GSM510443)
brain_rep4. (brain)		SRR042469(GSM539861)
mouse Th2 cells [09-002]. (lymph)		SRR042449(GSM539841)
mouse B cells activated in vitro with LPS/IL4 replicate 2 [09-002]. (b cell)		SRR038744(GSM527279)
small RNA-Seq. (brain)		SRR037929(GSM510467)
e7p5_rep3. (embryo)		SRR306536(GSM750579)
19-24nt. (ago2 brain)		SRR345199(SRX097260)
source: size fractionated RNA from mouse hipp. (brain)		SRR095855BC3(SRX039178)
sequencing of miRNA from wild type and diseas. (heart)		SRR306528(GSM750571)
19-24nt. (ago2 brain)		SRR073954(GSM629280)
total RNA. (blood)		SRR065058(SRR065058)
Tissue-specific Regulation of Mouse MicroRNA . (pancreas)		SRR042481(GSM539873)
mouse pancreatic tissue [09-002]. (pancreas)		SRR306527(GSM750570)
19-24nt. (ago2 brain)		SRR073955(GSM629281)
total RNA. (blood)		GSM509279(GSM509279)
MVH-/- E16.5 small RNA. (testes)		SRR039184(GSM485324)
shLuc.1309 (+dox). (fibroblast)		SRR306540(GSM750583)
19-24nt. (ago2 brain)		SRR306537(GSM750580)
19-24nt. (ago2 brain)		GSM519104(GSM519104)
mouse_granulocyte_nuclei_smallRNAs. (cell line)		SRR042471(GSM539863)
mouse TFHS cells [09-002]. (spleen)		SRR039154(GSM471931)
HL1_siSrf2_smallRNAseq. (muscle)		SRR391850(GSM852145)
gender: femalegenotype/variation: ADAR2-/-/AD. (embryo)		GSM510453(GSM510453)
newborn_rep9. (total RNA)		SRR279905(GSM689055)
cell type: mouse embryonic stem cellcell line. (ESC)		SRR039186(GSM485326)
shLuc.1309;ROSA-rtTA (+dox). (fibroblast)		SRR095855BC2(SRX039178)
sequencing of miRNA from wild type and diseas. (heart)		SRR346413(SRX098254)
Global profiling of miRNA and the hairpin pre. (Heart)		SRR029043(GSM433295)
18.5dpc_homo_tdrd1-KO. (tdrd1 testes)		GSM510450(GSM510450)
newborn_rep6. (total RNA)		SRR023851(GSM307160)
ZHBT-c412hsmallrna_rep1. (cell line)		SRR042484(GSM539876)
mouse salivary gland tissue [09-002]. (salivary gland)		SRR023850(GSM307159)
ZHBT-c40hsmallrna_rep1. (cell line)		SRR037905(GSM510441)
brain_rep2. (brain)		SRR042474(GSM539866)
mouse embryonic stem cells [09-002]. (ESC)		mjTestesKO8()
Testes Data. (Zcchc11 testes)		SRR023852(GSM307161)
ZHBT-c424hsmallrna_rep1. (cell line)		SRR306541(GSM750584)
19-24nt. (ago2 brain)		RuiDcrWT(Rui)
DGCR8-dependent microRNA biogenesis is essent. (skin)		SRR039183(GSM485323)
shLuc.1309 (-dox). (fibroblast)		GSM261957(GSM261957)
oocytesmallRNA-19to24. (oocyte)		SRR039610(GSM527274)
small RNA-Seq. (brain)		SRR346418(SRX098259)
Global profiling of miRNA and the hairpin pre. (Liver)		SRR306534(GSM750577)
19-24nt. (ago2 brain)		SRR029123(GSM416611)
NIH3T3. (cell line)		SRR014232(GSM319956)
16.5 dpc MILI. (mili testes)		mjTestesWT3()
Testes Data. (testes)		Ago2IP517(Rui)
Quantitative functions of Argonaute proteins . (ago2 skin)		SRR116846(GSM678422)
Small RNA deep sequencing from mouse epididym. (epididymis)		SRR346420(SRX098261)
Global profiling of miRNA and the hairpin pre. (Uterus)		SRR346415(SRX098256)
source: Testis. (Testes)		SRR037914(GSM510451)
newborn_rep7. (total RNA)		SRR553584(SRX182790)
source: Heart. (Heart)		mjTestesKO7()
Testes Data. (Zcchc11 testes)		SRR248525(GSM733813)
cell type: Thy1- spermatogonial stem cellstra. (testes)
....................................................................................................................................................................................GATTCTTCTTCCTCCGAAC................................................... 191.000.00--------------------------------------------1.00---------------------------------------------------------
...............................................................................CACCTTCTAATCACTAAAT........................................................................................................................................................ 191.000.00--------------------------------------------------------------------1.00---------------------------------