ID: uc007htw.3
GENE: Tcn2(3)
chr11:3823536-3823754-


(1)
AGO.mut 		(5)
AGO2.ip 		(1)
AGO3.ip 		(10)
BRAIN 		(3)
CELL-LINE 		(1)
DGCR8.mut 		(9)
EMBRYO 		(6)
ESC 		(3)
HEART 		(2)
KIDNEY 		(9)
LIVER 		(1)
LUNG 		(10)
OTHER 		(7)
OTHER.mut 		(2)
PIWI.ip 		(1)
PIWI.mut 		(2)
SKIN 		(2)
SPLEEN 		(16)
TESTES 		(1)
THYMUS 		(5)
TOTAL-RNA

Sense strand
CCCCTGAGGGCTACTTTGGGAATATCTATAGCACCCCACTGGCACTACAGGTAAGAGAGAGACTCTGGAGCCATGACTGCTTAGCGGGTCAATGGAGGGAGGGCTGGTTAGAAGCTGGAGAGCCTGGTTCCTTCCCAGGGGCTAACCTCTGACCTTCTCTTCCTCACAGATGCTCATGACATCTCCTGCATCCGGGGTAGGGCTGGGCACAGCGTGCAT
............................................................................................(((((((((((..(((((((.(((....))).(((..(((....)))..)))...)))))))..))))))))).))...................................................
.......................................................................................88...............................................................................169................................................
SizePerfect hitTotal NormPerfect NormSRR346416(SRX098257)
Global profiling of miRNA and the hairpin pre. (Kidney)		mjLiverKO1()
Liver Data. (Zcchc11 liver)		SRR279907(GSM689057)
cell type: mouse embryonic stem cellcell line. (ESC)		SRR391848(GSM852143)
gender: femalegenotype/variation: wild typeti. (embryo)		SRR546155(SRX180174)
Global profiling of miRNA and the hairpin pre. (ago2 Neuroblastoma)		mjLiverWT3()
Liver Data. (liver)		SRR042459(GSM539851)
mouse neutrophil cells replicate 1 [09-002]. (blood)		SRR346418(SRX098259)
Global profiling of miRNA and the hairpin pre. (Liver)		mjTestesWT4()
Testes Data. (testes)		mjLiverKO3()
Liver Data. (Zcchc11 liver)		SRR402762(SRX117945)
source: ES E14 male cells. (ESC)		mjTestesWT1()
Testes Data. (testes)		SRR391853(GSM852148)
gender: femalegenotype/variation: ADAR2-/-/AD. (embryo)		SRR391851(GSM852146)
gender: femalegenotype/variation: wild typeti. (embryo)		SRR346419(SRX098260)
Global profiling of miRNA and the hairpin pre. (Lung)		SRR553585(SRX182791)
source: Kidney. (Kidney)		mjTestesKO5()
Testes Data. (Zcchc11 testes)		SRR553602(SRX182808)
source: Sertoli cells. (Sertoli cells)		GSM519104(GSM519104)
mouse_granulocyte_nuclei_smallRNAs. (cell line)		SRR023852(GSM307161)
ZHBT-c424hsmallrna_rep1. (cell line)		SRR206942(GSM723283)
other. (brain)		SRR553586(SRX182792)
source: Testis. (testes)		SRR553583(SRX182789)
source: Cerebellum. (Cerebellum)		SRR553582(SRX182788)
source: Brain. (Brain)		SRR391850(GSM852145)
gender: femalegenotype/variation: ADAR2-/-/AD. (embryo)		GSM510450(GSM510450)
newborn_rep6. (total RNA)		SRR345200(SRX097261)
source: size fractionated RNA from mouse hipp. (brain)		SRR391846(GSM852141)
gender: femalegenotype/variation: ADAR2-/-tis. (embryo)		SRR038742(GSM527277)
small RNA-Seq. (dgcr8 brain)		SRR391852(GSM852147)
gender: femalegenotype/variation: ADAR2-/-tis. (embryo)		SRR073954(GSM629280)
total RNA. (blood)		SRR040489(GSM533912)
E18.5 Ago2 catalytically inactive LIVER small RNA. (ago2 liver)		SRR034119(GSM466729)
Mili IP_Tdrd9+/- replicate2. (mili testes)		SRR059765(GSM562827)
DN3_control. (thymus)		SRR553584(SRX182790)
source: Heart. (Heart)		SRR037930(GSM510468)
e7p5_rep4. (embryo)		SRR042462(GSM539854)
mouse macrophages [09-002]. (bone marrow)		SRR095855BC2(SRX039178)
sequencing of miRNA from wild type and diseas. (heart)		GSM640580(GSM640580)
small RNA in the liver with paternal Low pro. (liver)		GSM314552(GSM314552)
ESC wild type (Illumina). (ESC)		Ago3IP812(Rui)
Quantitative functions of Argonaute proteins . (ago3 skin)		SRR029043(GSM433295)
18.5dpc_homo_tdrd1-KO. (tdrd1 testes)		GSM509277(GSM509277)
small RNA cloning by length. (piwi testes)		SRR346425(SRX098267)
Global profiling of miRNA and the hairpin pre. (Neuroblastoma)		mjTestesKO6()
Testes Data. (Zcchc11 testes)		SRR345201(SRX097262)
source: size fractionated RNA from mouse hipp. (brain)		SRR095855BC1(SRX039178)
sequencing of miRNA from wild type and diseas. (heart)		mjTestesKO8()
Testes Data. (Zcchc11 testes)		SRR059769(GSM562831)
Treg_Drosha. (spleen)		SRR037910(GSM510447)
newborn_rep3. (total RNA)		SRR037912(GSM510449)
newborn_rep5. (total RNA)		SRR034121(GSM466731)
Mili IP_Tdrd9-/- replicate2. (mili testes)		SRR402760(SRX117943)
source: ES E14 male cells. (ESC)		mjTestesKO7()
Testes Data. (Zcchc11 testes)		Ago2IP504(Rui)
Quantitative functions of Argonaute proteins . (ago2 skin)		SRR391845(GSM852140)
gender: femalegenotype/variation: wild typeti. (embryo)		SRR306531(GSM750574)
19-24nt. (ago2 brain)		SRR279903(GSM689053)
cell type: mouse embryonic stem cellcell line. (ESC)		SRR069809(GSM610965)
small RNA sequencing; sample 1. (testes)		SRR248524(GSM733812)
cell type: Thy1+ spermatogonial stem cellstra. (testes)		SRR037921(GSM510459)
e12p5_rep3. (embryo)		SRR042463(GSM539855)
mouse natural killer cells [09-002]. (spleen)		GSM640579(GSM640579)
small RNA in the liver with paternal Low pro. (liver)		GSM510456(GSM510456)
newborn_rep12. (total RNA)		SRR685339(GSM1079783)
Small RNAs (15-50 nts in length) from immorta. (cell line)		SRR346424(SRX098266)
Global profiling of miRNA and the hairpin pre. (Neuroblastoma)		SRR037914(GSM510451)
newborn_rep7. (total RNA)		SRR306536(GSM750579)
19-24nt. (ago2 brain)		SRR345196(SRX097257)
source: size fractionated RNA from mouse hipp. (brain)		SRR345204(SRX097265)
source: size fractionated RNA from mouse hipp. (brain)		SRR042457(GSM539849)
mouse mast cells [09-002]. (bone marrow)		SRR306542(GSM750585)
19-24nt. (ago2 brain)		SRR065050(SRR065050)
Tissue-specific Regulation of Mouse MicroRNA . (liver)		SRR346422(SRX098264)
Global profiling of miRNA and the hairpin pre. (Muscle)		SRR402766(SRX117949)
source: ES PGK female cells. (ESC)		SRR037902(GSM510438)
testes_rep3. (testes)		SRR040488(GSM533911)
E18.5 wild type LIVER small RNA. (liver)		GSM509279(GSM509279)
MVH-/- E16.5 small RNA. (testes)		SRR248523(GSM733811)
cell type: Thy1+ spermatogonial stem cellstra. (testes)
...................................................................................................................................................TCTGACCTTCTCTTCCTCACAGT.................................................23117.004.002.00----4.00---4.00---------------2.00--2.00----------1.00---------1.00----------------1.00------------
............................................................................................TGGAGGGAGGGCTGGTTAGA...........................................................................................................20115.0015.00--5.00-1.00-2.00--------1.001.00----1.001.00----1.00--------------------------1.00----1.00-------------------
...........................................................................................ATGGAGGGAGGGCTGGTTAGA...........................................................................................................21113.0013.002.00---2.00------4.00-1.001.00--1.00--1.00-----------------------------------------------------1.00----
.....GAGGGCTACTTTGGGAAT....................................................................................................................................................................................................1819.009.00---3.00--------1.00-----------2.00--1.00-1.00-------------------------1.00-----------------------
............................................................................................TGGAGGGAGGGCTGGTTAGAA..........................................................................................................2119.009.00----1.00--------1.00----1.002.00-1.00-2.00----------------------------------1.00--------------------
............................................................................................TGGAGGGAGGGCTGGTTAGAAG.........................................................................................................2217.007.00---1.00--------1.00----1.00-----------1.001.00-----1.00------------------------------1.00-----------
...................................................................................................................................................TCTGACCTTCTCTTCCTCAC....................................................2017.007.001.006.00-----------------------------------------------------------------------------
............................................................................................TGGAGGGAGGGCTGGTTAGAAA.........................................................................................................2215.009.00--------4.00------1.00---------------------------------------------------------------
.....................................................................................................................................................TGACCTTCTCTTCCTCACAGT.................................................214.000.00-------------1.00--------------------------1.00-------1.00-----------1.00------------------
...................................................................................................................................................TCTGACCTTCTCTTCCTCACAG..................................................2214.004.001.002.00-----1.00-----------------------------------------------------------------------
............................................................................................TGGAGGGAGGGCTGGTTAG............................................................................................................1913.003.00--2.00------------------------------------------------------------------1.00---------
............................................................................................TGGAGGGAGGGCTGGTTAGAAGT........................................................................................................2313.007.00----------2.00---------1.00----------------------------------------------------------
...........................................................................................ATGGAGGGAGGGCTGGTTAG............................................................................................................2013.003.001.00-----1.00--------1.00---------------------------------------------------------------
..................................................................................................................................................CTCTGACCTTCTCTTCCTCACA...................................................2212.002.00-----------------------------------1.00--------1.00----------------------------------
...........................................................................................................................................................................................GCATCCGGGGTAGGGCTGGGCACAGCGTG...2912.002.00----------------------------------------------------------------------------1.001.00-
..CCTGAGGGCTACTTTGGGAA.....................................................................................................................................................................................................2012.002.00--------------------------------------------------1.00------------1.00---------------
................TGGGAATATCTATAGCACCCCACTGGCAC..............................................................................................................................................................................2912.002.00--------------------------------1.00---------1.00------------------------------------
..................................................GTAAGAGAGAGACTCTGGAGCCATGA...............................................................................................................................................2612.002.00----------------1.00------------------------------1.00-------------------------------
...................................................................................................................................................................................................GGTAGGGCTGGGCACAGC......1812.002.002.00------------------------------------------------------------------------------
..........................................................................................AATGGAGGGAGGGCTGGTTAGAA..........................................................................................................2312.002.001.00-------------------------------------1.00----------------------------------------
...................................................................................................................................................TCTGACCTTCTCTTCCTCACAGA.................................................2312.002.00--------------1.00--------------------------------------------------1.00-------------
.............................................................................................GGAGGGAGGGCTGGTTAGA...........................................................................................................1912.002.00----------------1.00--------------------------------------------------------1.00-----
.............................................................................................................................................................................................ATCCGGGGTAGGGCTGGGCACAGCGTG...2712.002.00-------1.00-------------------------1.00---------------------------------------------
..............TTTGGGAATATCTATAG............................................................................................................................................................................................1711.001.001.00------------------------------------------------------------------------------
............................................................................................TGGAGGGAGGGCTGGTTAGAAGTAT......................................................................................................2511.007.00----------------------------------------------------------------------1.00--------
..............................................................................................................................................................................CATGACATCTCCTGCATCCGGGGTAGGGC................2911.001.00--------------1.00----------------------------------------------------------------
......................................................................................................................................................................................................AGGGCTGGGCACAGCGCCC..191.000.00--------------------------1.00----------------------------------------------------
...CTGAGGGCTACTTTGGGAAT....................................................................................................................................................................................................2011.001.001.00------------------------------------------------------------------------------
....TGAGGGCTACTTTGGGAATATCT................................................................................................................................................................................................2311.001.00-------------------------------------------1.00-----------------------------------
............................................................................................TGGAGGGAGGGCTGGTTAGAAGC........................................................................................................2311.001.00-----------------1.00-------------------------------------------------------------
.....................................................................................................................................................................ACAGATGCTCATGACATCTCCTGC..............................2411.001.00------------1.00------------------------------------------------------------------
............................................................................................................TAGAAGCTGGAGAGCCCTA............................................................................................191.000.00---------------------------------------------------------------------------1.00---
............................................................................................TGGAGGGAGGGCTGGTTAGAAGA........................................................................................................2311.007.001.00------------------------------------------------------------------------------
...................................................................................................................................................................................CATCTCCTGCATCCGGGGTAGGGCTGG.............2711.001.001.00------------------------------------------------------------------------------
........................................................................................................................................................................................CCTGCATCCGGGGTAG...................1611.001.001.00------------------------------------------------------------------------------
...............................................................................................AGGGAGGGCTGGTTAGAAGCTT......................................................................................................221.000.00----1.00--------------------------------------------------------------------------
.............................................................................................GGAGGGAGGGCTGGTTAGAAGCT.......................................................................................................2311.001.00----------1.00--------------------------------------------------------------------
................TGGGAATATCTATAGCACCCCACTGGCACT.............................................................................................................................................................................3011.001.00---------------------------------------------------1.00---------------------------
.......................................................................................................................................................................................TCCTGCATCCGGGGTAGGGCTGGGC...........2511.001.00-----------------------------------------1.00-------------------------------------
.................................CCCCACTGGCACTACCGCT.......................................................................................................................................................................191.000.00---------------------------------------------1.00---------------------------------
...............TTGGGAATATCTATAGC...........................................................................................................................................................................................1711.001.001.00------------------------------------------------------------------------------
......................................................................................................................................................................................................AGGGCTGGGCACAGCGTGCAT2111.001.00------------1.00------------------------------------------------------------------
............................................................................................TGGAGGGAGGGCTGGTTAGT...........................................................................................................2011.003.00--------------------------------------------------------1.00----------------------
...........................................................................................................................................................................................GCATCCGGGGTAGGGCTGG.............1911.001.001.00------------------------------------------------------------------------------
..............................................................................................................................................................................................TCCGGGGTAGGGCTGGGCAC.........2011.001.00----------1.00--------------------------------------------------------------------
............................................................................................TGGAGGGAGGGCTGGTTAGAT..........................................................................................................2111.0015.001.00------------------------------------------------------------------------------
...................................................................................................................................................TCTGACCTTCTCTTCCTCACTGA.................................................2311.007.00-----1.00-------------------------------------------------------------------------
..........................................................................................................................................................................................TGCATCCGGGGTAGGGC................1711.001.001.00------------------------------------------------------------------------------
..............................................................................................................................................TAACCTCTGACCTTCTCTTCCTA......................................................231.000.00-------------------------------------------------------------1.00-----------------
.......GGGCTACTTTGGGAATATC.................................................................................................................................................................................................1911.001.001.00------------------------------------------------------------------------------
............................................................................................................................................................................................CATCCGGGGTAGGGCTGGGCACAGCGTG...2811.001.00-----------------------------------------------------1.00-------------------------
..........................................................................................AATGGAGGGAGGGCTGGTTAGA...........................................................................................................2211.001.00----------------------------------------------------1.00--------------------------
............................................................................................TGGAGGGAGGGCTGGTTAGAAGTT.......................................................................................................2411.007.00--------------------------------------------------------------1.00----------------
............................................................................................TGGAGGGAGGGCTGGTTAGTT..........................................................................................................2111.003.00------1.00------------------------------------------------------------------------
...........................................................................................ATGGAGGGAGGGCTGGTTAGAAGT........................................................................................................241.000.00---------------------------------------------------------1.00---------------------
..............................................................................................................................................................................................TCCGGGGTAGGGCTGGGCACAGCGT....2511.001.00------------------1.00------------------------------------------------------------
...................................................................................................................................TTCCCAGGGGCTAACCTCCG....................................................................201.000.00----------------------------------------------------------------1.00--------------
..................................................................................................................................................CTCTGACCTTCTCTTCCTCAC....................................................2111.001.00----------------------------------------------1.00--------------------------------
..................................................................................................................................................CTCTGACCTTCTCTTCCTCACATA.................................................2411.002.00-------------------------------------1.00-----------------------------------------
................................................................................................................................................................................................CGGGGTAGGGCTGGGCACAGCGTA...241.000.00------------------------------------------------------------------------1.00------
.....................................................................................................................................................................ACAGATGCTCATGACATCTCCT................................2211.001.00---1.00---------------------------------------------------------------------------
............................................................................................TGGAGGGAGGGCTGGTTAGAAAT........................................................................................................2311.009.00----------------------1.00--------------------------------------------------------
...........................................................................................ATGGAGGGAGGGCTGGTTAGTTT.........................................................................................................2311.003.00------1.00------------------------------------------------------------------------
............................................................................................TGGAGGGAGGGCTGGTTAGAAT.........................................................................................................2211.009.00------------------1.00------------------------------------------------------------
........GGCTACTTTGGGAATATCTATAGCACCCC......................................................................................................................................................................................2911.001.00-------1.00-----------------------------------------------------------------------
...................................................................................................................................................TCTGACCTTCTCTTCCTCACA...................................................2111.001.00----------------------------------1.00--------------------------------------------
..................................................................................................................................................................................................GGGTAGGGCTGGGCACAGCGTGCA.2411.001.00-------1.00-----------------------------------------------------------------------
.............................................................................................................................................................................................ATCCGGGGTAGGGCTGGGCACAGCGTGC..2811.001.00-------------------------------1.00-----------------------------------------------
...................................................................................................................................................................................................GGTAGGGCTGGGCACAG.......1730.330.330.33------------------------------------------------------------------------------
................................................................................................................................................................................................CGGGGTAGGGCTGGGTCG.........1870.140.14-------------0.14-----------------------------------------------------------------
................................................................................................................................................................................................CGGGGTAGGGCTGGG............1570.140.14------------------------------------------------------------------------------0.14
...........................................................................................................................................GGCTAACCTCTGACC.................................................................1570.140.14-------0.14-----------------------------------------------------------------------

Antisense strand
CCCCTGAGGGCTACTTTGGGAATATCTATAGCACCCCACTGGCACTACAGGTAAGAGAGAGACTCTGGAGCCATGACTGCTTAGCGGGTCAATGGAGGGAGGGCTGGTTAGAAGCTGGAGAGCCTGGTTCCTTCCCAGGGGCTAACCTCTGACCTTCTCTTCCTCACAGATGCTCATGACATCTCCTGCATCCGGGGTAGGGCTGGGCACAGCGTGCAT
............................................................................................(((((((((((..(((((((.(((....))).(((..(((....)))..)))...)))))))..))))))))).))...................................................
.......................................................................................88...............................................................................169................................................
SizePerfect hitTotal NormPerfect NormSRR346416(SRX098257)
Global profiling of miRNA and the hairpin pre. (Kidney)		mjLiverKO1()
Liver Data. (Zcchc11 liver)		SRR279907(GSM689057)
cell type: mouse embryonic stem cellcell line. (ESC)		SRR391848(GSM852143)
gender: femalegenotype/variation: wild typeti. (embryo)		SRR546155(SRX180174)
Global profiling of miRNA and the hairpin pre. (ago2 Neuroblastoma)		mjLiverWT3()
Liver Data. (liver)		SRR042459(GSM539851)
mouse neutrophil cells replicate 1 [09-002]. (blood)		SRR346418(SRX098259)
Global profiling of miRNA and the hairpin pre. (Liver)		mjTestesWT4()
Testes Data. (testes)		mjLiverKO3()
Liver Data. (Zcchc11 liver)		SRR402762(SRX117945)
source: ES E14 male cells. (ESC)		mjTestesWT1()
Testes Data. (testes)		SRR391853(GSM852148)
gender: femalegenotype/variation: ADAR2-/-/AD. (embryo)		SRR391851(GSM852146)
gender: femalegenotype/variation: wild typeti. (embryo)		SRR346419(SRX098260)
Global profiling of miRNA and the hairpin pre. (Lung)		SRR553585(SRX182791)
source: Kidney. (Kidney)		mjTestesKO5()
Testes Data. (Zcchc11 testes)		SRR553602(SRX182808)
source: Sertoli cells. (Sertoli cells)		GSM519104(GSM519104)
mouse_granulocyte_nuclei_smallRNAs. (cell line)		SRR023852(GSM307161)
ZHBT-c424hsmallrna_rep1. (cell line)		SRR206942(GSM723283)
other. (brain)		SRR553586(SRX182792)
source: Testis. (testes)		SRR553583(SRX182789)
source: Cerebellum. (Cerebellum)		SRR553582(SRX182788)
source: Brain. (Brain)		SRR391850(GSM852145)
gender: femalegenotype/variation: ADAR2-/-/AD. (embryo)		GSM510450(GSM510450)
newborn_rep6. (total RNA)		SRR345200(SRX097261)
source: size fractionated RNA from mouse hipp. (brain)		SRR391846(GSM852141)
gender: femalegenotype/variation: ADAR2-/-tis. (embryo)		SRR038742(GSM527277)
small RNA-Seq. (dgcr8 brain)		SRR391852(GSM852147)
gender: femalegenotype/variation: ADAR2-/-tis. (embryo)		SRR073954(GSM629280)
total RNA. (blood)		SRR040489(GSM533912)
E18.5 Ago2 catalytically inactive LIVER small RNA. (ago2 liver)		SRR034119(GSM466729)
Mili IP_Tdrd9+/- replicate2. (mili testes)		SRR059765(GSM562827)
DN3_control. (thymus)		SRR553584(SRX182790)
source: Heart. (Heart)		SRR037930(GSM510468)
e7p5_rep4. (embryo)		SRR042462(GSM539854)
mouse macrophages [09-002]. (bone marrow)		SRR095855BC2(SRX039178)
sequencing of miRNA from wild type and diseas. (heart)		GSM640580(GSM640580)
small RNA in the liver with paternal Low pro. (liver)		GSM314552(GSM314552)
ESC wild type (Illumina). (ESC)		Ago3IP812(Rui)
Quantitative functions of Argonaute proteins . (ago3 skin)		SRR029043(GSM433295)
18.5dpc_homo_tdrd1-KO. (tdrd1 testes)		GSM509277(GSM509277)
small RNA cloning by length. (piwi testes)		SRR346425(SRX098267)
Global profiling of miRNA and the hairpin pre. (Neuroblastoma)		mjTestesKO6()
Testes Data. (Zcchc11 testes)		SRR345201(SRX097262)
source: size fractionated RNA from mouse hipp. (brain)		SRR095855BC1(SRX039178)
sequencing of miRNA from wild type and diseas. (heart)		mjTestesKO8()
Testes Data. (Zcchc11 testes)		SRR059769(GSM562831)
Treg_Drosha. (spleen)		SRR037910(GSM510447)
newborn_rep3. (total RNA)		SRR037912(GSM510449)
newborn_rep5. (total RNA)		SRR034121(GSM466731)
Mili IP_Tdrd9-/- replicate2. (mili testes)		SRR402760(SRX117943)
source: ES E14 male cells. (ESC)		mjTestesKO7()
Testes Data. (Zcchc11 testes)		Ago2IP504(Rui)
Quantitative functions of Argonaute proteins . (ago2 skin)		SRR391845(GSM852140)
gender: femalegenotype/variation: wild typeti. (embryo)		SRR306531(GSM750574)
19-24nt. (ago2 brain)		SRR279903(GSM689053)
cell type: mouse embryonic stem cellcell line. (ESC)		SRR069809(GSM610965)
small RNA sequencing; sample 1. (testes)		SRR248524(GSM733812)
cell type: Thy1+ spermatogonial stem cellstra. (testes)		SRR037921(GSM510459)
e12p5_rep3. (embryo)		SRR042463(GSM539855)
mouse natural killer cells [09-002]. (spleen)		GSM640579(GSM640579)
small RNA in the liver with paternal Low pro. (liver)		GSM510456(GSM510456)
newborn_rep12. (total RNA)		SRR685339(GSM1079783)
Small RNAs (15-50 nts in length) from immorta. (cell line)		SRR346424(SRX098266)
Global profiling of miRNA and the hairpin pre. (Neuroblastoma)		SRR037914(GSM510451)
newborn_rep7. (total RNA)		SRR306536(GSM750579)
19-24nt. (ago2 brain)		SRR345196(SRX097257)
source: size fractionated RNA from mouse hipp. (brain)		SRR345204(SRX097265)
source: size fractionated RNA from mouse hipp. (brain)		SRR042457(GSM539849)
mouse mast cells [09-002]. (bone marrow)		SRR306542(GSM750585)
19-24nt. (ago2 brain)		SRR065050(SRR065050)
Tissue-specific Regulation of Mouse MicroRNA . (liver)		SRR346422(SRX098264)
Global profiling of miRNA and the hairpin pre. (Muscle)		SRR402766(SRX117949)
source: ES PGK female cells. (ESC)		SRR037902(GSM510438)
testes_rep3. (testes)		SRR040488(GSM533911)
E18.5 wild type LIVER small RNA. (liver)		GSM509279(GSM509279)
MVH-/- E16.5 small RNA. (testes)		SRR248523(GSM733811)
cell type: Thy1+ spermatogonial stem cellstra. (testes)
..........CTACTTTGGGAATATCT................................................................................................................................................................................................ 171.000.00-----------------------------------------------------------------------1.00-------
.................................................................TGGAGCCATGACTGCAA......................................................................................................................................... 171.000.00------------------------------1.00------------------------------------------------
..........................................................................................................................CCTGGTTCCTTCCCATAG............................................................................... 181.000.00--------------------------1.00----------------------------------------------------
..................................................................GGAGCCATGACTGCTCGC....................................................................................................................................... 181.000.00--------------------------------------------------------------------1.00----------