| (1) AGO.mut | (1) AGO1.ip | (6) AGO2.ip | (1) AGO3.ip | (4) B-CELL | (13) BRAIN | (3) CELL-LINE | (1) DCR.mut | (1) DGCR8.mut | (4) EMBRYO | (7) ESC | (3) FIBROBLAST | (1) HEART | (1) KIDNEY | (4) LIVER | (4) LYMPH | (9) OTHER | (7) OTHER.mut | (1) PIWI.ip | (2) SKIN | (2) SPLEEN | (17) TESTES | (4) TOTAL-RNA |
| CCCAACGAGGGTGTTGAGTACGTGCCCAGGCCTCTCGAATCTGTGTTTCTGTTCCACATGAAGCCACGGAGAGGCCCTTTGGGGACAGACCTCTGGCTCTGGGAAAGGCTGAGCCACACATTTTTCTGAGATGAGAGGCACTCTGGTTTTGTGAGTTGTATGTATGCCTCCTAGCCAGGCTGATGTCTCTCTAACCACAGGACACTGCCCAAGCCCCACCTGGAGGCCATTGTGGAGAATCTCCGCACCT ....................................................................................................................................((((((((.(((((((....(((..((....))..)))..)))))))....))))))))........................................................... ..............................................................................................................................127......................................................................200................................................ | Size | Perfect hit | Total Norm | Perfect Norm | SRR390300(GSM849858) cell line: NIH-3T3cell type: fibroblastinfect. (ago2 fibroblast) | SRR390299(GSM849857) cell line: NIH-3T3cell type: fibroblastip ant. (ago2 fibroblast) | SRR279904(GSM689054) cell type: mouse embryonic stem cellcell line. (ESC) | mjLiverKO1() Liver Data. (Zcchc11 liver) | SRR390297(GSM849855) cell line: NIH-3T3cell type: fibroblastip ant. (fibroblast) | mjTestesWT1() Testes Data. (testes) | SRR402761(SRX117944) source: ES E14 male cells. (ESC) | SRR345203(SRX097264) source: size fractionated RNA from mouse hipp. (brain) | SRR279903(GSM689053) cell type: mouse embryonic stem cellcell line. (ESC) | SRR546155(SRX180174) Global profiling of miRNA and the hairpin pre. (ago2 Neuroblastoma) | SRR059769(GSM562831) Treg_Drosha. (spleen) | SRR029042(GSM433294) 18.5dpc_hetero_tdrd1-KO. (tdrd1 testes) | SRR042458(GSM539850) mouse basophil cells [09-002]. (b cell) | mjTestesWT4() Testes Data. (testes) | SRR391848(GSM852143) gender: femalegenotype/variation: wild typeti. (embryo) | SRR391847(GSM852142) gender: femalegenotype/variation: ADAR2-/-/AD. (embryo) | SRR029043(GSM433295) 18.5dpc_homo_tdrd1-KO. (tdrd1 testes) | SRR248526(GSM733814) cell type: Thy1- spermatogonial stem cellstra. (testes) | SRR306535(GSM750578) 19-24nt. (ago2 brain) | SRR042468(GSM539860) mouse Th1 cells [09-002]. (lymph) | SRR073955(GSM629281) total RNA. (blood) | SRR038742(GSM527277) small RNA-Seq. (dgcr8 brain) | SRR037914(GSM510451) newborn_rep7. (total RNA) | SRR346424(SRX098266) Global profiling of miRNA and the hairpin pre. (Neuroblastoma) | SRR685339(GSM1079783) Small RNAs (15-50 nts in length) from immorta. (cell line) | SRR042470(GSM539862) mouse Th17 cells [09-002]. (lymph) | SRR014232(GSM319956) 16.5 dpc MILI. (mili testes) | mjTestesWT3() Testes Data. (testes) | SRR306534(GSM750577) 19-24nt. (ago2 brain) | GSM509280(GSM509280) small RNA cloning by length. (testes) | mjTestesKO6() Testes Data. (Zcchc11 testes) | SRR042461(GSM539853) mouse dendritic cells [09-002]. (bone marrow) | SRR402762(SRX117945) source: ES E14 male cells. (ESC) | GSM640579(GSM640579) small RNA in the liver with paternal Low pro. (liver) | SRR306544(GSM750587) 19-24nt. (ago2 brain) | SRR042463(GSM539855) mouse natural killer cells [09-002]. (spleen) | SRR014231(GSM319955) 16.5 dpc total. (testes) | SRR042455(GSM539847) mouse plasma cells [09-002]. (blood) | SRR069809(GSM610965) small RNA sequencing; sample 1. (testes) | SRR553602(SRX182808) source: Sertoli cells. (Sertoli cells) | SRR042472(GSM539864) mouse iTreg cells [09-002]. (lymph) | SRR029038(GSM433290) 25dpp_hetero_tdrd6-KO. (tdrd6 testes) | Ago1IP517(Rui) Quantitative functions of Argonaute proteins . (ago1 skin) | SRR042454(GSM539846) mouse germinal center B cells (lymph node) [09-002]. (b cell) | SRR037910(GSM510447) newborn_rep3. (total RNA) | SRR345202(SRX097263) source: size fractionated RNA from mouse hipp. (brain) | SRR402766(SRX117949) source: ES PGK female cells. (ESC) | Ago3IP805(Rui) Quantitative functions of Argonaute proteins . (ago3 skin) | SRR248523(GSM733811) cell type: Thy1+ spermatogonial stem cellstra. (testes) | GSM475281(GSM475281) total RNA. (testes) | SRR248525(GSM733813) cell type: Thy1- spermatogonial stem cellstra. (testes) | SRR042469(GSM539861) mouse Th2 cells [09-002]. (lymph) | SRR042456(GSM539848) mouse hematopoetic progenitor cells [09-002]. (bone marrow) | GSM510456(GSM510456) newborn_rep12. (total RNA) | SRR394084(GSM855970) background strain: C57BL6/SV129cell type: KRa. (dicer cell line) | SRR391851(GSM852146) gender: femalegenotype/variation: wild typeti. (embryo) | SRR029123(GSM416611) NIH3T3. (cell line) | SRR040489(GSM533912) E18.5 Ago2 catalytically inactive LIVER small RNA. (ago2 liver) | SRR206942(GSM723283) other. (brain) | SRR391849(GSM852144) gender: femalegenotype/variation: ADAR2-/-tis. (embryo) | SRR279906(GSM689056) cell type: mouse embryonic stem cellcell line. (ESC) | SRR039152(GSM471929) HL1_siNon_smallRNAseq. (muscle) | GSM509275(GSM509275) MitoPLD+/+ E16.5 small RNA. (testes) | mjTestesKO8() Testes Data. (Zcchc11 testes) | SRR095855BC1(SRX039178) sequencing of miRNA from wild type and diseas. (heart) | SRR345201(SRX097262) source: size fractionated RNA from mouse hipp. (brain) | GSM510455(GSM510455) newborn_rep11. (total RNA) | SRR346417(SRX098258) Global profiling of miRNA and the hairpin pre. (Brain) | SRR346425(SRX098267) Global profiling of miRNA and the hairpin pre. (Neuroblastoma) | SRR042488(GSM539880) mouse BclXL germinal center B cells [BalbC] [09-002]. (B cell) | SRR279905(GSM689055) cell type: mouse embryonic stem cellcell line. (ESC) | SRR206939(GSM723280) other. (brain) | SRR553582(SRX182788) source: Brain. (Brain) | SRR345205(SRX097266) source: size fractionated RNA from mouse hipp. (brain) | SRR042450(GSM539842) mouse B cells activated in vitro with LPS/IL4 replicate 3 [09-002]. (b cell) | mjLiverKO3() Liver Data. (Zcchc11 liver) | SRR345198(SRX097259) source: size fractionated RNA from mouse hipp. (brain) | SRR346416(SRX098257) Global profiling of miRNA and the hairpin pre. (Kidney) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ...................................................................................................................................TGAGAGGCACTCTGGTTTTGTGA................................................................................................ | 23 | 1 | 45.00 | 45.00 | 8.00 | 3.00 | 4.00 | - | 5.00 | - | 2.00 | - | 2.00 | - | 1.00 | 3.00 | - | 3.00 | - | 1.00 | 2.00 | 2.00 | - | - | - | - | 1.00 | 1.00 | - | - | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | 1.00 | - | - | - | - | 1.00 | - | - | - | - | 1.00 | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - |
| .................................................................................................................................GATGAGAGGCACTCTGGTTTTGT.................................................................................................. | 23 | 1 | 13.00 | 13.00 | - | - | - | - | - | - | - | 2.00 | - | - | 1.00 | - | 1.00 | - | - | 2.00 | - | - | - | - | - | 1.00 | - | - | - | - | - | - | 2.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - |
| .................................................................................................................................GATGAGAGGCACTCTGGTTTTGTGT................................................................................................ | 25 | 7.00 | 0.00 | - | - | - | - | - | 5.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .....................................................................................CAGACCTCTGGCTCTGGGAAAGGCTGA.......................................................................................................................................... | 27 | 1 | 6.00 | 6.00 | - | - | - | 6.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..................................................................................................................................ATGAGAGGCACTCTGGTTTTGTGA................................................................................................ | 24 | 1 | 6.00 | 6.00 | - | - | 3.00 | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..........................................................................................................................................................................CTAGCCAGGCTGATGTCTCTCT.......................................................... | 22 | 1 | 6.00 | 6.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | 1.00 | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..................................................................................................................................ATGAGAGGCACTCTGGTTTTGT.................................................................................................. | 22 | 1 | 5.00 | 5.00 | - | 3.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - |
| ..................................................................................................................................ATGAGAGGCACTCTGGTTTTGTG................................................................................................. | 23 | 1 | 5.00 | 5.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - |
| .................................................................................................................................GATGAGAGGCACTCTGGTTTTG................................................................................................... | 22 | 1 | 4.00 | 4.00 | - | - | - | - | - | - | - | 3.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - |
| ...................................................................................................................................TGAGAGGCACTCTGGTTTTGT.................................................................................................. | 21 | 1 | 4.00 | 4.00 | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...................................................................................................................................TGAGAGGCACTCTGGTTTTGTGT................................................................................................ | 23 | 1 | 4.00 | 4.00 | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...................................................................................................................................TGAGAGGCACTCTGGTTTTGTG................................................................................................. | 22 | 1 | 4.00 | 4.00 | - | - | - | - | - | - | 3.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .................................................................................................................................GATGAGAGGCACTCTGGTTTTGTGA................................................................................................ | 25 | 1 | 3.00 | 3.00 | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..........................................................................................................................................................................CTAGCCAGGCTGATGTCTCTC........................................................... | 21 | 1 | 2.00 | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..........................................................................................................................................................................CTAGCCAGGCTGATGTCT.............................................................. | 18 | 1 | 2.00 | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..........................................................................................................................................................................CTAGCCAGGCTGATGTCTCTCTA......................................................... | 23 | 1 | 2.00 | 2.00 | - | - | - | - | - | - | - | - | - | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...................................................................................................................................TGAGAGGCACTCTGGTTTTGTGAT............................................................................................... | 24 | 1 | 2.00 | 45.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..................................................................................................................................ATGAGAGGCACTCTGGTTTTGTGT................................................................................................ | 24 | 1 | 2.00 | 5.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - |
| .................................................................................................................................GATGAGAGGCACTCTGGTTTTGTGAGT.............................................................................................. | 27 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .......................................................................................................................................AGGCACTCTGGTTTTGTGA................................................................................................ | 19 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..................................................................................................................................ATGAGAGGCACTCTGGTTTTG................................................................................................... | 21 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ............................................................................................................................................................................................................................TGGAGGCCATTGTGGAGCA........... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ................................................................................................................................AGATGAGAGGCACTCTGGTTTTGAT................................................................................................. | 25 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...........................................................................................................................................................................TAGCCAGGCTGATGTCTCTCT.......................................................... | 21 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...............................................................................................................................................................................................................CCCAAGCCCCACCTGGAGGCCAT.................... | 23 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..........................................................................................................................................................................CTAGCCAGGCTGATGTCTCTCTAACC...................................................... | 26 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .................................................................................................................................GATGAGAGGCACTCTGGTTTTGTAT................................................................................................ | 25 | 1 | 1.00 | 13.00 | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ................................................................................GGGGACAGACCTCTGGATT....................................................................................................................................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | |
| ......................................................................................................................................................................................................................................TGTGGAGAATCTCCGCACC. | 19 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .............................................................................................................................................TCTGGTTTTGTGAGTTGTATT........................................................................................ | 21 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...............................................................................................................................GAGATGAGAGGCACTCTGGTTTT.................................................................................................... | 23 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...................................................................................................................................TGAGAGGCACTCTGGTTTTGTGAAA.............................................................................................. | 25 | 1 | 1.00 | 45.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ................................................................................................................................AGATGAGAGGCACTCTGGTTTTGT.................................................................................................. | 24 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ....................................................................................................................................................................TGCCTCCTAGCCAGGCTGATGTCTCT............................................................ | 26 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - |
| ........................................................................................................................TTTTTCTGAGATGAGGA................................................................................................................. | 17 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ........................................................................................................................................GGCACTCTGGTTTTGTG................................................................................................. | 17 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .................................................................................................................................GATGAGAGGCACTCTGGTTTT.................................................................................................... | 21 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .........GGTGTTGAGTACGTGCCCAGGCCTCTCGAA................................................................................................................................................................................................................... | 30 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .............................................................................................TGGCTCTGGGAAAGGCAAGG......................................................................................................................................... | 20 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...................................................................................................................................TGAGAGGCACTCTGGTTTTG................................................................................................... | 20 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - |
| ........................................................................................................................................................................................GTCTCTCTAACCACATTT................................................ | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ............................................................................................................................................CTCTGGTTTTGTGAGTCTGA.......................................................................................... | 20 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | |
| ............................................................................................................................................................................................................................TGGAGGCCATTGTGGA.............. | 16 | 4 | 0.25 | 0.25 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.25 |
| .................................................................................................................................................................................................ACCACAGGACACTGCC......................................... | 16 | 4 | 0.25 | 0.25 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.25 | - |
| .....................................................................................................................................AGAGGCACTCTGGTTT..................................................................................................... | 16 | 5 | 0.20 | 0.20 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.20 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| CCCAACGAGGGTGTTGAGTACGTGCCCAGGCCTCTCGAATCTGTGTTTCTGTTCCACATGAAGCCACGGAGAGGCCCTTTGGGGACAGACCTCTGGCTCTGGGAAAGGCTGAGCCACACATTTTTCTGAGATGAGAGGCACTCTGGTTTTGTGAGTTGTATGTATGCCTCCTAGCCAGGCTGATGTCTCTCTAACCACAGGACACTGCCCAAGCCCCACCTGGAGGCCATTGTGGAGAATCTCCGCACCT ....................................................................................................................................((((((((.(((((((....(((..((....))..)))..)))))))....))))))))........................................................... ..............................................................................................................................127......................................................................200................................................ | Size | Perfect hit | Total Norm | Perfect Norm | SRR390300(GSM849858) cell line: NIH-3T3cell type: fibroblastinfect. (ago2 fibroblast) | SRR390299(GSM849857) cell line: NIH-3T3cell type: fibroblastip ant. (ago2 fibroblast) | SRR279904(GSM689054) cell type: mouse embryonic stem cellcell line. (ESC) | mjLiverKO1() Liver Data. (Zcchc11 liver) | SRR390297(GSM849855) cell line: NIH-3T3cell type: fibroblastip ant. (fibroblast) | mjTestesWT1() Testes Data. (testes) | SRR402761(SRX117944) source: ES E14 male cells. (ESC) | SRR345203(SRX097264) source: size fractionated RNA from mouse hipp. (brain) | SRR279903(GSM689053) cell type: mouse embryonic stem cellcell line. (ESC) | SRR546155(SRX180174) Global profiling of miRNA and the hairpin pre. (ago2 Neuroblastoma) | SRR059769(GSM562831) Treg_Drosha. (spleen) | SRR029042(GSM433294) 18.5dpc_hetero_tdrd1-KO. (tdrd1 testes) | SRR042458(GSM539850) mouse basophil cells [09-002]. (b cell) | mjTestesWT4() Testes Data. (testes) | SRR391848(GSM852143) gender: femalegenotype/variation: wild typeti. (embryo) | SRR391847(GSM852142) gender: femalegenotype/variation: ADAR2-/-/AD. (embryo) | SRR029043(GSM433295) 18.5dpc_homo_tdrd1-KO. (tdrd1 testes) | SRR248526(GSM733814) cell type: Thy1- spermatogonial stem cellstra. (testes) | SRR306535(GSM750578) 19-24nt. (ago2 brain) | SRR042468(GSM539860) mouse Th1 cells [09-002]. (lymph) | SRR073955(GSM629281) total RNA. (blood) | SRR038742(GSM527277) small RNA-Seq. (dgcr8 brain) | SRR037914(GSM510451) newborn_rep7. (total RNA) | SRR346424(SRX098266) Global profiling of miRNA and the hairpin pre. (Neuroblastoma) | SRR685339(GSM1079783) Small RNAs (15-50 nts in length) from immorta. (cell line) | SRR042470(GSM539862) mouse Th17 cells [09-002]. (lymph) | SRR014232(GSM319956) 16.5 dpc MILI. (mili testes) | mjTestesWT3() Testes Data. (testes) | SRR306534(GSM750577) 19-24nt. (ago2 brain) | GSM509280(GSM509280) small RNA cloning by length. (testes) | mjTestesKO6() Testes Data. (Zcchc11 testes) | SRR042461(GSM539853) mouse dendritic cells [09-002]. (bone marrow) | SRR402762(SRX117945) source: ES E14 male cells. (ESC) | GSM640579(GSM640579) small RNA in the liver with paternal Low pro. (liver) | SRR306544(GSM750587) 19-24nt. (ago2 brain) | SRR042463(GSM539855) mouse natural killer cells [09-002]. (spleen) | SRR014231(GSM319955) 16.5 dpc total. (testes) | SRR042455(GSM539847) mouse plasma cells [09-002]. (blood) | SRR069809(GSM610965) small RNA sequencing; sample 1. (testes) | SRR553602(SRX182808) source: Sertoli cells. (Sertoli cells) | SRR042472(GSM539864) mouse iTreg cells [09-002]. (lymph) | SRR029038(GSM433290) 25dpp_hetero_tdrd6-KO. (tdrd6 testes) | Ago1IP517(Rui) Quantitative functions of Argonaute proteins . (ago1 skin) | SRR042454(GSM539846) mouse germinal center B cells (lymph node) [09-002]. (b cell) | SRR037910(GSM510447) newborn_rep3. (total RNA) | SRR345202(SRX097263) source: size fractionated RNA from mouse hipp. (brain) | SRR402766(SRX117949) source: ES PGK female cells. (ESC) | Ago3IP805(Rui) Quantitative functions of Argonaute proteins . (ago3 skin) | SRR248523(GSM733811) cell type: Thy1+ spermatogonial stem cellstra. (testes) | GSM475281(GSM475281) total RNA. (testes) | SRR248525(GSM733813) cell type: Thy1- spermatogonial stem cellstra. (testes) | SRR042469(GSM539861) mouse Th2 cells [09-002]. (lymph) | SRR042456(GSM539848) mouse hematopoetic progenitor cells [09-002]. (bone marrow) | GSM510456(GSM510456) newborn_rep12. (total RNA) | SRR394084(GSM855970) background strain: C57BL6/SV129cell type: KRa. (dicer cell line) | SRR391851(GSM852146) gender: femalegenotype/variation: wild typeti. (embryo) | SRR029123(GSM416611) NIH3T3. (cell line) | SRR040489(GSM533912) E18.5 Ago2 catalytically inactive LIVER small RNA. (ago2 liver) | SRR206942(GSM723283) other. (brain) | SRR391849(GSM852144) gender: femalegenotype/variation: ADAR2-/-tis. (embryo) | SRR279906(GSM689056) cell type: mouse embryonic stem cellcell line. (ESC) | SRR039152(GSM471929) HL1_siNon_smallRNAseq. (muscle) | GSM509275(GSM509275) MitoPLD+/+ E16.5 small RNA. (testes) | mjTestesKO8() Testes Data. (Zcchc11 testes) | SRR095855BC1(SRX039178) sequencing of miRNA from wild type and diseas. (heart) | SRR345201(SRX097262) source: size fractionated RNA from mouse hipp. (brain) | GSM510455(GSM510455) newborn_rep11. (total RNA) | SRR346417(SRX098258) Global profiling of miRNA and the hairpin pre. (Brain) | SRR346425(SRX098267) Global profiling of miRNA and the hairpin pre. (Neuroblastoma) | SRR042488(GSM539880) mouse BclXL germinal center B cells [BalbC] [09-002]. (B cell) | SRR279905(GSM689055) cell type: mouse embryonic stem cellcell line. (ESC) | SRR206939(GSM723280) other. (brain) | SRR553582(SRX182788) source: Brain. (Brain) | SRR345205(SRX097266) source: size fractionated RNA from mouse hipp. (brain) | SRR042450(GSM539842) mouse B cells activated in vitro with LPS/IL4 replicate 3 [09-002]. (b cell) | mjLiverKO3() Liver Data. (Zcchc11 liver) | SRR345198(SRX097259) source: size fractionated RNA from mouse hipp. (brain) | SRR346416(SRX098257) Global profiling of miRNA and the hairpin pre. (Kidney) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| .............................................................................................................................................................................................................TGCCCAAGCCCCACCTTAA.......................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | |
| ......................................ATCTGTGTTTCTGTTCCAACAG.............................................................................................................................................................................................. | 22 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ......................................ATCTGTGTTTCTGTTCCAGCCT.............................................................................................................................................................................................. | 22 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...................ACGTGCCCAGGCCTCTCGGT................................................................................................................................................................................................................... | 20 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .........................................................................................................................................................................................................ACACTGCCCAAGCCCCAG............................... | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ............................................................................................................CTGAGCCACACATTTAACC........................................................................................................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |