| (1) AGO.mut | (1) AGO1.ip | (4) AGO2.ip | (1) AGO3.ip | (3) B-CELL | (8) BRAIN | (2) CELL-LINE | (1) DGCR8.mut | (6) EMBRYO | (9) ESC | (6) FIBROBLAST | (2) HEART | (1) KIDNEY | (5) LIVER | (1) LYMPH | (11) OTHER | (2) OTHER.mut | (1) PIWI.mut | (3) SKIN | (1) SPLEEN | (7) TESTES | (1) THYMUS | (8) TOTAL-RNA |
| TCCATTTACGCGGGAGGCATCAAGTCCATTTTTGACCCTCCCGTGTTTCCGTGAGTAACTAGGGCATTTGTTCCAGCCATTGCCCTGGCATCCTTTCTAAGCCTTTGGTGTTCTGTGTCCCTCTGATTGCTTGGGTGGGAAGAGGCTAGGGCTCCAGTCCAGCAGGTAACTAGGCCTTCTCCTCTCCCTGCAGGGTGTGTATGCTGGGCAATAGGACCCTGTCTCGGGACCAGTTTGACATCT ......................................................................................................................................(((((.(((((..((((((..(((((....))..))).))))))..))))).))))).................................................... ..................................................................................................................................131...........................................................193................................................ | Size | Perfect hit | Total Norm | Perfect Norm | mjTestesWT1() Testes Data. (testes) | SRR390300(GSM849858) cell line: NIH-3T3cell type: fibroblastinfect. (ago2 fibroblast) | GSM314557(GSM314557) ESC dgcr8 (Illumina). (ESC) | SRR546155(SRX180174) Global profiling of miRNA and the hairpin pre. (ago2 Neuroblastoma) | mjTestesWT3() Testes Data. (testes) | SRR390297(GSM849855) cell line: NIH-3T3cell type: fibroblastip ant. (fibroblast) | SRR391848(GSM852143) gender: femalegenotype/variation: wild typeti. (embryo) | SRR390299(GSM849857) cell line: NIH-3T3cell type: fibroblastip ant. (ago2 fibroblast) | GSM510444(GSM510444) brain_rep5. (brain) | SRR279904(GSM689054) cell type: mouse embryonic stem cellcell line. (ESC) | SRR073954(GSM629280) total RNA. (blood) | SRR279906(GSM689056) cell type: mouse embryonic stem cellcell line. (ESC) | SRR553583(SRX182789) source: Cerebellum. (Cerebellum) | SRR039154(GSM471931) HL1_siSrf2_smallRNAseq. (muscle) | mjLiverKO3() Liver Data. (Zcchc11 liver) | GSM510453(GSM510453) newborn_rep9. (total RNA) | SRR042474(GSM539866) mouse embryonic stem cells [09-002]. (ESC) | SRR037912(GSM510449) newborn_rep5. (total RNA) | SRR042459(GSM539851) mouse neutrophil cells replicate 1 [09-002]. (blood) | SRR279907(GSM689057) cell type: mouse embryonic stem cellcell line. (ESC) | SRR279903(GSM689053) cell type: mouse embryonic stem cellcell line. (ESC) | SRR553602(SRX182808) source: Sertoli cells. (Sertoli cells) | SRR042471(GSM539863) mouse TFHS cells [09-002]. (spleen) | SRR042458(GSM539850) mouse basophil cells [09-002]. (b cell) | SRR042469(GSM539861) mouse Th2 cells [09-002]. (lymph) | SRR345204(SRX097265) source: size fractionated RNA from mouse hipp. (brain) | SRR346422(SRX098264) Global profiling of miRNA and the hairpin pre. (Muscle) | SRR039152(GSM471929) HL1_siNon_smallRNAseq. (muscle) | SRR023852(GSM307161) ZHBT-c424hsmallrna_rep1. (cell line) | SRR391849(GSM852144) gender: femalegenotype/variation: ADAR2-/-tis. (embryo) | Ago1IP812(Rui) Quantitative functions of Argonaute proteins . (ago1 skin) | SRR553584(SRX182790) source: Heart. (Heart) | SRR391850(GSM852145) gender: femalegenotype/variation: ADAR2-/-/AD. (embryo) | GSM510450(GSM510450) newborn_rep6. (total RNA) | mjTestesKO6() Testes Data. (Zcchc11 testes) | SRR039153(GSM471930) HL1_siSrf1_smallRNAseq. (muscle) | SRR391846(GSM852141) gender: femalegenotype/variation: ADAR2-/-tis. (embryo) | SRR095855BC6(SRX039178) sequencing of miRNA from wild type and diseas. (heart) | SRR042475(GSM539867) mouse embryonic fibroblast cells [09-002]. (fibroblast) | Ago2IP504(Rui) Quantitative functions of Argonaute proteins . (ago2 skin) | GSM640577(GSM640577) small RNA in the liver with paternal control . (liver) | GSM640579(GSM640579) small RNA in the liver with paternal Low pro. (liver) | mjTestesWT2() Testes Data. (testes) | SRR402761(SRX117944) source: ES E14 male cells. (ESC) | SRR346423(SRX098265) Global profiling of miRNA and the hairpin pre. (Brain) | GSM510456(GSM510456) newborn_rep12. (total RNA) | SRR685339(GSM1079783) Small RNAs (15-50 nts in length) from immorta. (cell line) | SRR037914(GSM510451) newborn_rep7. (total RNA) | SRR038742(GSM527277) small RNA-Seq. (dgcr8 brain) | SRR345196(SRX097257) source: size fractionated RNA from mouse hipp. (brain) | GSM475281(GSM475281) total RNA. (testes) | SRR346416(SRX098257) Global profiling of miRNA and the hairpin pre. (Kidney) | SRR042447(GSM539839) mouse mature B cells (spleen) replicate 2 [09-002]. (b cell) | Ago3IP805(Rui) Quantitative functions of Argonaute proteins . (ago3 skin) | SRR345198(SRX097259) source: size fractionated RNA from mouse hipp. (brain) | SRR040488(GSM533911) E18.5 wild type LIVER small RNA. (liver) | SRR073955(GSM629281) total RNA. (blood) | GSM510452(GSM510452) newborn_rep8. (total RNA) | SRR040489(GSM533912) E18.5 Ago2 catalytically inactive LIVER small RNA. (ago2 liver) | SRR059766(GSM562828) DN3_Drosha. (thymus) | SRR037909(GSM510446) newborn_rep2. (total RNA) | SRR116846(GSM678422) Small RNA deep sequencing from mouse epididym. (epididymis) | SRR391851(GSM852146) gender: femalegenotype/variation: wild typeti. (embryo) | SRR014230(GSM319954) 10 dpp Dnmt3L-KO MILI. (mili testes) | SRR279905(GSM689055) cell type: mouse embryonic stem cellcell line. (ESC) | SRR553582(SRX182788) source: Brain. (Brain) | SRR039186(GSM485326) shLuc.1309;ROSA-rtTA (+dox). (fibroblast) | GSM314552(GSM314552) ESC wild type (Illumina). (ESC) | SRR042488(GSM539880) mouse BclXL germinal center B cells [BalbC] [09-002]. (B cell) | SRR346417(SRX098258) Global profiling of miRNA and the hairpin pre. (Brain) | SRR037920(GSM510458) e12p5_rep2. (embryo) | GSM510455(GSM510455) newborn_rep11. (total RNA) | SRR039185(GSM485325) shLuc.1309;ROSA-rtTA (-dox). (fibroblast) | SRR248527(GSM733815) cell type: spermatogonial stem cell enriched . (testes) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ..........................................................................................................................................................................TAGGCCTTCTCCTCTCCCTGCAG.................................................. | 23 | 1 | 51.00 | 51.00 | 10.00 | 2.00 | 4.00 | 1.00 | 3.00 | - | 2.00 | 2.00 | 1.00 | - | 2.00 | - | 3.00 | - | 1.00 | - | 1.00 | 2.00 | 1.00 | - | - | 2.00 | - | - | 1.00 | - | 2.00 | - | - | - | - | 2.00 | - | 2.00 | - | - | - | - | - | - | - | - | - | 1.00 | - | 1.00 | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | 1.00 | - | 1.00 | 1.00 | - | - | - |
| ..........................................................................................................................................................................TAGGCCTTCTCCTCTCCCTGCAGT................................................. | 24 | 1 | 31.00 | 51.00 | - | 6.00 | 3.00 | 2.00 | 4.00 | - | - | 1.00 | - | - | - | - | - | - | 2.00 | 3.00 | - | - | - | - | 1.00 | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | 1.00 | - | 1.00 | - | 1.00 | - | - | 1.00 | - | 1.00 | - | - | - | 1.00 | - | - | - | - | - | - | - |
| ..........................................................................................................................................................................TAGGCCTTCTCCTCTCCCTGCAGA................................................. | 24 | 1 | 8.00 | 51.00 | - | - | - | - | - | 5.00 | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..........................................................................................................................................................................TAGGCCTTCTCCTCTCCCTGCA................................................... | 22 | 1 | 6.00 | 6.00 | - | - | - | - | - | - | 1.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .......................................................................................................................................TGGGAAGAGGCTAGGGCTCCAGT..................................................................................... | 23 | 1 | 5.00 | 5.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | 1.00 | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..........................................................................................................................................................................TAGGCCTTCTCCTCTCCCTGCAA.................................................. | 23 | 1 | 4.00 | 6.00 | - | - | - | 1.00 | - | - | - | - | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - |
| ..........................................................................................................................................................................TAGGCCTTCTCCTCTCCCTGCAT.................................................. | 23 | 1 | 3.00 | 6.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - |
| .......................................................................................................................................................................................................TATGCTGGGCAATAGGACCC........................ | 20 | 1 | 3.00 | 3.00 | - | - | - | - | - | - | - | - | - | - | - | 3.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ....................................................................................................................................................................................................................AGGACCCTGTCTCGGGACCAGT......... | 22 | 1 | 3.00 | 3.00 | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .....................................................................................................................................GGTGGGAAGAGGCTAGGGCTCCAGT..................................................................................... | 25 | 1 | 2.00 | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..........................................................................................................................................................................TAGGCCTTCTCCTCTCCCTGCAGTA................................................ | 25 | 1 | 2.00 | 51.00 | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..........................................................................................................................................................................TAGGCCTTCTCCTCTCCCTGCAGTAG............................................... | 26 | 1 | 2.00 | 51.00 | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ............................................................................................................................................................................GGCCTTCTCCTCTCCCTGCAGA................................................. | 22 | 2.00 | 0.00 | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..........................................................................................................................................................................TAGGCCTTCTCCTCTCCCTGCAGAAA............................................... | 26 | 1 | 2.00 | 51.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..................................................................................................................................TTGGGTGGGAAGAGGCTAGGGCT.......................................................................................... | 23 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..........................................................................................................................................................................TAGGCCTTCTCCTCTCCCTGT.................................................... | 21 | 1 | 1.00 | 1.00 | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .....................................................................................................................................GGTGGGAAGAGGCTAGGGCTCA........................................................................................ | 22 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ............................................................................................................................................................GTCCAGCAGGTAACTGAGA.................................................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...................................................................................................................................TGGGTGGGAAGAGGCTAGGGCTAA........................................................................................ | 24 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | |
| ..........................................................................................................................................................................TAGGCCTTCTCCTCTCCCTTCAT.................................................. | 23 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...............................................................................................................................TGCTTGGGTGGGAAGAGGCTAGT............................................................................................. | 23 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...............................................................................................................................................................................CTTCTCCTCTCCCTGCAG.................................................. | 18 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..........................................................................................................................................................................TAGGCCTTCTCCTCTCCCTTTT................................................... | 22 | 1.00 | 0.00 | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .......ACGCGGGAGGCATCAAGTCC........................................................................................................................................................................................................................ | 20 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .....................................................................................................................................GGTGGGAAGAGGCTAGGGCTCCAGTA.................................................................................... | 26 | 1 | 1.00 | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...........................................................................................................................................................................AGGCCTTCTCCTCTCCCTGCA................................................... | 21 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - |
| ..........................................................................................................................................................................TAGGCCTTCTCCTCTCCCTGCAGCTT............................................... | 26 | 1 | 1.00 | 51.00 | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..........................................................................................................................................................................TAGGCCTTCTCCTCTCCCTG..................................................... | 20 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..........................................................................................................................................................................TAGGCCTTCTCCTCTCCCTGCAGTTT............................................... | 26 | 1 | 1.00 | 51.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..........................................................................................................................................................................TAGGCCTTCTCCTCTCCCTGCAGAC................................................ | 25 | 1 | 1.00 | 51.00 | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ....................................................................................................................................................................................................................AGGACCCTGTCTCGGGACCAGTT........ | 23 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ............................................................................................................................................AGAGGCTAGGGCTCCGGT..................................................................................... | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..................................................................................................................................TTGGGTGGGAAGAGGCTAGGGCA.......................................................................................... | 23 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..........................................................................................................................................................................TAGGCCTTCTCCTCTCCCTGCC................................................... | 22 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ............................................................................................................................................................................................TGCAGGGTGTGTATGGTTT.................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..........................................................................................................................................................................TAGGCCTTCTCCTCTCCCTGCCGT................................................. | 24 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...........................................................................................................................................................................AGGCCTTCTCCTCTCCCTGCACT................................................. | 23 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..........................................................................................................................................................................TAGGCCTTCTCCTCTCCCTGG.................................................... | 21 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..........................................................................................................................................................................TAGGCCTTCTCCTCTCCCTGCAGTTTT.............................................. | 27 | 1 | 1.00 | 51.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..........................................................................................................................................................................TAGGCCTTCTCCTCTCCCTGA.................................................... | 21 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ............................................................................................................................................AGAGGCTAGGGCTCCTTGA.................................................................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..........................................................................................................................................................................TAGGCCTTCTCCTCTCCCTGCAGAA................................................ | 25 | 1 | 1.00 | 51.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..........................................................................................................................................................................TAGGCCTTCTCCTCTCCCTGC.................................................... | 21 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - |
| ................................TGACCCTCCCGTGTTTCC................................................................................................................................................................................................. | 18 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - |
| TCCATTTACGCGGGAGGCATCAAGTCCATTTTTGACCCTCCCGTGTTTCCGTGAGTAACTAGGGCATTTGTTCCAGCCATTGCCCTGGCATCCTTTCTAAGCCTTTGGTGTTCTGTGTCCCTCTGATTGCTTGGGTGGGAAGAGGCTAGGGCTCCAGTCCAGCAGGTAACTAGGCCTTCTCCTCTCCCTGCAGGGTGTGTATGCTGGGCAATAGGACCCTGTCTCGGGACCAGTTTGACATCT ......................................................................................................................................(((((.(((((..((((((..(((((....))..))).))))))..))))).))))).................................................... ..................................................................................................................................131...........................................................193................................................ | Size | Perfect hit | Total Norm | Perfect Norm | mjTestesWT1() Testes Data. (testes) | SRR390300(GSM849858) cell line: NIH-3T3cell type: fibroblastinfect. (ago2 fibroblast) | GSM314557(GSM314557) ESC dgcr8 (Illumina). (ESC) | SRR546155(SRX180174) Global profiling of miRNA and the hairpin pre. (ago2 Neuroblastoma) | mjTestesWT3() Testes Data. (testes) | SRR390297(GSM849855) cell line: NIH-3T3cell type: fibroblastip ant. (fibroblast) | SRR391848(GSM852143) gender: femalegenotype/variation: wild typeti. (embryo) | SRR390299(GSM849857) cell line: NIH-3T3cell type: fibroblastip ant. (ago2 fibroblast) | GSM510444(GSM510444) brain_rep5. (brain) | SRR279904(GSM689054) cell type: mouse embryonic stem cellcell line. (ESC) | SRR073954(GSM629280) total RNA. (blood) | SRR279906(GSM689056) cell type: mouse embryonic stem cellcell line. (ESC) | SRR553583(SRX182789) source: Cerebellum. (Cerebellum) | SRR039154(GSM471931) HL1_siSrf2_smallRNAseq. (muscle) | mjLiverKO3() Liver Data. (Zcchc11 liver) | GSM510453(GSM510453) newborn_rep9. (total RNA) | SRR042474(GSM539866) mouse embryonic stem cells [09-002]. (ESC) | SRR037912(GSM510449) newborn_rep5. (total RNA) | SRR042459(GSM539851) mouse neutrophil cells replicate 1 [09-002]. (blood) | SRR279907(GSM689057) cell type: mouse embryonic stem cellcell line. (ESC) | SRR279903(GSM689053) cell type: mouse embryonic stem cellcell line. (ESC) | SRR553602(SRX182808) source: Sertoli cells. (Sertoli cells) | SRR042471(GSM539863) mouse TFHS cells [09-002]. (spleen) | SRR042458(GSM539850) mouse basophil cells [09-002]. (b cell) | SRR042469(GSM539861) mouse Th2 cells [09-002]. (lymph) | SRR345204(SRX097265) source: size fractionated RNA from mouse hipp. (brain) | SRR346422(SRX098264) Global profiling of miRNA and the hairpin pre. (Muscle) | SRR039152(GSM471929) HL1_siNon_smallRNAseq. (muscle) | SRR023852(GSM307161) ZHBT-c424hsmallrna_rep1. (cell line) | SRR391849(GSM852144) gender: femalegenotype/variation: ADAR2-/-tis. (embryo) | Ago1IP812(Rui) Quantitative functions of Argonaute proteins . (ago1 skin) | SRR553584(SRX182790) source: Heart. (Heart) | SRR391850(GSM852145) gender: femalegenotype/variation: ADAR2-/-/AD. (embryo) | GSM510450(GSM510450) newborn_rep6. (total RNA) | mjTestesKO6() Testes Data. (Zcchc11 testes) | SRR039153(GSM471930) HL1_siSrf1_smallRNAseq. (muscle) | SRR391846(GSM852141) gender: femalegenotype/variation: ADAR2-/-tis. (embryo) | SRR095855BC6(SRX039178) sequencing of miRNA from wild type and diseas. (heart) | SRR042475(GSM539867) mouse embryonic fibroblast cells [09-002]. (fibroblast) | Ago2IP504(Rui) Quantitative functions of Argonaute proteins . (ago2 skin) | GSM640577(GSM640577) small RNA in the liver with paternal control . (liver) | GSM640579(GSM640579) small RNA in the liver with paternal Low pro. (liver) | mjTestesWT2() Testes Data. (testes) | SRR402761(SRX117944) source: ES E14 male cells. (ESC) | SRR346423(SRX098265) Global profiling of miRNA and the hairpin pre. (Brain) | GSM510456(GSM510456) newborn_rep12. (total RNA) | SRR685339(GSM1079783) Small RNAs (15-50 nts in length) from immorta. (cell line) | SRR037914(GSM510451) newborn_rep7. (total RNA) | SRR038742(GSM527277) small RNA-Seq. (dgcr8 brain) | SRR345196(SRX097257) source: size fractionated RNA from mouse hipp. (brain) | GSM475281(GSM475281) total RNA. (testes) | SRR346416(SRX098257) Global profiling of miRNA and the hairpin pre. (Kidney) | SRR042447(GSM539839) mouse mature B cells (spleen) replicate 2 [09-002]. (b cell) | Ago3IP805(Rui) Quantitative functions of Argonaute proteins . (ago3 skin) | SRR345198(SRX097259) source: size fractionated RNA from mouse hipp. (brain) | SRR040488(GSM533911) E18.5 wild type LIVER small RNA. (liver) | SRR073955(GSM629281) total RNA. (blood) | GSM510452(GSM510452) newborn_rep8. (total RNA) | SRR040489(GSM533912) E18.5 Ago2 catalytically inactive LIVER small RNA. (ago2 liver) | SRR059766(GSM562828) DN3_Drosha. (thymus) | SRR037909(GSM510446) newborn_rep2. (total RNA) | SRR116846(GSM678422) Small RNA deep sequencing from mouse epididym. (epididymis) | SRR391851(GSM852146) gender: femalegenotype/variation: wild typeti. (embryo) | SRR014230(GSM319954) 10 dpp Dnmt3L-KO MILI. (mili testes) | SRR279905(GSM689055) cell type: mouse embryonic stem cellcell line. (ESC) | SRR553582(SRX182788) source: Brain. (Brain) | SRR039186(GSM485326) shLuc.1309;ROSA-rtTA (+dox). (fibroblast) | GSM314552(GSM314552) ESC wild type (Illumina). (ESC) | SRR042488(GSM539880) mouse BclXL germinal center B cells [BalbC] [09-002]. (B cell) | SRR346417(SRX098258) Global profiling of miRNA and the hairpin pre. (Brain) | SRR037920(GSM510458) e12p5_rep2. (embryo) | GSM510455(GSM510455) newborn_rep11. (total RNA) | SRR039185(GSM485325) shLuc.1309;ROSA-rtTA (-dox). (fibroblast) | SRR248527(GSM733815) cell type: spermatogonial stem cell enriched . (testes) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| .........................................................................................ATCCTTTCTAAGCCTCAC........................................................................................................................................ | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ............................................................................................................TGTTCTGTGTCCCTCTGGGCA.................................................................................................................. | 21 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ................GCATCAAGTCCATTTT................................................................................................................................................................................................................... | 16 | 3 | 0.33 | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.33 |