ID: mmu-mir-6983
GENE: Csf1r(8)
chr18:61277017-61277235+


(1)
AGO.mut 		(2)
AGO1.ip 		(5)
AGO2.ip 		(2)
AGO3.ip 		(2)
B-CELL 		(17)
BRAIN 		(2)
CELL-LINE 		(2)
DCR.mut 		(1)
DGCR8.mut 		(4)
EMBRYO 		(1)
ESC 		(4)
HEART 		(1)
KIDNEY 		(11)
LIVER 		(2)
LUNG 		(12)
OTHER 		(3)
OTHER.mut 		(1)
PANCREAS 		(1)
PIWI.mut 		(6)
SKIN 		(3)
SPLEEN 		(8)
TESTES 		(1)
TOTAL-RNA 		(1)
UTERUS

Sense strand
TACCCTCAGCCCAGCGTGACATGGATGGAGTGCAGGGGCCACACCGATAGGTCAGTGGGCTTGGTTTTCCTCCTTAGGGTGAGTCTAAGTCTGGGTTGCGTACCCATGACTTGGAAGGGCATACTGATTCGGGAGACCCTAAAGCCTGAATCAAAGTCTGTTGTTCCAGGTGTGATGAAGCCCAGGCTTTGCAGGTTTGGAATGACACCCACCCTGAAG
...............................................................................................................(((((.((((.(((((((((((...........)))))))))..)).)))).)))))...................................................
.........................................................................................................106............................................................169................................................
SizePerfect hitTotal NormPerfect NormmjLiverWT2()
Liver Data. (liver)		mjLiverKO1()
Liver Data. (Zcchc11 liver)		SRR346414(SRX098255)
Global profiling of miRNA and the hairpin pre. (Spleen)		SRR042456(GSM539848)
mouse hematopoetic progenitor cells [09-002]. (bone marrow)		SRR206942(GSM723283)
other. (brain)		SRR038744(GSM527279)
small RNA-Seq. (brain)		SRR206941(GSM723282)
other. (brain)		SRR346418(SRX098259)
Global profiling of miRNA and the hairpin pre. (Liver)		mjTestesWT1()
Testes Data. (testes)		GSM510444(GSM510444)
brain_rep5. (brain)		SRR206940(GSM723281)
other. (brain)		SRR248523(GSM733811)
cell type: Thy1+ spermatogonial stem cellstra. (testes)		Ago2IP504(Rui)
Quantitative functions of Argonaute proteins . (ago2 skin)		SRR553602(SRX182808)
source: Sertoli cells. (Sertoli cells)		SRR346423(SRX098265)
Global profiling of miRNA and the hairpin pre. (Brain)		SRR038742(GSM527277)
small RNA-Seq. (dgcr8 brain)		SRR038743(GSM527278)
small RNA-Seq. (dicer brain)		SRR042462(GSM539854)
mouse macrophages [09-002]. (bone marrow)		Ago1IP517(Rui)
Quantitative functions of Argonaute proteins . (ago1 skin)		SRR248524(GSM733812)
cell type: Thy1+ spermatogonial stem cellstra. (testes)		SRR073954(GSM629280)
total RNA. (blood)		SRR095855BC7(SRX039178)
sequencing of miRNA from wild type and diseas. (heart)		Ago3IP805(Rui)
Quantitative functions of Argonaute proteins . (ago3 skin)		SRR073955(GSM629281)
total RNA. (blood)		SRR042443(GSM539835)
mouse pro B cells [09-002]. (b cell)		SRR040489(GSM533912)
E18.5 Ago2 catalytically inactive LIVER small RNA. (ago2 liver)		SRR346419(SRX098260)
Global profiling of miRNA and the hairpin pre. (Lung)		SRR039610(GSM527274)
small RNA-Seq. (brain)		Ago2IP517(Rui)
Quantitative functions of Argonaute proteins . (ago2 skin)		SRR553582(SRX182788)
source: Brain. (Brain)		SRR095855BC2(SRX039178)
sequencing of miRNA from wild type and diseas. (heart)		SRR042461(GSM539853)
mouse dendritic cells [09-002]. (bone marrow)		Ago3IP812(Rui)
Quantitative functions of Argonaute proteins . (ago3 skin)		SRR346417(SRX098258)
Global profiling of miRNA and the hairpin pre. (Brain)		SRR306539(GSM750582)
19-24nt. (ago2 brain)		SRR345200(SRX097261)
source: size fractionated RNA from mouse hipp. (brain)		SRR042460(GSM539852)
mouse neutrophil cells replicate 2 [09-002]. (blood)		mjTestesKO7()
Testes Data. (Zcchc11 testes)		SRR391846(GSM852141)
gender: femalegenotype/variation: ADAR2-/-tis. (embryo)		SRR553585(SRX182791)
source: Kidney. (Kidney)		SRR042459(GSM539851)
mouse neutrophil cells replicate 1 [09-002]. (blood)		SRR391845(GSM852140)
gender: femalegenotype/variation: wild typeti. (embryo)		SRR065047(SRR065047)
Tissue-specific Regulation of Mouse MicroRNA . (liver)		GSM519104(GSM519104)
mouse_granulocyte_nuclei_smallRNAs. (cell line)		SRR037921(GSM510459)
e12p5_rep3. (embryo)		SRR042471(GSM539863)
mouse TFHS cells [09-002]. (spleen)		GSM640579(GSM640579)
small RNA in the liver with paternal Low pro. (liver)		GSM510456(GSM510456)
newborn_rep12. (total RNA)		SRR077864(GSM637801)
18-30 nt small RNAs. (liver)		SRR037929(GSM510467)
e7p5_rep3. (embryo)		SRR038740(GSM527275)
small RNA-Seq. (dicer brain)		SRR042447(GSM539839)
mouse mature B cells (spleen) replicate 2 [09-002]. (b cell)		SRR040488(GSM533911)
E18.5 wild type LIVER small RNA. (liver)		SRR065058(SRR065058)
Tissue-specific Regulation of Mouse MicroRNA . (pancreas)		SRR525243(SRA056111/SRX170319)
Mus musculus domesticus miRNA sequencing. (ago2 Blood)		SRR042478(GSM539870)
mouse lung tissue [09-002]. (lung)		SRR042479(GSM539871)
mouse liver tissue [09-002]. (liver)		SRR306538(GSM750581)
19-24nt. (ago2 brain)		SRR039152(GSM471929)
HL1_siNon_smallRNAseq. (muscle)		SRR023852(GSM307161)
ZHBT-c424hsmallrna_rep1. (cell line)		SRR345207(SRX097268)
source: size fractionated RNA from mouse hipp. (brain)		SRR032477(GSM485235)
sRNA_activation_deep_sequencing. (uterus)		SRR014230(GSM319954)
10 dpp Dnmt3L-KO MILI. (mili testes)		Ago1IP812(Rui)
Quantitative functions of Argonaute proteins . (ago1 skin)		SRR553584(SRX182790)
source: Heart. (Heart)		SRR039154(GSM471931)
HL1_siSrf2_smallRNAseq. (muscle)		SRR346415(SRX098256)
source: Testis. (Testes)		SRR095853(SRX039174)
sequencing of miRNA from wild type and diseas. (heart)		mjLiverWT3()
Liver Data. (liver)		SRR059770(GSM562832)
Treg_Dicer. (spleen)		SRR042484(GSM539876)
mouse salivary gland tissue [09-002]. (salivary gland)		GSM509280(GSM509280)
small RNA cloning by length. (testes)		SRR037905(GSM510441)
brain_rep2. (brain)		SRR042474(GSM539866)
mouse embryonic stem cells [09-002]. (ESC)		SRR077866(GSM637803)
18-30 nt small RNAs. (liver)		mjTestesKO6()
Testes Data. (Zcchc11 testes)
..................................................................................................................................................TGAATCAAAGTCTGTTGTTCCAG..................................................23185.0085.0030.0013.004.00-5.002.003.004.00--5.002.00-3.001.001.001.00--1.00-----1.002.00--1.001.00--------1.00---1.00----1.00-1.00---1.00---------------------
..................................................................................................................................................TGAATCAAAGTCTGTTGTTCCAGT.................................................24120.0085.00-------1.00-2.00-1.002.00------1.001.001.001.00----1.00-1.00---1.00----------1.00-1.001.00----1.00------1.00----1.00-1.00---------
..............................................................................................................TTGGAAGGGCATACTGATTCGG.......................................................................................22115.0015.00---1.00--1.001.00-1.00-------1.002.00-----2.00------1.001.00--------1.001.00----------------------------1.00-1.00--
..............................................................................................................TTGGAAGGGCATACTGATTCGGG......................................................................................23114.0014.00---3.00-------1.001.00----1.00----1.00-----2.00---1.00-----1.00------1.00---------------1.00--------1.00-----
..................................................................................................................................................TGAATCAAAGTCTGTTGTTC.....................................................2018.008.00--1.00--1.00--------2.001.00------------------1.00----------------------------------1.00--1.00---
..................................................................................................................................................TGAATCAAAGTCTGTTGTTCC....................................................2117.007.00--2.00-1.001.001.00--------1.001.00-----------------------------------------------------------
................TGACATGGATGGAGTGCAGGGGCCAC.................................................................................................................................................................................2615.005.00--------5.00-------------------------------------------------------------------
..................................................................................................................................................TGAATCAAAGTCTGTTGTTCCA...................................................2215.005.00----1.00----1.00------1.00----1.00--------1.00---------------------------------------------
..............................................................................................................TTGGAAGGGCATACTGATTCG........................................................................................2112.002.00-----------------1.00-------------------------------------1.00--------------------
..................................................................................................................................................TGAATCAAAGTCTGTTGTT......................................................1922.002.00----------------------------------0.50----------------------1.00----------------0.50-
...................................................................................................................................................GAATCAAAGTCTGTTGTTCCAGT.................................................232.000.00-----1.00---1.00------------------------------------------------------------------
..................................................................................................................................................TGAATCAAAGTCTGTTGTTCCCG..................................................2312.007.00--1.00------------------------1.00------------------------------------------------
..................................................................................................................................................TGAATCAAAGTCTGTTGTTCCAGA.................................................2412.0085.00------1.00-------------------------------------------------------------1.00-------
..............................................................................................................TTGGAAGGGCATACTGATTCTGG......................................................................................2312.001.00---1.00----------------------------------------------------1.00-------------------
............................................................................................................ACTTGGAAGGGCATACTGATTCG........................................................................................2311.001.00------------------------------------------------------------1.00---------------
..............................................................................................................TTGGAAGGGCATACTGATTC.........................................................................................2011.001.00------------------------------------1.00---------------------------------------
..............................................................................................................TTGGAAGGGCATACTGATTCGGGAT....................................................................................2511.001.00---1.00------------------------------------------------------------------------
...............................................................................................................TGGAAGGGCATACTGATTCGG.......................................................................................2111.001.00---------------------------------1.00------------------------------------------
..............................................................................................................TTGGAAGGGCATACTGATTCGGGT.....................................................................................2411.0014.00--------------------------------------------------------------1.00-------------
..............................................................................................................TTGGAAGGGCATACTGATTCGGGA.....................................................................................2411.001.00---1.00------------------------------------------------------------------------
..................................................................................................................................................TGAATCAAAGTCTGTTGTTCCAGAA................................................2511.0085.00-------------------------------------------------1.00--------------------------
...............................................................................................................TGGAAGGGCATACTGATTCGGG......................................................................................2211.001.00---------------------------------------------------1.00------------------------
.................................................................................................................................................CTGAATCAAAGTCTGTTGTTCCAG..................................................2411.001.00-----1.00----------------------------------------------------------------------
.......................GATGGAGTGCAGGGGCCACAC...............................................................................................................................................................................2111.001.00-------------------------1.00--------------------------------------------------
.................................................................................................................................................CTGAATCAAAGTCTGTTGTTC.....................................................2111.001.00-------------------------------------------------------------------1.00--------
...................................................................................TCTAAGTCTGGGTTGCG.......................................................................................................................1711.001.00-------------------------------------1.00--------------------------------------
.............................................................................................................CTTGGAAGGGCATACTGATTCGG.......................................................................................2311.001.00-------------------------------1.00--------------------------------------------
..........................................................................................................................................................................TGTGATGAAGCCCAGAAGC..............................191.000.00----------------------------------------------------------1.00-----------------
..............................................................................................................TTGGAAGGGCATACTGATTCGGA......................................................................................2311.0015.00-----------------------------------------------------1.00----------------------
............................................................................................................ACTTGGAAGGGCATACTGATTCGG.......................................................................................2411.001.00----------------------------------------1.00-----------------------------------
..................................................................................................................................................TGAATCAAAGTCTGTTGTTCCCGA.................................................2411.007.00---------------------------------------------------------------1.00------------
........................................................................CTTAGGGTGAGTCTATATC................................................................................................................................191.000.00-----------------------------------------------------------------1.00----------
..................................................................................................................................................TGAATCAAAGTCTGTTG........................................................1720.500.50--0.50-------------------------------------------------------------------------
............................................................................GGGTGAGTCTAAGTCT...............................................................................................................................1640.250.25---------------------------------------------------------------------------0.25

Antisense strand
TACCCTCAGCCCAGCGTGACATGGATGGAGTGCAGGGGCCACACCGATAGGTCAGTGGGCTTGGTTTTCCTCCTTAGGGTGAGTCTAAGTCTGGGTTGCGTACCCATGACTTGGAAGGGCATACTGATTCGGGAGACCCTAAAGCCTGAATCAAAGTCTGTTGTTCCAGGTGTGATGAAGCCCAGGCTTTGCAGGTTTGGAATGACACCCACCCTGAAG
...............................................................................................................(((((.((((.(((((((((((...........)))))))))..)).)))).)))))...................................................
.........................................................................................................106............................................................169................................................
SizePerfect hitTotal NormPerfect NormmjLiverWT2()
Liver Data. (liver)		mjLiverKO1()
Liver Data. (Zcchc11 liver)		SRR346414(SRX098255)
Global profiling of miRNA and the hairpin pre. (Spleen)		SRR042456(GSM539848)
mouse hematopoetic progenitor cells [09-002]. (bone marrow)		SRR206942(GSM723283)
other. (brain)		SRR038744(GSM527279)
small RNA-Seq. (brain)		SRR206941(GSM723282)
other. (brain)		SRR346418(SRX098259)
Global profiling of miRNA and the hairpin pre. (Liver)		mjTestesWT1()
Testes Data. (testes)		GSM510444(GSM510444)
brain_rep5. (brain)		SRR206940(GSM723281)
other. (brain)		SRR248523(GSM733811)
cell type: Thy1+ spermatogonial stem cellstra. (testes)		Ago2IP504(Rui)
Quantitative functions of Argonaute proteins . (ago2 skin)		SRR553602(SRX182808)
source: Sertoli cells. (Sertoli cells)		SRR346423(SRX098265)
Global profiling of miRNA and the hairpin pre. (Brain)		SRR038742(GSM527277)
small RNA-Seq. (dgcr8 brain)		SRR038743(GSM527278)
small RNA-Seq. (dicer brain)		SRR042462(GSM539854)
mouse macrophages [09-002]. (bone marrow)		Ago1IP517(Rui)
Quantitative functions of Argonaute proteins . (ago1 skin)		SRR248524(GSM733812)
cell type: Thy1+ spermatogonial stem cellstra. (testes)		SRR073954(GSM629280)
total RNA. (blood)		SRR095855BC7(SRX039178)
sequencing of miRNA from wild type and diseas. (heart)		Ago3IP805(Rui)
Quantitative functions of Argonaute proteins . (ago3 skin)		SRR073955(GSM629281)
total RNA. (blood)		SRR042443(GSM539835)
mouse pro B cells [09-002]. (b cell)		SRR040489(GSM533912)
E18.5 Ago2 catalytically inactive LIVER small RNA. (ago2 liver)		SRR346419(SRX098260)
Global profiling of miRNA and the hairpin pre. (Lung)		SRR039610(GSM527274)
small RNA-Seq. (brain)		Ago2IP517(Rui)
Quantitative functions of Argonaute proteins . (ago2 skin)		SRR553582(SRX182788)
source: Brain. (Brain)		SRR095855BC2(SRX039178)
sequencing of miRNA from wild type and diseas. (heart)		SRR042461(GSM539853)
mouse dendritic cells [09-002]. (bone marrow)		Ago3IP812(Rui)
Quantitative functions of Argonaute proteins . (ago3 skin)		SRR346417(SRX098258)
Global profiling of miRNA and the hairpin pre. (Brain)		SRR306539(GSM750582)
19-24nt. (ago2 brain)		SRR345200(SRX097261)
source: size fractionated RNA from mouse hipp. (brain)		SRR042460(GSM539852)
mouse neutrophil cells replicate 2 [09-002]. (blood)		mjTestesKO7()
Testes Data. (Zcchc11 testes)		SRR391846(GSM852141)
gender: femalegenotype/variation: ADAR2-/-tis. (embryo)		SRR553585(SRX182791)
source: Kidney. (Kidney)		SRR042459(GSM539851)
mouse neutrophil cells replicate 1 [09-002]. (blood)		SRR391845(GSM852140)
gender: femalegenotype/variation: wild typeti. (embryo)		SRR065047(SRR065047)
Tissue-specific Regulation of Mouse MicroRNA . (liver)		GSM519104(GSM519104)
mouse_granulocyte_nuclei_smallRNAs. (cell line)		SRR037921(GSM510459)
e12p5_rep3. (embryo)		SRR042471(GSM539863)
mouse TFHS cells [09-002]. (spleen)		GSM640579(GSM640579)
small RNA in the liver with paternal Low pro. (liver)		GSM510456(GSM510456)
newborn_rep12. (total RNA)		SRR077864(GSM637801)
18-30 nt small RNAs. (liver)		SRR037929(GSM510467)
e7p5_rep3. (embryo)		SRR038740(GSM527275)
small RNA-Seq. (dicer brain)		SRR042447(GSM539839)
mouse mature B cells (spleen) replicate 2 [09-002]. (b cell)		SRR040488(GSM533911)
E18.5 wild type LIVER small RNA. (liver)		SRR065058(SRR065058)
Tissue-specific Regulation of Mouse MicroRNA . (pancreas)		SRR525243(SRA056111/SRX170319)
Mus musculus domesticus miRNA sequencing. (ago2 Blood)		SRR042478(GSM539870)
mouse lung tissue [09-002]. (lung)		SRR042479(GSM539871)
mouse liver tissue [09-002]. (liver)		SRR306538(GSM750581)
19-24nt. (ago2 brain)		SRR039152(GSM471929)
HL1_siNon_smallRNAseq. (muscle)		SRR023852(GSM307161)
ZHBT-c424hsmallrna_rep1. (cell line)		SRR345207(SRX097268)
source: size fractionated RNA from mouse hipp. (brain)		SRR032477(GSM485235)
sRNA_activation_deep_sequencing. (uterus)		SRR014230(GSM319954)
10 dpp Dnmt3L-KO MILI. (mili testes)		Ago1IP812(Rui)
Quantitative functions of Argonaute proteins . (ago1 skin)		SRR553584(SRX182790)
source: Heart. (Heart)		SRR039154(GSM471931)
HL1_siSrf2_smallRNAseq. (muscle)		SRR346415(SRX098256)
source: Testis. (Testes)		SRR095853(SRX039174)
sequencing of miRNA from wild type and diseas. (heart)		mjLiverWT3()
Liver Data. (liver)		SRR059770(GSM562832)
Treg_Dicer. (spleen)		SRR042484(GSM539876)
mouse salivary gland tissue [09-002]. (salivary gland)		GSM509280(GSM509280)
small RNA cloning by length. (testes)		SRR037905(GSM510441)
brain_rep2. (brain)		SRR042474(GSM539866)
mouse embryonic stem cells [09-002]. (ESC)		SRR077866(GSM637803)
18-30 nt small RNAs. (liver)		mjTestesKO6()
Testes Data. (Zcchc11 testes)
...................................................................................................................................GGAGACCCTAAAGCCACC...................................................................... 182.000.00-----------------------2.00----------------------------------------------------
...................................................................................................................................GGAGACCCTAAAGCCAAA...................................................................... 181.000.00--------------------1.00-------------------------------------------------------
.ACCCTCAGCCCAGCGTG......................................................................................................................................................................................................... 171.000.00-----------------------------------1.00----------------------------------------