ID: mmu-mir-6971
GENE: Skiv2l(19)
chr17:34978704-34978938-


(4)
AGO1.ip 		(16)
AGO2.ip 		(2)
AGO3.ip 		(7)
B-CELL 		(34)
BRAIN 		(8)
CELL-LINE 		(2)
DCR.mut 		(3)
DGCR8.mut 		(9)
EMBRYO 		(7)
ESC 		(2)
FIBROBLAST 		(3)
HEART 		(2)
KIDNEY 		(9)
LIVER 		(4)
LYMPH 		(16)
OTHER 		(10)
OTHER.mut 		(1)
OVARY 		(1)
PANCREAS 		(3)
PIWI.ip 		(8)
SKIN 		(5)
SPLEEN 		(18)
TESTES 		(6)
TOTAL-RNA 		(2)
UTERUS

Sense strand
ACATGATGAAGAGGAGCTTCTCAGAGTTCCCATCCCGCAAGGACAGCAAGGTGAGGTTAGGGTGAGCAACGTAGCTGTTGAGACAGGCAGTCTGGGCTGGCCAGGTGGGCATGCGGAGGCAGTGGGGTGGGGGAGGGTGTAGAGGCTGGGCTGGCAGACTCATCACAGCCTCTGCTTCTTCTCAGGCCCATGAGCAGGCTCTGGCTGACCTCACCAAGAGGCTGGGGGCTTTGGA
..................................................................................................................................(((((((.((((((((((((.(((.....))))).)))))))))).)))))))....................................................
..........................................................................................................................123...........................................................185................................................
SizePerfect hitTotal NormPerfect NormSRR546155(SRX180174)
Global profiling of miRNA and the hairpin pre. (ago2 Neuroblastoma)		SRR346417(SRX098258)
Global profiling of miRNA and the hairpin pre. (Brain)		SRR279907(GSM689057)
cell type: mouse embryonic stem cellcell line. (ESC)		SRR685339(GSM1079783)
Small RNAs (15-50 nts in length) from immorta. (cell line)		mjLiverKO2()
Liver Data. (Zcchc11 liver)		SRR038742(GSM527277)
small RNA-Seq. (dgcr8 brain)		SRR038741(GSM527276)
small RNA-Seq. (brain)		SRR345200(SRX097261)
source: size fractionated RNA from mouse hipp. (brain)		SRR038744(GSM527279)
small RNA-Seq. (brain)		SRR039610(GSM527274)
small RNA-Seq. (brain)		SRR346423(SRX098265)
Global profiling of miRNA and the hairpin pre. (Brain)		SRR391851(GSM852146)
gender: femalegenotype/variation: wild typeti. (embryo)		SRR206940(GSM723281)
other. (brain)		SRR346416(SRX098257)
Global profiling of miRNA and the hairpin pre. (Kidney)		SRR553583(SRX182789)
source: Cerebellum. (Cerebellum)		GSM510456(GSM510456)
newborn_rep12. (total RNA)		Ago3IP805(Rui)
Quantitative functions of Argonaute proteins . (ago3 skin)		SRR073954(GSM629280)
total RNA. (blood)		SRR042470(GSM539862)
mouse Th17 cells [09-002]. (lymph)		SRR038745(GSM527280)
small RNA-Seq. (dgcr8 brain)		SRR391853(GSM852148)
gender: femalegenotype/variation: ADAR2-/-/AD. (embryo)		SRR390300(GSM849858)
cell line: NIH-3T3cell type: fibroblastinfect. (ago2 fibroblast)		SRR346424(SRX098266)
Global profiling of miRNA and the hairpin pre. (Neuroblastoma)		SRR248526(GSM733814)
cell type: Thy1- spermatogonial stem cellstra. (testes)		mjLiverKO1()
Liver Data. (Zcchc11 liver)		SRR279904(GSM689054)
cell type: mouse embryonic stem cellcell line. (ESC)		SRR042449(GSM539841)
mouse B cells activated in vitro with LPS/IL4 replicate 2 [09-002]. (b cell)		SRR391848(GSM852143)
gender: femalegenotype/variation: wild typeti. (embryo)		SRR346415(SRX098256)
source: Testis. (Testes)		SRR391846(GSM852141)
gender: femalegenotype/variation: ADAR2-/-tis. (embryo)		SRR346422(SRX098264)
Global profiling of miRNA and the hairpin pre. (Muscle)		SRR394083(GSM855969)
background strain: C57BL6/SV129cell type: KRa. (cell line)		SRR345202(SRX097263)
source: size fractionated RNA from mouse hipp. (brain)		RuiDcrWT(Rui)
DGCR8-dependent microRNA biogenesis is essent. (skin)		SRR346425(SRX098267)
Global profiling of miRNA and the hairpin pre. (Neuroblastoma)		Ago1IP812(Rui)
Quantitative functions of Argonaute proteins . (ago1 skin)		GSM519104(GSM519104)
mouse_granulocyte_nuclei_smallRNAs. (cell line)		SRR077865(GSM637802)
18-30 nt small RNAs. (liver)		SRR042468(GSM539860)
mouse Th1 cells [09-002]. (lymph)		SRR042447(GSM539839)
mouse mature B cells (spleen) replicate 2 [09-002]. (b cell)		SRR038740(GSM527275)
small RNA-Seq. (dicer brain)		GSM475281(GSM475281)
total RNA. (testes)		SRR345198(SRX097259)
source: size fractionated RNA from mouse hipp. (brain)		GSM314557(GSM314557)
ESC dgcr8 (Illumina). (ESC)		GSM314552(GSM314552)
ESC wild type (Illumina). (ESC)		SRR042469(GSM539861)
mouse Th2 cells [09-002]. (lymph)		SRR116846(GSM678422)
Small RNA deep sequencing from mouse epididym. (epididymis)		GSM640581(GSM640581)
small RNA in the liver with paternal control. (liver)		SRR391849(GSM852144)
gender: femalegenotype/variation: ADAR2-/-tis. (embryo)		SRR038743(GSM527278)
small RNA-Seq. (dicer brain)		SRR346418(SRX098259)
Global profiling of miRNA and the hairpin pre. (Liver)		SRR023850(GSM307159)
ZHBT-c40hsmallrna_rep1. (cell line)		GSM510450(GSM510450)
newborn_rep6. (total RNA)		SRR525244(SRA056111/SRX170320)
Mus musculus domesticus miRNA sequencing. (ago2 Blood)		mjLiverKO3()
Liver Data. (Zcchc11 liver)		SRR553582(SRX182788)
source: Brain. (Brain)		SRR042471(GSM539863)
mouse TFHS cells [09-002]. (spleen)		SRR345197(SRX097258)
source: size fractionated RNA from mouse hipp. (brain)		SRR042465(GSM539857)
mouse CD4+ T cells (spleen) [09-002]. (spleen)		SRR059769(GSM562831)
Treg_Drosha. (spleen)		SRR059771(GSM562833)
CD4_control. (spleen)		SRR042446(GSM539838)
mouse mature B cells (spleen) replicate 1 [09-002]. (b cell)		SRR065058(SRR065058)
Tissue-specific Regulation of Mouse MicroRNA . (pancreas)		SRR029037(GSM433289)
18dpp_homo_tdrd6-KO. (tdrd6 testes)		SRR306542(GSM750585)
19-24nt. (ago2 brain)		SRR391852(GSM852147)
gender: femalegenotype/variation: ADAR2-/-tis. (embryo)		RuiDGCR8KO(Rui)
DGCR8-dependent microRNA biogenesis is essent. (dgcr8 skin)		SRR306541(GSM750584)
19-24nt. (ago2 brain)		GSM475280(GSM475280)
Mili-IP. (mili testes)		SRR402762(SRX117945)
source: ES E14 male cells. (ESC)		Ago3IP812(Rui)
Quantitative functions of Argonaute proteins . (ago3 skin)		GSM510444(GSM510444)
brain_rep5. (brain)		SRR346420(SRX098261)
Global profiling of miRNA and the hairpin pre. (Uterus)		Ago1IP517(Rui)
Quantitative functions of Argonaute proteins . (ago1 skin)		SRR037912(GSM510449)
newborn_rep5. (total RNA)		SRR042483(GSM539875)
mouse muscle tissue [09-002]. (muscle)		SRR306530(GSM750573)
19-24nt. (ago2 brain)		SRR306536(GSM750579)
19-24nt. (ago2 brain)		SRR042456(GSM539848)
mouse hematopoetic progenitor cells [09-002]. (bone marrow)		SRR390299(GSM849857)
cell line: NIH-3T3cell type: fibroblastip ant. (ago2 fibroblast)		SRR077864(GSM637801)
18-30 nt small RNAs. (liver)		SRR345199(SRX097260)
source: size fractionated RNA from mouse hipp. (brain)		SRR391845(GSM852140)
gender: femalegenotype/variation: wild typeti. (embryo)		SRR060845(GSM561991)
total RNA. (brain)		SRR042459(GSM539851)
mouse neutrophil cells replicate 1 [09-002]. (blood)		SRR206942(GSM723283)
other. (brain)		SRR306529(GSM750572)
19-24nt. (ago2 brain)		SRR037920(GSM510458)
e12p5_rep2. (embryo)		SRR037905(GSM510441)
brain_rep2. (brain)		SRR345201(SRX097262)
source: size fractionated RNA from mouse hipp. (brain)		GSM510455(GSM510455)
newborn_rep11. (total RNA)		SRR306532(GSM750575)
19-24nt. (ago2 brain)		mjTestesKO8()
Testes Data. (Zcchc11 testes)		SRR525240(SRA056111/SRX170316)
Mus musculus domesticus miRNA sequencing. (ago1 Blood)		SRR346413(SRX098254)
Global profiling of miRNA and the hairpin pre. (Heart)		GSM640578(GSM640578)
small RNA in the liver with paternal control. (liver)		SRR042473(GSM539865)
mouse nTreg cells [09-002]. (lymph)		SRR042453(GSM539845)
mouse marginal zone B cells (spleen) [09-002]. (b cell)		SRR095853(SRX039174)
sequencing of miRNA from wild type and diseas. (heart)		GSM510453(GSM510453)
newborn_rep9. (total RNA)		SRR042455(GSM539847)
mouse plasma cells [09-002]. (blood)		SRR037897(GSM510433)
ovary_rep2. (ovary)		SRR248524(GSM733812)
cell type: Thy1+ spermatogonial stem cellstra. (testes)		SRR029038(GSM433290)
25dpp_hetero_tdrd6-KO. (tdrd6 testes)		SRR248527(GSM733815)
cell type: spermatogonial stem cell enriched . (testes)		mjTestesKO7()
Testes Data. (Zcchc11 testes)		GSM416732(GSM416732)
MEF. (cell line)		SRR306537(GSM750580)
19-24nt. (ago2 brain)		SRR042454(GSM539846)
mouse germinal center B cells (lymph node) [09-002]. (b cell)		SRR525243(SRA056111/SRX170319)
Mus musculus domesticus miRNA sequencing. (ago2 Blood)		SRR032476(GSM485234)
sRNA_delayed_deep_sequencing. (uterus)		SRR402761(SRX117944)
source: ES E14 male cells. (ESC)		SRR029036(GSM433288)
18dpp_hetero_tdrd6-KO. (tdrd6 testes)		SRR248525(GSM733813)
cell type: Thy1- spermatogonial stem cellstra. (testes)		SRR077866(GSM637803)
18-30 nt small RNAs. (liver)		SRR037934(GSM510472)
293cand4_rep3. (cell line)		mjTestesWT3()
Testes Data. (testes)		Ago2IP517(Rui)
Quantitative functions of Argonaute proteins . (ago2 skin)		SRR042467(GSM539859)
mouse T cells activated in vitro with Concanavalin A [09-002]. (spleen)		SRR345207(SRX097268)
source: size fractionated RNA from mouse hipp. (brain)		SRR029123(GSM416611)
NIH3T3. (cell line)		SRR306534(GSM750577)
19-24nt. (ago2 brain)		SRR306538(GSM750581)
19-24nt. (ago2 brain)		SRR029043(GSM433295)
18.5dpc_homo_tdrd1-KO. (tdrd1 testes)		GSM475279(GSM475279)
Miwi-IP. (miwi testes)		SRR391850(GSM852145)
gender: femalegenotype/variation: ADAR2-/-/AD. (embryo)		SRR069809(GSM610965)
small RNA sequencing; sample 1. (testes)		SRR553604(SRX182810)
source: Spermatocytes. (Spermatocytes)		Ago2IP504(Rui)
Quantitative functions of Argonaute proteins . (ago2 skin)		SRR279903(GSM689053)
cell type: mouse embryonic stem cellcell line. (ESC)		mjTestesKO5()
Testes Data. (Zcchc11 testes)		SRR037944(GSM510482)
293DcrTN_cand5. (cell line)		SRR553585(SRX182791)
source: Kidney. (Kidney)		SRR095855BC8(SRX039178)
sequencing of miRNA from wild type and diseas. (heart)		SRR073955(GSM629281)
total RNA. (blood)		SRR042444(GSM539836)
mouse pre B cells [09-002]. (b cell)		SRR034120(GSM466730)
Mili IP_Tdrd9-/- replicate1. (mili testes)		SRR345196(SRX097257)
source: size fractionated RNA from mouse hipp. (brain)		GSM317183(GSM317183)
Ago-1 IP small RNAs from mouse brain. (ago1 brain)		SRR037914(GSM510451)
newborn_rep7. (total RNA)		SRR042450(GSM539842)
mouse B cells activated in vitro with LPS/IL4 replicate 3 [09-002]. (b cell)		SRR345205(SRX097266)
source: size fractionated RNA from mouse hipp. (brain)
....................................................................................................................................................................ACAGCCTCTGCTTCTTCTCAGT.................................................221172.0012.006.0013.00-9.00-9.007.00-7.007.006.003.003.005.003.003.003.002.001.004.001.00---4.004.00-2.001.00-2.00--2.002.003.001.003.00-2.001.002.00--2.00-2.001.001.002.00-1.00-1.00-1.00--1.00--1.002.001.001.00--1.00-1.00-1.001.00-1.001.001.002.001.002.002.00-1.00-1.001.001.00-----1.00-1.00-1.00--1.00------1.00---1.001.001.00----1.00--1.001.00-1.00-1.00-1.00--1.00-1.00---------
...............................................................................................................................TGGGGGAGGGTGTAGAGGCT........................................................................................20120.0020.00-1.005.00-----------1.00---1.00----1.00--1.00-----3.00-----2.00-----------------2.00------------------1.00---------------------------------1.00------------------1.00-------------
...................................................................................................................................................................CACAGCCTCTGCTTCTTCTCAGT.................................................23114.003.00---------2.001.00--1.00-----1.00-------1.00--1.00-----1.00---2.00--------------------------------1.00------------------------1.00--1.00-----1.00----------------------------------
....................................................................................................................................................................ACAGCCTCTGCTTCTTCTCAG..................................................21112.0012.001.00----1.001.00----1.00--1.00--1.00-----1.00------1.00------------1.00------1.00----------1.00-----------------------------------1.00--------------------------------------------
................................................................................................................................GGGGGAGGGTGTAGAGGCTGGGCT...................................................................................24112.0012.00----12.00-----------------------------------------------------------------------------------------------------------------------------------------
....................................................................................................................................................................ACAGCCTCTGCTTCTTCTCAGA.................................................22112.0012.001.00-------------------1.005.00------1.00------------------1.00----------------------1.00---1.00------------------1.00------------------------------------------------
.....................................................................................................................................................................CAGCCTCTGCTTCTTCTCAGT.................................................2110.000.002.00--2.00------1.00-------------------------1.00-----------------------2.00-----1.00----------------------------------------------1.00----------------------------
....................................................................................................................................................................ACAGCCTCTGCTTCTTCTCA...................................................2018.008.00-1.00---1.00-----------------1.00--1.00--------------------------1.00-----1.00------------------------------1.00-----------------------1.00---------------------------
...............................................................................................................................TGGGGGAGGGTGTAGAGGCTGGG.....................................................................................2315.005.00-1.002.00-----------------1.00-------------------------------------------1.00-----------------------------------------------------------------------------
...............................................................................................................................TGGGGGAGGGTGTAGAGGC.........................................................................................1914.004.00------------------1.00-1.00------------------------------------2.00------------------------------------------------------------------------------------
....................................................................................................................................................................ACAGCCTCTGCTTCTTCT.....................................................1814.004.00-------------------------------4.00--------------------------------------------------------------------------------------------------------------
...............................................................................................................................TGGGGGAGGGTGTAGAGGCTGA......................................................................................2214.004.001.00-------1.00---2.00---------------------------------------------------------------------------------------------------------------------------------
...............................................................................................................................TGGGGGAGGGTGTAGAGGCTGG......................................................................................2214.004.001.00----------1.00----1.00-----1.00-----------------------------------------------------------------------------------------------------------------------
....................................................................................................................................................................................................GGCTCTGGCTGACCTCAC.....................1814.004.00---------------3.00------------------------------------1.00-----------------------------------------------------------------------------------------
...............................................................................................................................TGGGGGAGGGTGTAGAGGCTG.......................................................................................2114.004.001.00-------------1.00----------------------------------------------------1.00-----------------------1.00--------------------------------------------------
....................................................................................................................................................................ACAGCCTCTGCTTCTTCTCAGTT................................................2313.0012.00----------------1.00------------------------------------------------------------------1.00-------------------------------------------------1.00--------
...............................................................................................................................TGGGGGAGGGTGTAGAGGCTGGAAA...................................................................................2513.004.00--3.00-------------------------------------------------------------------------------------------------------------------------------------------
...................................................................................................................................................................CACAGCCTCTGCTTCTTCTCAG..................................................2213.003.00------1.00-----1.00------------------------------------------------------------1.00--------------------------------------------------------------------
...............................................................................................................................TGGGGGAGGGTGTAGAGGCTGGGC....................................................................................2413.003.00------------------------------------------------------1.00-----------------1.00--------------------------------------------------------1.00------------
...............................................................................................................................TGGGGGAGGGTGTAGAGGCTGT......................................................................................2213.004.001.00----------------1.00---------------------------------------------------1.00------------------------------------------------------------------------
...............................................................................................................................TGGGGGAGGGTGTAGAGGCTGGGA....................................................................................2413.005.00--3.00-------------------------------------------------------------------------------------------------------------------------------------------
....................................................................................................................................................................ACAGCCTCTGCTTCTTCTCAGC.................................................2213.0012.00------2.00------------------------------------------------------------------------------------------------------------------------------------1.00--
....................................................................................................................................................................ACAGCCTCTGCTTCTTCTCAGTAT...............................................2412.0012.00-----------1.00------------------------------------------------------------------1.00---------------------------------------------------------------
....................................................................................................................................................................ACAGCCTCTGCTTCTTCTC....................................................1912.002.00-1.00------------------------------------------------------------------------------------------------------------------------1.00-------------------
...............................................................................................................................TGGGGGAGGGTGTAGAGGCTGGT.....................................................................................2312.004.001.00----------------------------------------------------------1.00----------------------------------------------------------------------------------
.................................................................................................................................GGGGAGGGTGTAGAGGCTGA......................................................................................202.000.001.00----------------------------------------------------------------------------------------------1.00----------------------------------------------
................................................................................................................................GGGGGAGGGTGTAGAGGCT........................................................................................1912.002.00------------------1.00--------------------------1.00------------------------------------------------------------------------------------------------
...............................................................................................................................TGGGGGAGGGTGTAGAGGCTGTAA....................................................................................2412.004.00------------2.00---------------------------------------------------------------------------------------------------------------------------------
...............................................................................................................................TGGGGGAGGGTGTAGAGGCTAT......................................................................................2212.0020.00--------1.00------------------------------1.00------------------------------------------------------------------------------------------------------
...............................................................................................................................TGGGGGAGGGTGTAGAGGCTGGGG....................................................................................2412.005.00----------------------------1.00--------------------------1.00--------------------------------------------------------------------------------------
...............................................................................................................................TGGGGGAGGGTGTAGAGGCTGAAT....................................................................................2412.004.002.00---------------------------------------------------------------------------------------------------------------------------------------------
..................................................................................................................................................................TCACAGCCTCTGCTTCTTCTCAGT.................................................242.000.00-----1.00---------------------------1.00------------------------------------------------------------------------------------------------------------
.....................................................................................................................................................................CAGCCTCTGCTTCTTCTCAGTAA...............................................232.000.00-----------------------------2.00----------------------------------------------------------------------------------------------------------------
....................................................................................................................................................................ACAGCCTCTGCTTCTTCTCAGTA................................................2312.0012.00-----------1.00---------------------------------------1.00------------------------------------------------------------------------------------------
...............................................................................................................................TGGGGGAGGGTGTAGAGGCTGGGGTT..................................................................................2611.005.00------------------------------------------------------1.00---------------------------------------------------------------------------------------
.................................................................................................................................GGGGAGGGTGTAGAGGCTGG......................................................................................2011.001.001.00---------------------------------------------------------------------------------------------------------------------------------------------
....................................................................................................................AGGCAGTGGGGTGGGGCTT....................................................................................................191.000.00-----------------------------------------------------------------------------------------------------------------------------------------1.00----
...............................................................................................................................TGGGGGAGGGTGTAGAGGCTT.......................................................................................2111.0020.00----------------------------------------------------------1.00-----------------------------------------------------------------------------------
.............................................................................................................................................................................................ATGAGCAGGCTCTGGAAC............................181.000.00-----------------------------1.00----------------------------------------------------------------------------------------------------------------
...TGATGAAGAGGAGCTTCTCAGAGTTCCCAT..........................................................................................................................................................................................................3011.001.00-------------------------------------------------------------------------------------------------------1.00--------------------------------------
.............................................................................................GGGCTGGCCAGGTGGAGCA...........................................................................................................................191.000.00---------------------------------------------------------------------------------1.00------------------------------------------------------------
................................................................................................................................GGGGGAGGGTGTAGAGGCTAAAT....................................................................................2311.002.00----------------------------------------------------------------------------------------------------------------------1.00-----------------------
.....................................................................................................................................................................CAGCCTCTGCTTCTTCTAAGT.................................................211.000.00---1.00------------------------------------------------------------------------------------------------------------------------------------------
.................................................................................................................................GGGGAGGGTGTAGAGGCTGGGT....................................................................................221.000.00---------------------------1.00------------------------------------------------------------------------------------------------------------------
..........................................................................................................................................................................................................................AGGCTGGGGGCTTTGGA1711.001.00--------------------------------------------------------------------------------------------------------------------1.00-------------------------
...............................................................................................................................TGGGGGAGGGTGTAGAGGCTTAT.....................................................................................2311.0020.00---------------------------------------------1.00------------------------------------------------------------------------------------------------
.......GAAGAGGAGCTTCTCAGAGTTCC.............................................................................................................................................................................................................2311.001.00-----------------------------------------------------------------1.00----------------------------------------------------------------------------
....................................GCAAGGACAGCAAGGGGG.....................................................................................................................................................................................181.000.00----------------------------------------------------------------------1.00-----------------------------------------------------------------------
....................................................................................................................................................................ACAGCCTCTGCTTCTTCTTATT.................................................2211.004.00----------------------------------------------------------------------------1.00-----------------------------------------------------------------
.................................................................................................................................GGGGAGGGTGTAGAGGCTAT......................................................................................2011.001.00------------------------------------------------1.00---------------------------------------------------------------------------------------------
...................................................................................................................................................................CACAGCCTCTGCTTCTTCTCAGTA................................................2411.003.001.00---------------------------------------------------------------------------------------------------------------------------------------------
...............................................................................................................................TGGGGGAGGGTGTAGAGGCTGGGTT...................................................................................2511.005.00----------------------1.00-----------------------------------------------------------------------------------------------------------------------
...............................................................................................................................TGGGGGAGGGTGTAGAGGCTGGAC....................................................................................2411.004.00--------1.00-------------------------------------------------------------------------------------------------------------------------------------
.................................................................................................................................................................................................GCAGGCTCTGGCTGACCTCAA.....................211.000.00------------------------------------------------------------------------------------------------------------1.00---------------------------------
...................................................................................................................................................................................................AGGCTCTGGCTGACCTCAC.....................1911.001.00--------------------1.00-------------------------------------------------------------------------------------------------------------------------
...............................................................................................................................TGGGGGAGGGTGTAGAGGCTGTAT....................................................................................2411.004.001.00---------------------------------------------------------------------------------------------------------------------------------------------
....................................................................................................................................................................ACAGCCTCTGCTTCTTCTCACT.................................................2211.008.00---1.00------------------------------------------------------------------------------------------------------------------------------------------
...............................................................................................................................TGGGGGAGGGTGTAGAGGTTAA......................................................................................221.000.001.00---------------------------------------------------------------------------------------------------------------------------------------------
...............................................................................................................................TGGGGGAGGGTGTAGAGGCTGGTTTA..................................................................................2611.004.00----------------------1.00-----------------------------------------------------------------------------------------------------------------------
...............................................................................................................................TGGGGGAGGGTGTAGAGGCTGGGCA...................................................................................2511.003.00-1.00--------------------------------------------------------------------------------------------------------------------------------------------
................................................................................................................................GGGGGAGGGTGTAGAGGCTGGGC....................................................................................2311.001.00----------------------------------1.00-----------------------------------------------------------------------------------------------------------
..............................................................................................................................................................................................TGAGCAGGCTCTGGCATAG..........................191.000.00------------------------------------------1.00---------------------------------------------------------------------------------------------------
...............................................................................................................................TGGGGGAGGGTGTAGAGGCTGGATT...................................................................................2511.004.001.00---------------------------------------------------------------------------------------------------------------------------------------------
...............................................................................................................................TGGGGGAGGGTGTAGAGGCTGGGAAT..................................................................................2611.005.00-------------------------------------------1.00--------------------------------------------------------------------------------------------------
..................................................................................................................................................................................................CAGGCTCTGGCTGACCTCACC....................2111.001.00--------------------------------------------------1.00-------------------------------------------------------------------------------------------
....................................................................................................................................................................ACAGCCTCTGCTTCTAGC.....................................................181.000.00-----------------------------------------------------------------------------------------------------------------------------------1.00----------
...........................TCCCATCCCGCAAGGACAGCAAGGCCC.....................................................................................................................................................................................271.000.00------------------------------------------------------------------------------------------------------------------------------1.00---------------
...............................ATCCCGCAAGGACAGCAAGGCCC.....................................................................................................................................................................................231.000.00--------------------------------------------------------------------1.00-------------------------------------------------------------------------
.................................................................................................................................GGGGAGGGTGTAGAGGCT........................................................................................1811.001.00------------------1.00---------------------------------------------------------------------------------------------------------------------------
................................................................................................................................GGGGGAGGGTGTAGAGGCTGGGCATT.................................................................................2611.001.00-----------------1.00----------------------------------------------------------------------------------------------------------------------------
.........................................................................................................................................................................................................TGGCTGACCTCACCAAGAGGCTGGGGGCT.....2911.001.00----------------------------------------------------------------------------------------------------------------------------------------1.00-----
...............................................................................................................................TGGGGGAGGGTGTAGAGGCTGTAG....................................................................................2411.004.00---------------------------------------------------------------------------------------------------------1.00------------------------------------
................................................................................................................................GGGGGAGGGTGTAGAGGCTGGGGAAT.................................................................................261.000.00------------------------------------------------------------------------------------------------------1.00---------------------------------------
...............................................................................................................................TGGGGGAGGGTGTAGAGGCTGGAAT...................................................................................2511.004.00----------------------1.00-----------------------------------------------------------------------------------------------------------------------
...........................TCCCATCCCGCAAGGACAGCAAGGC.......................................................................................................................................................................................251.000.00--------------------------------------------------------------------1.00-------------------------------------------------------------------------
........................................GGACAGCAAGGTGAGGAACT...............................................................................................................................................................................201.000.00-----------------------------------------------------------------------------------------1.00----------------------------------------------------
.........................................................................................................................GTGGGGTGGGGGAGGGTAAT..............................................................................................201.000.00----------------------------------------------------------------------------------------------------1.00-----------------------------------------
...................................................................................................................................................................CACAGCCTCTGCTTCTTCTCAT..................................................221.000.00------------------------------------------------------------------1.00---------------------------------------------------------------------------
....................................................................................................................................................................ACAGCCTCTGCTTCTAGCT....................................................191.000.00-------------------------------------------------------------------------------------------------------------------1.00--------------------------
...TGATGAAGAGGAGCTTCTCAGAGTTCT.............................................................................................................................................................................................................271.000.00---------------------------------------------------------------1.00------------------------------------------------------------------------------
................................................................................................................................GGGGGAGGGTGTAGAGGCTTT......................................................................................2111.002.00--------------------------------------1.00-------------------------------------------------------------------------------------------------------
...............................................................................................................................TGGGGGAGGGTGTAGAGGCTAAG.....................................................................................2311.0020.00--------------------------1.00-------------------------------------------------------------------------------------------------------------------
...............................................................................................................................TGGGGGAGGGTGTAGAGGCTATA.....................................................................................2311.0020.00---------------------------------------------------------------------------------------------------------------------------------------1.00------
..............................................................................TGAGACAGGCAGTCTGTC...........................................................................................................................................181.000.00-------1.00--------------------------------------------------------------------------------------------------------------------------------------
.....................................................................................................................................................................CAGCCTCTGCTTCTTCTCAGA.................................................211.000.00-----------------------------------------------------------------1.00----------------------------------------------------------------------------
....................................................................................................................................................................ACAGCCTCTGCTTCTTCTCAAGT................................................2311.008.00------------------------------------------------------------------------------------------------------------------------------------------1.00---
...............................................................................................................................TGGGGGAGGGTGTAGAGGCTGGA.....................................................................................2311.004.00-----------1.00----------------------------------------------------------------------------------------------------------------------------------
...................................................................................................................................................................CACAGCCTCTGCTTCTTCTCAGA.................................................2311.003.00--------------------------------------------------------------------------------------------------------1.00-------------------------------------
.........................................................................................................................GTGGGGTGGGGGAGGGTATTT.............................................................................................211.000.00--------------------------1.00-------------------------------------------------------------------------------------------------------------------
.....................................................................................................................................................................CAGCCTCTGCTTCTTCTCAAT.................................................211.000.001.00---------------------------------------------------------------------------------------------------------------------------------------------
........................................................................................................................................................................CCTCTGCTTCTTCTCAGT.................................................181.000.00---------------------------------------------------------------------------------------1.00------------------------------------------------------
..................................................................................................................................................................TCACAGCCTCTGCTTCTTCTCAGA.................................................241.000.00----------------------------1.00-----------------------------------------------------------------------------------------------------------------
....................................................................................................................................................................ACAGCCTCTGCTTCTTCTCAGAT................................................2311.0012.00-----------------------1.00----------------------------------------------------------------------------------------------------------------------
.................................................................................................................................GGGGAGGGTGTAGAGGCTGAAT....................................................................................221.000.001.00---------------------------------------------------------------------------------------------------------------------------------------------
................................................................................................................................GGGGGAGGGTGTAGAGGCTGGCCAT..................................................................................251.000.001.00---------------------------------------------------------------------------------------------------------------------------------------------
.....................................CAAGGACAGCAAGGTGGT....................................................................................................................................................................................181.000.00-----------------------------1.00----------------------------------------------------------------------------------------------------------------
...............................................................................................................................................................................................GAGCAGGCTCTGGCTGACC.........................1911.001.00----------------------------------------------------------------------------------------------------------------------------1.00-----------------
..............................................................................................................ATGCGGAGGCAGTGGCACG..........................................................................................................191.000.00-------1.00--------------------------------------------------------------------------------------------------------------------------------------
...............................................................................................................................TGGGGGAGGGTGTAGAGGCTGAAAT...................................................................................2511.004.00--------------------------------------------------------------------------------------------------------------------------------------1.00-------
...............................................................................................................................TGGGGGAGGGTGTAGAGGCTAGT.....................................................................................2311.0020.00----------------------1.00-----------------------------------------------------------------------------------------------------------------------
...............................................................................................................................TGGGGGAGGGTGTAGAGGCTGGGCTAT.................................................................................271.000.001.00---------------------------------------------------------------------------------------------------------------------------------------------
....................................................................................................................................................................ACAGCCTCTGCTTCTTCTCAT..................................................2111.008.00----------------------------------------------------1.00-----------------------------------------------------------------------------------------
....................................................................................................................................................................ACAGCCTCTGCTTCTTCTCAAT.................................................2211.008.00----------------------------------------------------------------------------------------1.00-----------------------------------------------------
...............................................................................................................................TGGGGGAGGGTGTAGAGGCTAA......................................................................................2211.0020.00-----------------------------------------------------------------------1.00----------------------------------------------------------------------
...............................................................................................................................TGGGGGAGGGTGTAGAGGCTGGGT....................................................................................2411.005.001.00---------------------------------------------------------------------------------------------------------------------------------------------
....................................................................................................................................................................ACAGCCTCTGCTTCTTC......................................................1730.670.67--------------------------------------------0.33-------------------------------------0.33-----------------------------------------------------------
........................................................................................................................................................................................................................AGAGGCTGGGGGCTTT...1620.500.50-------------------------------------------0.50--------------------------------------------------------------------------------------------------
.......................................................................................................................CAGTGGGGTGGGGGAGGGT.................................................................................................1950.400.40------------------------------------------------------------------------------------0.20-------------------------------------------------------0.20-
........................................................................................AGTCTGGGCTGGCCAGG..................................................................................................................................1740.250.25-----------------------------------------------------------------------------------0.25----------------------------------------------------------
...............................................................................................................................TGGGGGAGGGTGTAGA............................................................................................1690.220.220.22---------------------------------------------------------------------------------------------------------------------------------------------
...............................................................................................................................TGGGGGAGGGTGTAGAAGT.........................................................................................1990.110.22---------------------------------------------0.11------------------------------------------------------------------------------------------------
..................................................................................................................GGAGGCAGTGGGGTGGGACA.....................................................................................................2090.110.11--------------------------------0.11-------------------------------------------------------------------------------------------------------------
..................................................................................................................GGAGGCAGTGGGGTGGG........................................................................................................1790.110.11---------------------------------------------------------------------------------------------------------------------------------------------0.11

Antisense strand
ACATGATGAAGAGGAGCTTCTCAGAGTTCCCATCCCGCAAGGACAGCAAGGTGAGGTTAGGGTGAGCAACGTAGCTGTTGAGACAGGCAGTCTGGGCTGGCCAGGTGGGCATGCGGAGGCAGTGGGGTGGGGGAGGGTGTAGAGGCTGGGCTGGCAGACTCATCACAGCCTCTGCTTCTTCTCAGGCCCATGAGCAGGCTCTGGCTGACCTCACCAAGAGGCTGGGGGCTTTGGA
..................................................................................................................................(((((((.((((((((((((.(((.....))))).)))))))))).)))))))....................................................
..........................................................................................................................123...........................................................185................................................
SizePerfect hitTotal NormPerfect NormSRR546155(SRX180174)
Global profiling of miRNA and the hairpin pre. (ago2 Neuroblastoma)		SRR346417(SRX098258)
Global profiling of miRNA and the hairpin pre. (Brain)		SRR279907(GSM689057)
cell type: mouse embryonic stem cellcell line. (ESC)		SRR685339(GSM1079783)
Small RNAs (15-50 nts in length) from immorta. (cell line)		mjLiverKO2()
Liver Data. (Zcchc11 liver)		SRR038742(GSM527277)
small RNA-Seq. (dgcr8 brain)		SRR038741(GSM527276)
small RNA-Seq. (brain)		SRR345200(SRX097261)
source: size fractionated RNA from mouse hipp. (brain)		SRR038744(GSM527279)
small RNA-Seq. (brain)		SRR039610(GSM527274)
small RNA-Seq. (brain)		SRR346423(SRX098265)
Global profiling of miRNA and the hairpin pre. (Brain)		SRR391851(GSM852146)
gender: femalegenotype/variation: wild typeti. (embryo)		SRR206940(GSM723281)
other. (brain)		SRR346416(SRX098257)
Global profiling of miRNA and the hairpin pre. (Kidney)		SRR553583(SRX182789)
source: Cerebellum. (Cerebellum)		GSM510456(GSM510456)
newborn_rep12. (total RNA)		Ago3IP805(Rui)
Quantitative functions of Argonaute proteins . (ago3 skin)		SRR073954(GSM629280)
total RNA. (blood)		SRR042470(GSM539862)
mouse Th17 cells [09-002]. (lymph)		SRR038745(GSM527280)
small RNA-Seq. (dgcr8 brain)		SRR391853(GSM852148)
gender: femalegenotype/variation: ADAR2-/-/AD. (embryo)		SRR390300(GSM849858)
cell line: NIH-3T3cell type: fibroblastinfect. (ago2 fibroblast)		SRR346424(SRX098266)
Global profiling of miRNA and the hairpin pre. (Neuroblastoma)		SRR248526(GSM733814)
cell type: Thy1- spermatogonial stem cellstra. (testes)		mjLiverKO1()
Liver Data. (Zcchc11 liver)		SRR279904(GSM689054)
cell type: mouse embryonic stem cellcell line. (ESC)		SRR042449(GSM539841)
mouse B cells activated in vitro with LPS/IL4 replicate 2 [09-002]. (b cell)		SRR391848(GSM852143)
gender: femalegenotype/variation: wild typeti. (embryo)		SRR346415(SRX098256)
source: Testis. (Testes)		SRR391846(GSM852141)
gender: femalegenotype/variation: ADAR2-/-tis. (embryo)		SRR346422(SRX098264)
Global profiling of miRNA and the hairpin pre. (Muscle)		SRR394083(GSM855969)
background strain: C57BL6/SV129cell type: KRa. (cell line)		SRR345202(SRX097263)
source: size fractionated RNA from mouse hipp. (brain)		RuiDcrWT(Rui)
DGCR8-dependent microRNA biogenesis is essent. (skin)		SRR346425(SRX098267)
Global profiling of miRNA and the hairpin pre. (Neuroblastoma)		Ago1IP812(Rui)
Quantitative functions of Argonaute proteins . (ago1 skin)		GSM519104(GSM519104)
mouse_granulocyte_nuclei_smallRNAs. (cell line)		SRR077865(GSM637802)
18-30 nt small RNAs. (liver)		SRR042468(GSM539860)
mouse Th1 cells [09-002]. (lymph)		SRR042447(GSM539839)
mouse mature B cells (spleen) replicate 2 [09-002]. (b cell)		SRR038740(GSM527275)
small RNA-Seq. (dicer brain)		GSM475281(GSM475281)
total RNA. (testes)		SRR345198(SRX097259)
source: size fractionated RNA from mouse hipp. (brain)		GSM314557(GSM314557)
ESC dgcr8 (Illumina). (ESC)		GSM314552(GSM314552)
ESC wild type (Illumina). (ESC)		SRR042469(GSM539861)
mouse Th2 cells [09-002]. (lymph)		SRR116846(GSM678422)
Small RNA deep sequencing from mouse epididym. (epididymis)		GSM640581(GSM640581)
small RNA in the liver with paternal control. (liver)		SRR391849(GSM852144)
gender: femalegenotype/variation: ADAR2-/-tis. (embryo)		SRR038743(GSM527278)
small RNA-Seq. (dicer brain)		SRR346418(SRX098259)
Global profiling of miRNA and the hairpin pre. (Liver)		SRR023850(GSM307159)
ZHBT-c40hsmallrna_rep1. (cell line)		GSM510450(GSM510450)
newborn_rep6. (total RNA)		SRR525244(SRA056111/SRX170320)
Mus musculus domesticus miRNA sequencing. (ago2 Blood)		mjLiverKO3()
Liver Data. (Zcchc11 liver)		SRR553582(SRX182788)
source: Brain. (Brain)		SRR042471(GSM539863)
mouse TFHS cells [09-002]. (spleen)		SRR345197(SRX097258)
source: size fractionated RNA from mouse hipp. (brain)		SRR042465(GSM539857)
mouse CD4+ T cells (spleen) [09-002]. (spleen)		SRR059769(GSM562831)
Treg_Drosha. (spleen)		SRR059771(GSM562833)
CD4_control. (spleen)		SRR042446(GSM539838)
mouse mature B cells (spleen) replicate 1 [09-002]. (b cell)		SRR065058(SRR065058)
Tissue-specific Regulation of Mouse MicroRNA . (pancreas)		SRR029037(GSM433289)
18dpp_homo_tdrd6-KO. (tdrd6 testes)		SRR306542(GSM750585)
19-24nt. (ago2 brain)		SRR391852(GSM852147)
gender: femalegenotype/variation: ADAR2-/-tis. (embryo)		RuiDGCR8KO(Rui)
DGCR8-dependent microRNA biogenesis is essent. (dgcr8 skin)		SRR306541(GSM750584)
19-24nt. (ago2 brain)		GSM475280(GSM475280)
Mili-IP. (mili testes)		SRR402762(SRX117945)
source: ES E14 male cells. (ESC)		Ago3IP812(Rui)
Quantitative functions of Argonaute proteins . (ago3 skin)		GSM510444(GSM510444)
brain_rep5. (brain)		SRR346420(SRX098261)
Global profiling of miRNA and the hairpin pre. (Uterus)		Ago1IP517(Rui)
Quantitative functions of Argonaute proteins . (ago1 skin)		SRR037912(GSM510449)
newborn_rep5. (total RNA)		SRR042483(GSM539875)
mouse muscle tissue [09-002]. (muscle)		SRR306530(GSM750573)
19-24nt. (ago2 brain)		SRR306536(GSM750579)
19-24nt. (ago2 brain)		SRR042456(GSM539848)
mouse hematopoetic progenitor cells [09-002]. (bone marrow)		SRR390299(GSM849857)
cell line: NIH-3T3cell type: fibroblastip ant. (ago2 fibroblast)		SRR077864(GSM637801)
18-30 nt small RNAs. (liver)		SRR345199(SRX097260)
source: size fractionated RNA from mouse hipp. (brain)		SRR391845(GSM852140)
gender: femalegenotype/variation: wild typeti. (embryo)		SRR060845(GSM561991)
total RNA. (brain)		SRR042459(GSM539851)
mouse neutrophil cells replicate 1 [09-002]. (blood)		SRR206942(GSM723283)
other. (brain)		SRR306529(GSM750572)
19-24nt. (ago2 brain)		SRR037920(GSM510458)
e12p5_rep2. (embryo)		SRR037905(GSM510441)
brain_rep2. (brain)		SRR345201(SRX097262)
source: size fractionated RNA from mouse hipp. (brain)		GSM510455(GSM510455)
newborn_rep11. (total RNA)		SRR306532(GSM750575)
19-24nt. (ago2 brain)		mjTestesKO8()
Testes Data. (Zcchc11 testes)		SRR525240(SRA056111/SRX170316)
Mus musculus domesticus miRNA sequencing. (ago1 Blood)		SRR346413(SRX098254)
Global profiling of miRNA and the hairpin pre. (Heart)		GSM640578(GSM640578)
small RNA in the liver with paternal control. (liver)		SRR042473(GSM539865)
mouse nTreg cells [09-002]. (lymph)		SRR042453(GSM539845)
mouse marginal zone B cells (spleen) [09-002]. (b cell)		SRR095853(SRX039174)
sequencing of miRNA from wild type and diseas. (heart)		GSM510453(GSM510453)
newborn_rep9. (total RNA)		SRR042455(GSM539847)
mouse plasma cells [09-002]. (blood)		SRR037897(GSM510433)
ovary_rep2. (ovary)		SRR248524(GSM733812)
cell type: Thy1+ spermatogonial stem cellstra. (testes)		SRR029038(GSM433290)
25dpp_hetero_tdrd6-KO. (tdrd6 testes)		SRR248527(GSM733815)
cell type: spermatogonial stem cell enriched . (testes)		mjTestesKO7()
Testes Data. (Zcchc11 testes)		GSM416732(GSM416732)
MEF. (cell line)		SRR306537(GSM750580)
19-24nt. (ago2 brain)		SRR042454(GSM539846)
mouse germinal center B cells (lymph node) [09-002]. (b cell)		SRR525243(SRA056111/SRX170319)
Mus musculus domesticus miRNA sequencing. (ago2 Blood)		SRR032476(GSM485234)
sRNA_delayed_deep_sequencing. (uterus)		SRR402761(SRX117944)
source: ES E14 male cells. (ESC)		SRR029036(GSM433288)
18dpp_hetero_tdrd6-KO. (tdrd6 testes)		SRR248525(GSM733813)
cell type: Thy1- spermatogonial stem cellstra. (testes)		SRR077866(GSM637803)
18-30 nt small RNAs. (liver)		SRR037934(GSM510472)
293cand4_rep3. (cell line)		mjTestesWT3()
Testes Data. (testes)		Ago2IP517(Rui)
Quantitative functions of Argonaute proteins . (ago2 skin)		SRR042467(GSM539859)
mouse T cells activated in vitro with Concanavalin A [09-002]. (spleen)		SRR345207(SRX097268)
source: size fractionated RNA from mouse hipp. (brain)		SRR029123(GSM416611)
NIH3T3. (cell line)		SRR306534(GSM750577)
19-24nt. (ago2 brain)		SRR306538(GSM750581)
19-24nt. (ago2 brain)		SRR029043(GSM433295)
18.5dpc_homo_tdrd1-KO. (tdrd1 testes)		GSM475279(GSM475279)
Miwi-IP. (miwi testes)		SRR391850(GSM852145)
gender: femalegenotype/variation: ADAR2-/-/AD. (embryo)		SRR069809(GSM610965)
small RNA sequencing; sample 1. (testes)		SRR553604(SRX182810)
source: Spermatocytes. (Spermatocytes)		Ago2IP504(Rui)
Quantitative functions of Argonaute proteins . (ago2 skin)		SRR279903(GSM689053)
cell type: mouse embryonic stem cellcell line. (ESC)		mjTestesKO5()
Testes Data. (Zcchc11 testes)		SRR037944(GSM510482)
293DcrTN_cand5. (cell line)		SRR553585(SRX182791)
source: Kidney. (Kidney)		SRR095855BC8(SRX039178)
sequencing of miRNA from wild type and diseas. (heart)		SRR073955(GSM629281)
total RNA. (blood)		SRR042444(GSM539836)
mouse pre B cells [09-002]. (b cell)		SRR034120(GSM466730)
Mili IP_Tdrd9-/- replicate1. (mili testes)		SRR345196(SRX097257)
source: size fractionated RNA from mouse hipp. (brain)		GSM317183(GSM317183)
Ago-1 IP small RNAs from mouse brain. (ago1 brain)		SRR037914(GSM510451)
newborn_rep7. (total RNA)		SRR042450(GSM539842)
mouse B cells activated in vitro with LPS/IL4 replicate 3 [09-002]. (b cell)		SRR345205(SRX097266)
source: size fractionated RNA from mouse hipp. (brain)
........................................................................................................................................................................CCTCTGCTTCTTCTCAAGCT............................................... 203.000.00-------3.00--------------------------------------------------------------------------------------------------------------------------------------
............................................................................................................................................................GACTCATCACAGCCTG............................................................... 162.000.00-------1.00---------------------------------------------------------------------------------------------------------------1.00----------------------
............................................................................................................................................................GACTCATCACAGCCTGCA............................................................. 182.000.00-------2.00--------------------------------------------------------------------------------------------------------------------------------------
.........................................................................................................................................................................CTCTGCTTCTTCTCATGGG............................................... 191.000.00-------1.00--------------------------------------------------------------------------------------------------------------------------------------
.........................................................................................................................................................................CTCTGCTTCTTCTCATAGC............................................... 191.000.00------------------------------------------1.00---------------------------------------------------------------------------------------------------
.........................................................................................................................................................................CTCTGCTTCTTCTCATGGC............................................... 191.000.00-------1.00--------------------------------------------------------------------------------------------------------------------------------------
...........................................................................................................................................................AGACTCATCACAGCCT................................................................ 1630.670.67------------------------------------------0.33--------------------------------------0.33------------------------------------------------------------
...........................................................................................................................................................AGACTCATCACAGCCTCGA............................................................. 190.330.00------------------------------------------0.33---------------------------------------------------------------------------------------------------