ID: mmu-mir-6965
GENE: Ccnf(10)
chr17:24377779-24378028-


(1)
AGO.mut 		(1)
AGO1.ip 		(6)
AGO2.ip 		(1)
AGO3.ip 		(6)
B-CELL 		(11)
BRAIN 		(5)
CELL-LINE 		(1)
DCR.mut 		(11)
EMBRYO 		(12)
ESC 		(5)
FIBROBLAST 		(4)
LIVER 		(2)
LYMPH 		(10)
OTHER 		(5)
OTHER.mut 		(1)
PIWI.ip 		(2)
SKIN 		(7)
SPLEEN 		(13)
TESTES 		(3)
THYMUS 		(1)
TOTAL-RNA 		(1)
UTERUS

Sense strand
GCCACCGTCCGTGCTGCTTAGAGCAGAGCCCCGAGGCCAGGCTCCCTATTGGTCAGTTACCGAGCACTGGCTGCTTCTCAGCCTCATTTCTGCCGTGATCAGTCAGCACTGTGTACGACTGCTTGAGGGTCTAGGAGCGGGAGAGGGAGGCTATTGGGCAGGAGATGAGGAAGAACCTTCTGTGCTCGGTCTCGCTCCAGGACGAAGAGAAAAGGAAGCAGGCGCGTAGCCTTTTGGAAGAGTCTTCTCG
...........................................................................................................................................((((...((((((...(((((..(((..(((.....)))))).))))))))))).))))....................................................
........................................................................................................................................137............................................................200................................................
SizePerfect hitTotal NormPerfect NormSRR546155(SRX180174)
Global profiling of miRNA and the hairpin pre. (ago2 Neuroblastoma)		SRR402762(SRX117945)
source: ES E14 male cells. (ESC)		SRR402760(SRX117943)
source: ES E14 male cells. (ESC)		SRR685340(GSM1079784)
Small RNAs (15-50 nts in length) from immorta. (dicer cell line)		SRR279907(GSM689057)
cell type: mouse embryonic stem cellcell line. (ESC)		GSM314557(GSM314557)
ESC dgcr8 (Illumina). (ESC)		SRR390300(GSM849858)
cell line: NIH-3T3cell type: fibroblastinfect. (ago2 fibroblast)		mjLiverKO1()
Liver Data. (Zcchc11 liver)		SRR391853(GSM852148)
gender: femalegenotype/variation: ADAR2-/-/AD. (embryo)		SRR553602(SRX182808)
source: Sertoli cells. (Sertoli cells)		SRR279904(GSM689054)
cell type: mouse embryonic stem cellcell line. (ESC)		mjLiverWT3()
Liver Data. (liver)		SRR391848(GSM852143)
gender: femalegenotype/variation: wild typeti. (embryo)		SRR040489(GSM533912)
E18.5 Ago2 catalytically inactive LIVER small RNA. (ago2 liver)		SRR346424(SRX098266)
Global profiling of miRNA and the hairpin pre. (Neuroblastoma)		SRR042469(GSM539861)
mouse Th2 cells [09-002]. (lymph)		SRR248526(GSM733814)
cell type: Thy1- spermatogonial stem cellstra. (testes)		SRR042471(GSM539863)
mouse TFHS cells [09-002]. (spleen)		SRR059769(GSM562831)
Treg_Drosha. (spleen)		SRR042468(GSM539860)
mouse Th1 cells [09-002]. (lymph)		SRR391850(GSM852145)
gender: femalegenotype/variation: ADAR2-/-/AD. (embryo)		SRR039183(GSM485323)
shLuc.1309 (-dox). (fibroblast)		SRR040488(GSM533911)
E18.5 wild type LIVER small RNA. (liver)		SRR402766(SRX117949)
source: ES PGK female cells. (ESC)		Ago3IP805(Rui)
Quantitative functions of Argonaute proteins . (ago3 skin)		SRR402761(SRX117944)
source: ES E14 male cells. (ESC)		SRR391852(GSM852147)
gender: femalegenotype/variation: ADAR2-/-tis. (embryo)		SRR059775(GSM562837)
MEF_Drosha. (MEF)		SRR279903(GSM689053)
cell type: mouse embryonic stem cellcell line. (ESC)		SRR037921(GSM510459)
e12p5_rep3. (embryo)		GSM519104(GSM519104)
mouse_granulocyte_nuclei_smallRNAs. (cell line)		SRR248524(GSM733812)
cell type: Thy1+ spermatogonial stem cellstra. (testes)		SRR391846(GSM852141)
gender: femalegenotype/variation: ADAR2-/-tis. (embryo)		SRR346425(SRX098267)
Global profiling of miRNA and the hairpin pre. (Neuroblastoma)		SRR039185(GSM485325)
shLuc.1309;ROSA-rtTA (-dox). (fibroblast)		SRR042464(GSM539856)
mouse CD4+CD8+ T cells (thymus) [09-002]. (thymus)		SRR345201(SRX097262)
source: size fractionated RNA from mouse hipp. (brain)		mjTestesKO8()
Testes Data. (Zcchc11 testes)		SRR279905(GSM689055)
cell type: mouse embryonic stem cellcell line. (ESC)		SRR039186(GSM485326)
shLuc.1309;ROSA-rtTA (+dox). (fibroblast)		GSM314552(GSM314552)
ESC wild type (Illumina). (ESC)		mjTestesWT3()
Testes Data. (testes)		SRR042467(GSM539859)
mouse T cells activated in vitro with Concanavalin A [09-002]. (spleen)		SRR306541(GSM750584)
19-24nt. (ago2 brain)		SRR039610(GSM527274)
small RNA-Seq. (brain)		SRR345200(SRX097261)
source: size fractionated RNA from mouse hipp. (brain)		SRR029037(GSM433289)
18dpp_homo_tdrd6-KO. (tdrd6 testes)		SRR248523(GSM733811)
cell type: Thy1+ spermatogonial stem cellstra. (testes)		SRR029042(GSM433294)
18.5dpc_hetero_tdrd1-KO. (tdrd1 testes)		SRR032476(GSM485234)
sRNA_delayed_deep_sequencing. (uterus)		SRR073955(GSM629281)
total RNA. (blood)		GSM510456(GSM510456)
newborn_rep12. (total RNA)		SRR042487(GSM539879)
mouse BclXL B activated with LPS/IL4 [BalbC] [09-002]. (spleen)		SRR346423(SRX098265)
Global profiling of miRNA and the hairpin pre. (Brain)		GSM361415(GSM361415)
WholeCerebellum_P6_p53--_Ink4c--_rep4. (brain)		SRR248525(GSM733813)
cell type: Thy1- spermatogonial stem cellstra. (testes)		SRR042449(GSM539841)
mouse B cells activated in vitro with LPS/IL4 replicate 2 [09-002]. (b cell)		SRR685339(GSM1079783)
Small RNAs (15-50 nts in length) from immorta. (cell line)		SRR042458(GSM539850)
mouse basophil cells [09-002]. (b cell)		SRR037929(GSM510467)
e7p5_rep3. (embryo)		SRR345196(SRX097257)
source: size fractionated RNA from mouse hipp. (brain)		SRR391845(GSM852140)
gender: femalegenotype/variation: wild typeti. (embryo)		SRR248527(GSM733815)
cell type: spermatogonial stem cell enriched . (testes)		GSM361407(GSM361407)
CGNP_P6_Ptc+-_Ink4c--_rep5. (brain)		SRR042465(GSM539857)
mouse CD4+ T cells (spleen) [09-002]. (spleen)		SRR014231(GSM319955)
16.5 dpc total. (testes)		SRR306544(GSM750587)
19-24nt. (ago2 brain)		mjTestesWT2()
Testes Data. (testes)		SRR059771(GSM562833)
CD4_control. (spleen)		SRR034121(GSM466731)
Mili IP_Tdrd9-/- replicate2. (mili testes)		SRR039184(GSM485324)
shLuc.1309 (+dox). (fibroblast)		mjTestesKO7()
Testes Data. (Zcchc11 testes)		SRR037927(GSM510465)
e7p5_rep1. (embryo)		SRR042445(GSM539837)
mouse immature B cells [09-002]. (b cell)		SRR306532(GSM750575)
19-24nt. (ago2 brain)		SRR042474(GSM539866)
mouse embryonic stem cells [09-002]. (ESC)		SRR306539(GSM750582)
19-24nt. (ago2 brain)		SRR042450(GSM539842)
mouse B cells activated in vitro with LPS/IL4 replicate 3 [09-002]. (b cell)		SRR042466(GSM539858)
mouse CD8+ T cells (spleen) [09-002]. (spleen)		SRR042488(GSM539880)
mouse BclXL germinal center B cells [BalbC] [09-002]. (B cell)		SRR059767(GSM562829)
DN3_Dicer. (thymus)		SRR059766(GSM562828)
DN3_Drosha. (thymus)		Ago1IP812(Rui)
Quantitative functions of Argonaute proteins . (ago1 skin)		SRR391851(GSM852146)
gender: femalegenotype/variation: wild typeti. (embryo)		SRR116846(GSM678422)
Small RNA deep sequencing from mouse epididym. (epididymis)		SRR023852(GSM307161)
ZHBT-c424hsmallrna_rep1. (cell line)		SRR039152(GSM471929)
HL1_siNon_smallRNAseq. (muscle)		SRR042448(GSM539840)
mouse B cells activated in vitro with LPS/IL4 replicate 1 [09-002]. (b cell)		SRR279906(GSM689056)
cell type: mouse embryonic stem cellcell line. (ESC)		SRR065055(SRR065055)
Tissue-specific Regulation of Mouse MicroRNA . (jejunum)		SRR391849(GSM852144)
gender: femalegenotype/variation: ADAR2-/-tis. (embryo)		SRR023847(GSM307156)
mESv6.5smallrna_rep1. (cell line)		GSM261957(GSM261957)
oocytesmallRNA-19to24. (oocyte)
..................................................................................................................................................................................TCTGTGCTCGGTCTCGCTCCAG..................................................22144.0044.0014.003.003.00--1.00---1.00--1.001.00--1.00---1.00---1.001.001.00-1.00-----1.001.00-2.00-1.00--2.00------1.00---1.00-1.00----------1.00------1.00----------------1.001.00-
..................................................................................................................................................................................TCTGTGCTCGGTCTCGCTCCAGT.................................................23131.0044.00-5.002.00--1.005.005.00----2.002.00-----1.00---------1.00-----1.00----------1.00-1.00------------------1.00--------1.00----------1.00-1.00---
....................................................................................................................................................................................TGTGCTCGGTCTCGCTCCAGT.................................................21118.005.00--5.00---1.00------1.00----2.00--2.001.00----1.001.00-----1.00----1.00---------------------1.00-------------1.00-----------------
..................................................................................................................................................................................TCTGTGCTCGGTCTCGCTCCAGTA................................................24110.0044.00----4.00---------2.00-1.00------------------------2.00------------------------------------------1.00--------
...................................................................................................................................................................................CTGTGCTCGGTCTCGCTCCAG..................................................2119.009.006.00----1.00--------------------------------------1.00---------------------------------1.00--------------
..................................................................................................................................................................................TCTGTGCTCGGTCTCGCTCCA...................................................2118.008.00-2.00-------------2.00-------2.00--------------------------------------------------1.00-----------------1.00
...................................................................................................................................................................................CTGTGCTCGGTCTCGCTCCAGT.................................................2218.009.00-----1.00---------------1.00-----1.00------------1.00-----------1.00---------------1.00-------------1.001.00---------
.............................................................................................................................................................................AACCTTCTGTGCTCGGTCTCGCTCCAG..................................................2717.007.00---7.00-----------------------------------------------------------------------------------------
..................................................................................................................................................................................TCTGTGCTCGGTCTCGCTCCAGA.................................................2317.0044.001.00-------1.002.00----1.00-1.00-------------1.00--------------------------------------------------------------
...................................................................................................................................................................................CTGTGCTCGGTCTCGCTCCAGA.................................................2215.009.00-----------4.00--------------------------------------------1.00------------------------------------
....................................................................................................................................................................................TGTGCTCGGTCTCGCTCCAG..................................................2015.005.003.00-------------------1.00-----------------1.00------------------------------------------------------
......................................................................................................................................................................................................AGGACGAAGAGAAAAGGAAGCAGGC...........................2514.004.00----4.00----------------------------------------------------------------------------------------
....................................................................................................................................................................................TGTGCTCGGTCTCGCTCCAGA.................................................2113.005.00--------1.00-----------------------------------1.00------1.00-----------------------------------------
..................................................................................................................................................................................TCTGTGCTCGGTCTCGCTCCATT.................................................2313.008.00---------1.00-------1.001.00--------------------------------------------------------------------------
.............................................................................................................................................AGAGGGAGGCTATTGGGCAGGAGA.....................................................................................2413.003.00-1.00---1.00----1.00----------------------------------------------------------------------------------
..................................................................................................................................................................................TCTGTGCTCGGTCTCGCTCCAT..................................................2213.008.00-----------------1.00-------------------------------------------------------------1.001.00------------
...................................................................................................................................................................................................................AAGGAAGCAGGCGCGCAA.....................183.000.00-------------------------------------------1.00-------------------------------------1.00----1.00------
.................................................................................................................................................................................TTCTGTGCTCGGTCTCGCTCCAG..................................................2312.002.00--------------------------------------1.00-------------------------------------------------1.00----
..................................................................................................................................................................................TCTGTGCTCGGTCTCGCTCCAGTAT...............................................2512.0044.00----------------------1.00-------------------------------------------------1.00--------------------
..........................................................ACCGAGCACTGGCTGCTTCTCAGCCTC.....................................................................................................................................................................2712.002.00--------2.00------------------------------------------------------------------------------------
.................................................................................................................................................................GAGATGAGGAAGAACCTTCTGTGCT................................................................2512.002.00----------2.00----------------------------------------------------------------------------------
..................................................................................................................................................................................TCTGTGCTCGGTCTCGCTCC....................................................2012.002.00----------1.00----------------------1.00-----------------------------------------------------------
...................................................................................................................................................................................................................AAGGAAGCAGGCGCGCAAA....................192.000.00--------------------1.00----------------------1.00-------------------------------------------------
..........................................................................................................................................................................................................CGAAGAGAAAAGGAAGCAGGCGCGTA......................2612.002.00-------------------------------1.00-------------------------------------1.00-----------------------
..........................................................................................................................................................................................................CGAAGAGAAAAGGAAGCAGGCGCGTAG.....................2711.001.00--------------------------------------------------------------1.00------------------------------
.............................................................................................................................................AGAGGGAGGCTATTGGGCAGGAG......................................................................................2311.001.00---------------------------------------------------------1.00-----------------------------------
.............................................................................................................................................AGAGGGAGGCTATTGGGCAT.........................................................................................201.000.00----------------------------------------------------------1.00----------------------------------
.............................................................................................................................................AGAGGGAGGCTATTGGGCAG.........................................................................................2011.001.00-------------------1.00-------------------------------------------------------------------------
......................................................................................................................................................................................................AGGACGAAGAGAAAAGGAAGCA..............................2211.001.00-------------------------------1.00-------------------------------------------------------------
................................................................................................................................................................................................................GAAAAGGAAGCAGGCGCGTAGCCTTT................2611.001.00-----------------------------------------------------------------1.00---------------------------
...................................................................................................................................................................................CTGTGCTCGGTCTCGCTCCAGTAG...............................................2411.009.001.00--------------------------------------------------------------------------------------------
......................................................................................................................CTGCTTGAGGGTCTAGGAGC................................................................................................................2011.001.00--------------------------------------------------1.00------------------------------------------
.............................................................................................................................................................................AACCTTCTGTGCTCGGTCTCGCTCAAG..................................................271.000.00---1.00-----------------------------------------------------------------------------------------
....................................................................................................................................................................................TGTGCTCGGTCTCGCTCCAGATT...............................................2311.005.00------------------------------1.00--------------------------------------------------------------
..................................................................................................................................................................................TCTGTGCTCGGTCTCGCTCCAAA.................................................2311.008.00----------------------------------------------------------------1.00----------------------------
..................................................................................................................................................................................TCTGTGCTCGGTCTCGCTCCAGTAA...............................................2511.0044.00-------------------------1.00-------------------------------------------------------------------
..........................................................................................................................................................................................................CGAAGAGAAAAGGAAGC...............................1711.001.00-----1.00---------------------------------------------------------------------------------------
...................................................................................................................................................................................................................................AGCCTTTTGGAAGAGTCTTCTC.2211.001.00--------------------------------1.00------------------------------------------------------------
..................................................................................................................................................................................TCTGTGCTCGGTCTCGCTCCAGTAG...............................................2511.0044.001.00--------------------------------------------------------------------------------------------
............................................................................................................................................GAGAGGGAGGCTATTGGGCAGGAGATGAGGA...............................................................................3111.001.00---1.00-----------------------------------------------------------------------------------------
............................................................................................................................................GAGAGGGAGGCTATTGGGCAGC........................................................................................221.000.00------------------------1.00--------------------------------------------------------------------
...................................................................................................................................................................................CTGTGCTCGGTCTCGCTCCAGTA................................................2311.009.00---------------1.00-----------------------------------------------------------------------------
......................................................................................................................................................................................TGCTCGGTCTCGCTCCAGT.................................................191.000.00-----------------------------1.00---------------------------------------------------------------
.....................................................................................................................................................................TGAGGAAGAACCTTCTGTCGT................................................................211.000.00------------------------------------1.00--------------------------------------------------------
............................................................................................................................................................................................................AAGAGAAAAGGAAGCAAGCA..........................201.000.00---------------------------------------------1.00-----------------------------------------------
.................................................................................................................................................................................................................AAAAGGAAGCAGGCGCGCAA.....................201.000.00--------------------------------1.00------------------------------------------------------------
..................................................................................................................................................................................TCTGTGCTCGGTCTCGC.......................................................1711.001.00-----1.00---------------------------------------------------------------------------------------
..............................................................................................................GTGTACGACTGCTTGAGGGT........................................................................................................................2011.001.00--------1.00------------------------------------------------------------------------------------
......................................................................................................................................................................................................AGGACGAAGAGAAAAGGAAG................................2011.001.00-----------------------------------------------------------------------------1.00---------------
..................................................................................................................................................................................TCTGTGCTCGGTCTCGCTCCAGATT...............................................2511.0044.00----------------------------------------------------------------------1.00----------------------
......................................................................................................................................................................................................AGGACGAAGAGAAAAGGAA.................................1911.001.00---------------------------------1.00-----------------------------------------------------------
...........................................................................................GCCGTGATCAGTCAGCACTGT..........................................................................................................................................2111.001.00--------------------------1.00------------------------------------------------------------------
..................................................................................................................................................................................TCTGTGCTCGGTCTCGCTCCAAAA................................................2411.008.00---------1.00-----------------------------------------------------------------------------------
..............................CCGAGGCCAGGCTCCCTATTG.......................................................................................................................................................................................................2111.001.00-----1.00---------------------------------------------------------------------------------------
.................................................................................................................................................................................TTCTGTGCTCGGTCTCGCT......................................................1911.001.00-----------------------------------------------------------------------1.00---------------------
..................................................................................................................................................................................TCTGTGCTCGGTCTCGCTCCAGAA................................................2411.0044.00-----------------1.00---------------------------------------------------------------------------
....................................................................................................................................AGGAGCGGGAGAGGGATG....................................................................................................181.000.00------------------------------------------------------------1.00--------------------------------
...................................................................................................................................................................................CTGTGCTCGGTCTCGCTCC....................................................1911.001.001.00--------------------------------------------------------------------------------------------
.............................................................................................................................................AGAGGGAGGCTATTGGGCAGGATAA....................................................................................251.000.00-------------------1.00-------------------------------------------------------------------------
....................................................................................................................................................................................TGTGCTCGGTCTCGCTCAAGT.................................................211.000.00-------------------------------------------------------------------------------------1.00-------
..................................................................................................................................................................................TCTGTGCTCGGTCTCGCTC.....................................................1911.001.00------------1.00--------------------------------------------------------------------------------
......................................................................................................................................................................................................AGGACGAAGAGAAAAGGAAGCAGG............................2411.001.00-----------------------------------------------1.00---------------------------------------------
......GTCCGTGCTGCTTAGAGCAGA...............................................................................................................................................................................................................................2111.001.00----------------------------------------1.00----------------------------------------------------
....................................................................................................................................................................................................................AGGAAGCAGGCGCGTAG.....................1720.500.50----0.50----------------------------------------------------------------------------------------
......................................................................................................................................................................................................AGGACGAAGAGAAAAGG...................................1720.500.50--------------0.50------------------------------------------------------------------------------
.............................................................................................................................................................GCAGGAGATGAGGAAGAA...........................................................................1840.250.25---------------------------------------------0.25-----------------------------------------------

Antisense strand
GCCACCGTCCGTGCTGCTTAGAGCAGAGCCCCGAGGCCAGGCTCCCTATTGGTCAGTTACCGAGCACTGGCTGCTTCTCAGCCTCATTTCTGCCGTGATCAGTCAGCACTGTGTACGACTGCTTGAGGGTCTAGGAGCGGGAGAGGGAGGCTATTGGGCAGGAGATGAGGAAGAACCTTCTGTGCTCGGTCTCGCTCCAGGACGAAGAGAAAAGGAAGCAGGCGCGTAGCCTTTTGGAAGAGTCTTCTCG
...........................................................................................................................................((((...((((((...(((((..(((..(((.....)))))).))))))))))).))))....................................................
........................................................................................................................................137............................................................200................................................
SizePerfect hitTotal NormPerfect NormSRR546155(SRX180174)
Global profiling of miRNA and the hairpin pre. (ago2 Neuroblastoma)		SRR402762(SRX117945)
source: ES E14 male cells. (ESC)		SRR402760(SRX117943)
source: ES E14 male cells. (ESC)		SRR685340(GSM1079784)
Small RNAs (15-50 nts in length) from immorta. (dicer cell line)		SRR279907(GSM689057)
cell type: mouse embryonic stem cellcell line. (ESC)		GSM314557(GSM314557)
ESC dgcr8 (Illumina). (ESC)		SRR390300(GSM849858)
cell line: NIH-3T3cell type: fibroblastinfect. (ago2 fibroblast)		mjLiverKO1()
Liver Data. (Zcchc11 liver)		SRR391853(GSM852148)
gender: femalegenotype/variation: ADAR2-/-/AD. (embryo)		SRR553602(SRX182808)
source: Sertoli cells. (Sertoli cells)		SRR279904(GSM689054)
cell type: mouse embryonic stem cellcell line. (ESC)		mjLiverWT3()
Liver Data. (liver)		SRR391848(GSM852143)
gender: femalegenotype/variation: wild typeti. (embryo)		SRR040489(GSM533912)
E18.5 Ago2 catalytically inactive LIVER small RNA. (ago2 liver)		SRR346424(SRX098266)
Global profiling of miRNA and the hairpin pre. (Neuroblastoma)		SRR042469(GSM539861)
mouse Th2 cells [09-002]. (lymph)		SRR248526(GSM733814)
cell type: Thy1- spermatogonial stem cellstra. (testes)		SRR042471(GSM539863)
mouse TFHS cells [09-002]. (spleen)		SRR059769(GSM562831)
Treg_Drosha. (spleen)		SRR042468(GSM539860)
mouse Th1 cells [09-002]. (lymph)		SRR391850(GSM852145)
gender: femalegenotype/variation: ADAR2-/-/AD. (embryo)		SRR039183(GSM485323)
shLuc.1309 (-dox). (fibroblast)		SRR040488(GSM533911)
E18.5 wild type LIVER small RNA. (liver)		SRR402766(SRX117949)
source: ES PGK female cells. (ESC)		Ago3IP805(Rui)
Quantitative functions of Argonaute proteins . (ago3 skin)		SRR402761(SRX117944)
source: ES E14 male cells. (ESC)		SRR391852(GSM852147)
gender: femalegenotype/variation: ADAR2-/-tis. (embryo)		SRR059775(GSM562837)
MEF_Drosha. (MEF)		SRR279903(GSM689053)
cell type: mouse embryonic stem cellcell line. (ESC)		SRR037921(GSM510459)
e12p5_rep3. (embryo)		GSM519104(GSM519104)
mouse_granulocyte_nuclei_smallRNAs. (cell line)		SRR248524(GSM733812)
cell type: Thy1+ spermatogonial stem cellstra. (testes)		SRR391846(GSM852141)
gender: femalegenotype/variation: ADAR2-/-tis. (embryo)		SRR346425(SRX098267)
Global profiling of miRNA and the hairpin pre. (Neuroblastoma)		SRR039185(GSM485325)
shLuc.1309;ROSA-rtTA (-dox). (fibroblast)		SRR042464(GSM539856)
mouse CD4+CD8+ T cells (thymus) [09-002]. (thymus)		SRR345201(SRX097262)
source: size fractionated RNA from mouse hipp. (brain)		mjTestesKO8()
Testes Data. (Zcchc11 testes)		SRR279905(GSM689055)
cell type: mouse embryonic stem cellcell line. (ESC)		SRR039186(GSM485326)
shLuc.1309;ROSA-rtTA (+dox). (fibroblast)		GSM314552(GSM314552)
ESC wild type (Illumina). (ESC)		mjTestesWT3()
Testes Data. (testes)		SRR042467(GSM539859)
mouse T cells activated in vitro with Concanavalin A [09-002]. (spleen)		SRR306541(GSM750584)
19-24nt. (ago2 brain)		SRR039610(GSM527274)
small RNA-Seq. (brain)		SRR345200(SRX097261)
source: size fractionated RNA from mouse hipp. (brain)		SRR029037(GSM433289)
18dpp_homo_tdrd6-KO. (tdrd6 testes)		SRR248523(GSM733811)
cell type: Thy1+ spermatogonial stem cellstra. (testes)		SRR029042(GSM433294)
18.5dpc_hetero_tdrd1-KO. (tdrd1 testes)		SRR032476(GSM485234)
sRNA_delayed_deep_sequencing. (uterus)		SRR073955(GSM629281)
total RNA. (blood)		GSM510456(GSM510456)
newborn_rep12. (total RNA)		SRR042487(GSM539879)
mouse BclXL B activated with LPS/IL4 [BalbC] [09-002]. (spleen)		SRR346423(SRX098265)
Global profiling of miRNA and the hairpin pre. (Brain)		GSM361415(GSM361415)
WholeCerebellum_P6_p53--_Ink4c--_rep4. (brain)		SRR248525(GSM733813)
cell type: Thy1- spermatogonial stem cellstra. (testes)		SRR042449(GSM539841)
mouse B cells activated in vitro with LPS/IL4 replicate 2 [09-002]. (b cell)		SRR685339(GSM1079783)
Small RNAs (15-50 nts in length) from immorta. (cell line)		SRR042458(GSM539850)
mouse basophil cells [09-002]. (b cell)		SRR037929(GSM510467)
e7p5_rep3. (embryo)		SRR345196(SRX097257)
source: size fractionated RNA from mouse hipp. (brain)		SRR391845(GSM852140)
gender: femalegenotype/variation: wild typeti. (embryo)		SRR248527(GSM733815)
cell type: spermatogonial stem cell enriched . (testes)		GSM361407(GSM361407)
CGNP_P6_Ptc+-_Ink4c--_rep5. (brain)		SRR042465(GSM539857)
mouse CD4+ T cells (spleen) [09-002]. (spleen)		SRR014231(GSM319955)
16.5 dpc total. (testes)		SRR306544(GSM750587)
19-24nt. (ago2 brain)		mjTestesWT2()
Testes Data. (testes)		SRR059771(GSM562833)
CD4_control. (spleen)		SRR034121(GSM466731)
Mili IP_Tdrd9-/- replicate2. (mili testes)		SRR039184(GSM485324)
shLuc.1309 (+dox). (fibroblast)		mjTestesKO7()
Testes Data. (Zcchc11 testes)		SRR037927(GSM510465)
e7p5_rep1. (embryo)		SRR042445(GSM539837)
mouse immature B cells [09-002]. (b cell)		SRR306532(GSM750575)
19-24nt. (ago2 brain)		SRR042474(GSM539866)
mouse embryonic stem cells [09-002]. (ESC)		SRR306539(GSM750582)
19-24nt. (ago2 brain)		SRR042450(GSM539842)
mouse B cells activated in vitro with LPS/IL4 replicate 3 [09-002]. (b cell)		SRR042466(GSM539858)
mouse CD8+ T cells (spleen) [09-002]. (spleen)		SRR042488(GSM539880)
mouse BclXL germinal center B cells [BalbC] [09-002]. (B cell)		SRR059767(GSM562829)
DN3_Dicer. (thymus)		SRR059766(GSM562828)
DN3_Drosha. (thymus)		Ago1IP812(Rui)
Quantitative functions of Argonaute proteins . (ago1 skin)		SRR391851(GSM852146)
gender: femalegenotype/variation: wild typeti. (embryo)		SRR116846(GSM678422)
Small RNA deep sequencing from mouse epididym. (epididymis)		SRR023852(GSM307161)
ZHBT-c424hsmallrna_rep1. (cell line)		SRR039152(GSM471929)
HL1_siNon_smallRNAseq. (muscle)		SRR042448(GSM539840)
mouse B cells activated in vitro with LPS/IL4 replicate 1 [09-002]. (b cell)		SRR279906(GSM689056)
cell type: mouse embryonic stem cellcell line. (ESC)		SRR065055(SRR065055)
Tissue-specific Regulation of Mouse MicroRNA . (jejunum)		SRR391849(GSM852144)
gender: femalegenotype/variation: ADAR2-/-tis. (embryo)		SRR023847(GSM307156)
mESv6.5smallrna_rep1. (cell line)		GSM261957(GSM261957)
oocytesmallRNA-19to24. (oocyte)
.....................................................................................................................................................................................GTGCTCGGTCTCGCTCCAGCGC............................................... 222.000.00------------------------------------------------------1.00--------1.00-----------------------------
............................................................................................CCGTGATCAGTCAGCAAG............................................................................................................................................ 181.000.00------------------------------------1.00--------------------------------------------------------
..................................................................................................................................CTAGGAGCGGGAGAGGGAT..................................................................................................... 191.000.00-----------------------------------------------------------1.00---------------------------------
..............................................................................................................................................................................................................................CGCGTAGCCTTT................ 1270.140.14---------------------------------------------0.14-----------------------------------------------