ID: mmu-mir-6958
GENE: Fam116b(13)
chr15:89015845-89016017-


(1)
AGO.mut 		(3)
AGO1.ip 		(21)
AGO2.ip 		(2)
AGO3.ip 		(8)
B-CELL 		(48)
BRAIN 		(7)
CELL-LINE 		(3)
DCR.mut 		(3)
DGCR8.mut 		(16)
EMBRYO 		(12)
ESC 		(7)
FIBROBLAST 		(4)
HEART 		(7)
LIVER 		(1)
LUNG 		(3)
LYMPH 		(12)
OTHER 		(6)
OTHER.mut 		(3)
PIWI.ip 		(1)
PIWI.mut 		(7)
SKIN 		(4)
SPLEEN 		(11)
TESTES 		(2)
THYMUS 		(6)
TOTAL-RNA 		(1)
UTERUS

Sense strand
GGACCCCAGCTCACCTGCATCCTCAAGGGTGACTGGCTGGGCCTCTACAGGTGGGAGAAGAGGCTGCTGTGGGTGCCCCCAAGTCCGCTAGCTCAGCTCCTCAGCTGCCTCTTGCCATCACAGGCGGTTTTTCAAGTCCCCCCATTTTGATGGCTGGTATCGGCAACGACACA
..................................................(((((..(((((((.((((.(((.((.....(((......)))..))))).)))).))))))).))..)))....................................................
..................................................51......................................................................123................................................
SizePerfect hitTotal NormPerfect NormSRR391853(GSM852148)
gender: femalegenotype/variation: ADAR2-/-/AD. (embryo)		SRR546155(SRX180174)
Global profiling of miRNA and the hairpin pre. (ago2 Neuroblastoma)		SRR391848(GSM852143)
gender: femalegenotype/variation: wild typeti. (embryo)		SRR391852(GSM852147)
gender: femalegenotype/variation: ADAR2-/-tis. (embryo)		SRR391851(GSM852146)
gender: femalegenotype/variation: wild typeti. (embryo)		SRR553583(SRX182789)
source: Cerebellum. (Cerebellum)		GSM314557(GSM314557)
ESC dgcr8 (Illumina). (ESC)		SRR279907(GSM689057)
cell type: mouse embryonic stem cellcell line. (ESC)		SRR038742(GSM527277)
small RNA-Seq. (dgcr8 brain)		SRR306541(GSM750584)
19-24nt. (ago2 brain)		SRR346417(SRX098258)
Global profiling of miRNA and the hairpin pre. (Brain)		SRR038744(GSM527279)
small RNA-Seq. (brain)		SRR391846(GSM852141)
gender: femalegenotype/variation: ADAR2-/-tis. (embryo)		SRR306542(GSM750585)
19-24nt. (ago2 brain)		mjTestesWT1()
Testes Data. (testes)		SRR346424(SRX098266)
Global profiling of miRNA and the hairpin pre. (Neuroblastoma)		SRR038745(GSM527280)
small RNA-Seq. (dgcr8 brain)		GSM510444(GSM510444)
brain_rep5. (brain)		SRR391850(GSM852145)
gender: femalegenotype/variation: ADAR2-/-/AD. (embryo)		SRR346422(SRX098264)
Global profiling of miRNA and the hairpin pre. (Muscle)		SRR037906(GSM510442)
brain_rep3. (brain)		SRR391849(GSM852144)
gender: femalegenotype/variation: ADAR2-/-tis. (embryo)		SRR206941(GSM723282)
other. (brain)		mjLiverKO1()
Liver Data. (Zcchc11 liver)		SRR390297(GSM849855)
cell line: NIH-3T3cell type: fibroblastip ant. (fibroblast)		SRR306535(GSM750578)
19-24nt. (ago2 brain)		SRR391845(GSM852140)
gender: femalegenotype/variation: wild typeti. (embryo)		SRR391847(GSM852142)
gender: femalegenotype/variation: ADAR2-/-/AD. (embryo)		SRR206940(GSM723281)
other. (brain)		SRR553582(SRX182788)
source: Brain. (Brain)		SRR059769(GSM562831)
Treg_Drosha. (spleen)		SRR206939(GSM723280)
other. (brain)		SRR394083(GSM855969)
background strain: C57BL6/SV129cell type: KRa. (cell line)		SRR206942(GSM723283)
other. (brain)		SRR306534(GSM750577)
19-24nt. (ago2 brain)		SRR037921(GSM510459)
e12p5_rep3. (embryo)		SRR346423(SRX098265)
Global profiling of miRNA and the hairpin pre. (Brain)		SRR306537(GSM750580)
19-24nt. (ago2 brain)		SRR402762(SRX117945)
source: ES E14 male cells. (ESC)		SRR306536(GSM750579)
19-24nt. (ago2 brain)		Ago1IP517(Rui)
Quantitative functions of Argonaute proteins . (ago1 skin)		GSM314552(GSM314552)
ESC wild type (Illumina). (ESC)		SRR042471(GSM539863)
mouse TFHS cells [09-002]. (spleen)		SRR306543(GSM750586)
19-24nt. (ago2 brain)		SRR390299(GSM849857)
cell line: NIH-3T3cell type: fibroblastip ant. (ago2 fibroblast)		SRR306531(GSM750574)
19-24nt. (ago2 brain)		SRR390300(GSM849858)
cell line: NIH-3T3cell type: fibroblastinfect. (ago2 fibroblast)		SRR038741(GSM527276)
small RNA-Seq. (brain)		SRR306533(GSM750576)
19-24nt. (ago2 brain)		SRR073954(GSM629280)
total RNA. (blood)		mjLiverWT3()
Liver Data. (liver)		Ago3IP812(Rui)
Quantitative functions of Argonaute proteins . (ago3 skin)		SRR029043(GSM433295)
18.5dpc_homo_tdrd1-KO. (tdrd1 testes)		Ago1IP812(Rui)
Quantitative functions of Argonaute proteins . (ago1 skin)		SRR040489(GSM533912)
E18.5 Ago2 catalytically inactive LIVER small RNA. (ago2 liver)		SRR685339(GSM1079783)
Small RNAs (15-50 nts in length) from immorta. (cell line)		SRR279903(GSM689053)
cell type: mouse embryonic stem cellcell line. (ESC)		GSM510454(GSM510454)
newborn_rep10. (total RNA)		SRR037920(GSM510458)
e12p5_rep2. (embryo)		SRR306532(GSM750575)
19-24nt. (ago2 brain)		SRR042448(GSM539840)
mouse B cells activated in vitro with LPS/IL4 replicate 1 [09-002]. (b cell)		SRR279904(GSM689054)
cell type: mouse embryonic stem cellcell line. (ESC)		SRR042469(GSM539861)
mouse Th2 cells [09-002]. (lymph)		SRR042477(GSM539869)
mouse brain tissue [09-002]. (brain)		SRR039610(GSM527274)
small RNA-Seq. (brain)		SRR345203(SRX097264)
source: size fractionated RNA from mouse hipp. (brain)		SRR402766(SRX117949)
source: ES PGK female cells. (ESC)		SRR346421(SRX098263)
Global profiling of miRNA and the hairpin pre. (mixture)		SRR345201(SRX097262)
source: size fractionated RNA from mouse hipp. (brain)		GSM510455(GSM510455)
newborn_rep11. (total RNA)		SRR095853(SRX039174)
sequencing of miRNA from wild type and diseas. (heart)		SRR394084(GSM855970)
background strain: C57BL6/SV129cell type: KRa. (dicer cell line)		SRR023848(GSM307157)
mEFsmallrna_rep1. (cell line)		SRR039186(GSM485326)
shLuc.1309;ROSA-rtTA (+dox). (fibroblast)		SRR042488(GSM539880)
mouse BclXL germinal center B cells [BalbC] [09-002]. (B cell)		SRR306539(GSM750582)
19-24nt. (ago2 brain)		SRR037923(GSM510461)
e9p5_rep1. (embryo)		mjTestesWT3()
Testes Data. (testes)		SRR345207(SRX097268)
source: size fractionated RNA from mouse hipp. (brain)		SRR038740(GSM527275)
small RNA-Seq. (dicer brain)		SRR029042(GSM433294)
18.5dpc_hetero_tdrd1-KO. (tdrd1 testes)		SRR037904(GSM510440)
brain_rep1. (brain)		SRR042458(GSM539850)
mouse basophil cells [09-002]. (b cell)		GSM510456(GSM510456)
newborn_rep12. (total RNA)		SRR306529(GSM750572)
19-24nt. (ago2 brain)		SRR023851(GSM307160)
ZHBT-c412hsmallrna_rep1. (cell line)		SRR346425(SRX098267)
Global profiling of miRNA and the hairpin pre. (Neuroblastoma)		SRR346413(SRX098254)
Global profiling of miRNA and the hairpin pre. (Heart)		SRR345205(SRX097266)
source: size fractionated RNA from mouse hipp. (brain)		mjLiverKO3()
Liver Data. (Zcchc11 liver)		SRR039183(GSM485323)
shLuc.1309 (-dox). (fibroblast)		SRR038743(GSM527278)
small RNA-Seq. (dicer brain)		SRR023852(GSM307161)
ZHBT-c424hsmallrna_rep1. (cell line)		SRR037924(GSM510462)
e9p5_rep2. (embryo)		SRR345204(SRX097265)
source: size fractionated RNA from mouse hipp. (brain)		SRR042475(GSM539867)
mouse embryonic fibroblast cells [09-002]. (fibroblast)		GSM640576(GSM640576)
small RNA in the liver with paternal low prot. (liver)		mjTestesKO6()
Testes Data. (Zcchc11 testes)		SRR028732(GSM400969)
Mili-Tdrd1 KO associated. (mili testes)		SRR037927(GSM510465)
e7p5_rep1. (embryo)		SRR042445(GSM539837)
mouse immature B cells [09-002]. (b cell)		GSM640580(GSM640580)
small RNA in the liver with paternal Low pro. (liver)		SRR279905(GSM689055)
cell type: mouse embryonic stem cellcell line. (ESC)		SRR034118(GSM466728)
Mili IP_Tdrd9+/- replicate1. (mili testes)		SRR059766(GSM562828)
DN3_Drosha. (thymus)		SRR014232(GSM319956)
16.5 dpc MILI. (mili testes)		SRR346419(SRX098260)
Global profiling of miRNA and the hairpin pre. (Lung)		SRR306538(GSM750581)
19-24nt. (ago2 brain)		GSM510452(GSM510452)
newborn_rep8. (total RNA)		SRR073955(GSM629281)
total RNA. (blood)		SRR306530(GSM750573)
19-24nt. (ago2 brain)		GSM566419(GSM566419)
Endougenous small RNA from mouse NIH3T3 cells, without MHV-68 infection. (fibroblast)		SRR306527(GSM750570)
19-24nt. (ago2 brain)		SRR042444(GSM539836)
mouse pre B cells [09-002]. (b cell)		SRR306528(GSM750571)
19-24nt. (ago2 brain)		SRR345196(SRX097257)
source: size fractionated RNA from mouse hipp. (brain)		SRR042456(GSM539848)
mouse hematopoetic progenitor cells [09-002]. (bone marrow)		GSM317183(GSM317183)
Ago-1 IP small RNAs from mouse brain. (ago1 brain)		SRR037944(GSM510482)
293DcrTN_cand5. (cell line)		SRR346420(SRX098261)
Global profiling of miRNA and the hairpin pre. (Uterus)		SRR065047(SRR065047)
Tissue-specific Regulation of Mouse MicroRNA . (liver)		GSM314553(GSM314553)
ESC dcr (Illumina). (ESC)		SRR306540(GSM750583)
19-24nt. (ago2 brain)		SRR402760(SRX117943)
source: ES E14 male cells. (ESC)		SRR037912(GSM510449)
newborn_rep5. (total RNA)		SRR042483(GSM539875)
mouse muscle tissue [09-002]. (muscle)		SRR037905(GSM510441)
brain_rep2. (brain)		SRR525242(SRA056111/SRX170318)
Mus musculus domesticus miRNA sequencing. (ago2 Blood)		GSM314559(GSM314559)
ESC dgcr8 (454). (ESC)		SRR037922(GSM510460)
e12p5_rep4. (embryo)		SRR042473(GSM539865)
mouse nTreg cells [09-002]. (lymph)		SRR553584(SRX182790)
source: Heart. (Heart)		SRR059765(GSM562827)
DN3_control. (thymus)		RuiDcrWT(Rui)
DGCR8-dependent microRNA biogenesis is essent. (skin)		SRR059772(GSM562834)
CD4_Drosha. (spleen)		SRR042443(GSM539835)
mouse pro B cells [09-002]. (b cell)		GSM509279(GSM509279)
MVH-/- E16.5 small RNA. (testes)		SRR345202(SRX097263)
source: size fractionated RNA from mouse hipp. (brain)		Ago3IP805(Rui)
Quantitative functions of Argonaute proteins . (ago3 skin)		SRR095855BC7(SRX039178)
sequencing of miRNA from wild type and diseas. (heart)		SRR029037(GSM433289)
18dpp_homo_tdrd6-KO. (tdrd6 testes)		SRR037929(GSM510467)
e7p5_rep3. (embryo)		SRR065053(SRR065053)
Tissue-specific Regulation of Mouse MicroRNA . (jejunum)		SRR060845(GSM561991)
total RNA. (brain)		RuiDGCR8KO(Rui)
DGCR8-dependent microRNA biogenesis is essent. (dgcr8 skin)		SRR037907(GSM510443)
brain_rep4. (brain)		SRR042449(GSM539841)
mouse B cells activated in vitro with LPS/IL4 replicate 2 [09-002]. (b cell)		SRR402761(SRX117944)
source: ES E14 male cells. (ESC)		SRR042470(GSM539862)
mouse Th17 cells [09-002]. (lymph)		SRR042465(GSM539857)
mouse CD4+ T cells (spleen) [09-002]. (spleen)		RuiDGCR8WT(Rui)
DGCR8-dependent microRNA biogenesis is essent. (skin)		SRR042446(GSM539838)
mouse mature B cells (spleen) replicate 1 [09-002]. (b cell)		SRR034121(GSM466731)
Mili IP_Tdrd9-/- replicate2. (mili testes)		SRR037910(GSM510447)
newborn_rep3. (total RNA)		SRR345198(SRX097259)
source: size fractionated RNA from mouse hipp. (brain)		SRR345199(SRX097260)
source: size fractionated RNA from mouse hipp. (brain)
....................................................................................................TCAGCTGCCTCTTGCCATCACAGT.................................................241383.00201.0029.0022.0028.0016.0020.006.0026.00-14.0019.006.0011.0010.0015.007.002.002.003.008.001.002.005.006.003.00-7.007.004.002.00-3.001.008.002.003.001.002.005.001.004.003.002.00-4.001.005.00-2.002.001.003.00---1.001.002.002.003.004.00-2.00--2.00----1.00--1.001.00-1.00-1.00-2.001.00--2.001.002.001.001.001.002.001.00-----1.00----1.001.00--1.001.00-1.00-------------1.00-----1.001.00---------1.001.00----1.00--1.00-------
....................................................................................................TCAGCTGCCTCTTGCCATCACAG..................................................231201.00201.0013.006.0013.009.005.0021.00--9.00-10.007.004.00-8.004.004.007.002.006.009.002.003.004.00----1.007.001.004.00-5.00-1.003.00----3.001.00-2.00-5.003.00-3.00----1.001.00-----1.00--1.00----1.00-------1.00---2.00----------2.00------1.00-------------------1.00----1.00------1.00---------1.00-----------1.00--
....................................................................................................TCAGCTGCCTCTTGCCATCACAGA.................................................241101.00201.0028.001.005.0016.0015.007.00---2.00-1.002.00------4.00-2.00-------------3.00--4.00-----------1.00--1.002.001.00-----1.00-------1.00------1.00----------------1.00--------------------------1.00--------------------------1.00--------
..................................................GTGGGAGAAGAGGCTGCTGTGG.....................................................................................................22161.0061.00-7.001.00-2.002.00-29.00-1.00---1.00-3.00-----------1.001.00-----1.00---1.00---------1.00--------------1.00-1.00-------1.00--------1.00-----1.00------1.00--------------------1.00------1.00------------------1.00------1.00------
....................................................................................................TCAGCTGCCTCTTGCCATCACA...................................................22158.0058.003.006.00-2.001.005.00--1.00-1.001.00-2.00--1.001.00-1.001.001.001.004.0010.00-1.00----1.00----1.00---3.00-------2.001.00--1.001.00--1.00---------------------------1.00--1.00---1.00----------------------------------------1.00-----------------------
....................................................................................................TCAGCTGCCTCTTGCCATCAC....................................................21121.0021.00-1.00------1.003.001.00-----2.00-----2.00--2.00-1.001.001.00-------1.00----------------------------1.00------------------------1.00---------------1.00--1.00---1.00-----------------------------------------
....................................................................................................TCAGCTGCCTCTTGCCATCACAGTT................................................25117.00201.001.002.002.003.00--1.00-1.00---------1.00--1.00------------1.001.00----------------------------------------1.00--------------------------------1.00----------------------------------1.00-----------
..................................................GTGGGAGAAGAGGCTGCTGTG......................................................................................................21113.0013.00----1.00-------------------------2.00-----------1.00-----------------2.00-2.00-----------1.00---1.00--------------------------------------------------------1.001.00------1.00------------
....................................................................................................TCAGCTGCCTCTTGCCATCA.....................................................20112.0012.00-----1.00--1.00-------3.00-------------1.00--------2.00----1.00-------1.00---------------------------1.00-------------------------------1.00-------------------------------------------
....................................................................................................TCAGCTGCCTCTTGCCATCACAGC.................................................2419.00201.003.00-1.001.002.00-1.00--------------------1.00--------------------------------------------------------------------------------------------------------------------------------
..................................................GTGGGAGAAGAGGCTGCTGTGA.....................................................................................................2217.0013.00-1.001.00------------1.00------------------1.00-------1.00-------------------1.00-------------------------------1.00-------------------------------------------------------------
..................................................GTGGGAGAAGAGGCTGCTGTGT.....................................................................................................2217.0013.00-----------------1.00--------------------------------------------1.001.00-1.00----------------1.00---------------------1.00-------------------------1.00-------------------------
....................................................................................................TCAGCTGCCTCTTGCCATC......................................................1915.005.00------1.00-----------------------1.001.00-----1.00----------------------------------------------------1.00-----------------------------------------------------------------
....................................................................................................TCAGCTGCCTCTTGCCATCACAT..................................................2314.0058.00---1.001.00-----------1.00--------------------------1.00----------------------------------------------------------------------------------------------------------------
..................................................GTGGGAGAAGAGGCTGCTGTGAA....................................................................................................2314.0013.00-----1.00------------------------------------1.00-----------------------2.00-----------------------------------------------------------------------------------------
.................................TGGCTGGGCCTCTACAG...........................................................................................................................1714.004.00-----------------------------------------------------------------------3.00-------------------------------------------------1.00----------------------------------
....................................................................................................TCAGCTGCCTCTTGCCATCACCGA.................................................2414.0021.00---------------------------------------------------4.00--------------------------------------------------------------------------------------------------------
..................................................GTGGGAGAAGAGGCTGCTGTGGA....................................................................................................2314.0061.00-1.00-------------------------------------------------------------1.00-1.00-------------------------------------------------------------1.00----------------------------
..................................................GTGGGAGAAGAGGCTGCTGT.......................................................................................................2014.004.00----------------------------1.00---------------------------------------1.00---------1.00---------------1.00-------------------------------------------------------------
......................................................................................................AGCTGCCTCTTGCCATCACAGT.................................................2214.003.00------2.00----------1.00-------1.00----------------------------------------------------------------------------------------------------------------------------------
....................................................................................................TCAGCTGCCTCTTGCCATCACCGT.................................................2414.0021.00-----------------------1.00-----------------1.00-----------2.00------------------------------------------------------------------------------------------------------
....................................................................................................TCAGCTGCCTCTTGCCATCACAGTTT...............................................2613.00201.00------------1.00-----1.00----------------------------------------------------------------------------------------------------------1.00------------------------------
....................................................................................................TCAGCTGCCTCTTGCCATCACAA..................................................2313.0058.00------1.00---------------------2.00-------------------------------------------------------------------------------------------------------------------------------
...................................................TGGGAGAAGAGGCTGCTGTGG.....................................................................................................2113.003.00-------3.00----------------------------------------------------------------------------------------------------------------------------------------------------
......................................................................................................AGCTGCCTCTTGCCATCACAG..................................................2113.003.00------1.00--------------------------------------------------2.00--------------------------------------------------------------------------------------------------
..................................................GTGGGAGAAGAGGCTGCTGTGGG....................................................................................................2313.003.00----------1.00--------------------1.00--------------------------------------------------------------------1.00-------------------------------------------------------
....................................................................................................TCAGCTGCCTCTTGCCATCACAGG.................................................2413.003.00-----1.001.00--------1.00--------------------------------------------------------------------------------------------------------------------------------------------
....................................................................................................TCAGCTGCCTCTTGCCATCACATT.................................................2413.0058.001.00-1.00---------------------------1.00-----------------------------------------------------------------------------------------------------------------------------
.....................................................................................................CAGCTGCCTCTTGCCATCACAGT.................................................2313.001.00----------------------------------------------------------1.00-------------2.00-----------------------------------------------------------------------------------
....................................................................................................TCAGCTGCCTCTTGCCATCACAGAA................................................2512.00201.00---2.00--------------------------------------------------------------------------------------------------------------------------------------------------------
..................................................GTGGGAGAAGAGGCTGCTGTGGT....................................................................................................2312.0061.00------------------------------------------------------------1.00--1.00--------------------------------------------------------------------------------------------
.................................................................................................TCCTCAGCTGCCTCTTGCCATCAC....................................................2412.002.00-2.00----------------------------------------------------------------------------------------------------------------------------------------------------------
.................................................................................................TCCTCAGCTGCCTCTTGCCATC......................................................2212.002.00-2.00----------------------------------------------------------------------------------------------------------------------------------------------------------
..................................................GTGGGAGAAGAGGCTGCTGTGAGA...................................................................................................2412.0013.00---------------2.00--------------------------------------------------------------------------------------------------------------------------------------------
....................................................................................................TCAGCTGCCTCTTGCCATCACAGTC................................................2512.00201.00------------2.00-----------------------------------------------------------------------------------------------------------------------------------------------
...................................................................................................CTCAGCTGCCTCTTGCCATCACA...................................................2312.002.00----------------------------------------------------------------------2.00-------------------------------------------------------------------------------------
..................................................GTGGGAGAAGAGGCTGCTGTTT.....................................................................................................2212.004.00------------------------------------------1.00-------------------------------------------------------------------------------------------------------1.00---------
.................................................................................................TCCTCAGCTGCCTCTTGCCATCT.....................................................2312.002.00-1.00-----------------------------------------------------1.00----------------------------------------------------------------------------------------------------
....................................................................................................TCAGCTGCCTCTTGCCATCACC...................................................2212.0021.00-------------------------------------------------------------------------------------------------------------------------------------1.00----1.00-----------------
..................................................GTGGGAGAAGAGGCTGCTGTGGAAA..................................................................................................2512.0061.00-----------------------------1.00------------1.00-----------------------------------------------------------------------------------------------------------------
....................................................................................................TCAGCTGCCTCTTGCCA........................................................1721.501.50--------------------------0.501.00--------------------------------------------------------------------------------------------------------------------------------
..................................................GTGGGAGAAGAGGCTGCTGTGGTAG..................................................................................................2511.0061.00-------1.00----------------------------------------------------------------------------------------------------------------------------------------------------
....................................................................................................TCAGCTGCCTCTTGCCATCACG...................................................2211.0021.00---------------------------------------------------------------------------1.00--------------------------------------------------------------------------------
..................................................GTGGGAGAAGAGGCTGCTGTGGGTGGA................................................................................................2711.001.00------------------------------------------------------------1.00-----------------------------------------------------------------------------------------------
..................................................GTGGGAGAAGAGGCTGCTGA.......................................................................................................201.000.00-----------------------------------------------------------------------------------------------------------------------------------------1.00------------------
............................................CTACAGGTGGGAGAACGC...............................................................................................................181.000.00----------------------------------------------------------------------------------------------------------------------1.00-------------------------------------
..................................................GTGGGAGAAGAGGCTGCTGTGGGTG..................................................................................................2511.001.00--------------------------------------------------------------------------------------------------1.00---------------------------------------------------------
................................CTGGCTGGGCCTCTACAG...........................................................................................................................1811.001.00--------------------------------------------------------1.00---------------------------------------------------------------------------------------------------
..................................................GTGGGAGAAGAGGCTGCTGAATT....................................................................................................231.000.00-----------------------------------------------------------------------------------------------------------------1.00------------------------------------------
....................................................................................................TCAGCTGCCTCTTGCCATCACAAG.................................................2411.0058.00---------------------------------------------------------------------------------------------------------------------1.00--------------------------------------
...................................................................................................................................................TGATGGCTGGTATCGGCAACGACACAATT291.000.00-------------------------------------------------------------------------------------------------------1.00----------------------------------------------------
..................................................GTGGGAGAAGAGGCTGCTGTGGGTGC.................................................................................................2611.001.00--------------------------------------------------------------------------------------------------------------------------------------------------------1.00---
.................................................................................................TCCTCAGCTGCCTCTTGCC.........................................................1911.001.00-1.00----------------------------------------------------------------------------------------------------------------------------------------------------------
....................................................................................................TCAGCTGCCTCTTGCCATCACAGAT................................................2511.00201.00---------------------------------------------------------------------------------------------1.00--------------------------------------------------------------
....................................................................................................TCAGCTGCCTCTTGCCATCATAGT.................................................2411.0012.00----------------------------------------------------1.00-------------------------------------------------------------------------------------------------------
........................AAGGGTGACTGGCTGGGCC..................................................................................................................................1911.001.00--------------------------------------------------------------------------------------------------------------------------------------1.00---------------------
..................................................GTGGGAGAAGAGGCTGCTGTGGGTGCCCCCAAGTCCGCTAGCTCAGCTCCTCAGCTGCCTCTTGCCATCACA...................................................7211.001.00-------------------------------------------------------------------1.00----------------------------------------------------------------------------------------
.......................................................................................................................................................GGCTGGTATCGGCAACGAC...1911.001.00---------------------------------1.00--------------------------------------------------------------------------------------------------------------------------
..............................................................................................................................GTTTTTCAAGTCCCCGGC.............................181.000.00-------------------------------------------------------------------------------------------------------------------1.00----------------------------------------
..................................................GTGGGAGAAGAGGCTGCTTTGG.....................................................................................................221.000.00-------1.00----------------------------------------------------------------------------------------------------------------------------------------------------
....................................................................................................TCAGCTGCCTCTTGCCATCAGGG..................................................2311.0012.00-1.00----------------------------------------------------------------------------------------------------------------------------------------------------------
..................................................GTGGGAGAAGAGGCTGCTGTGGGTGCCCCCAAGTCCGCTAGCTCAGCTCCTCAGCTGCCTCTTGCCATCCCA...................................................721.000.00-------------------------------------------------------------------1.00----------------------------------------------------------------------------------------
........................................................................................................CTGCCTCTTGCCATCACAG..................................................1911.001.00----------1.00-------------------------------------------------------------------------------------------------------------------------------------------------
...................................................TGGGAGAAGAGGCTGCTGTGGGTGC.................................................................................................2511.001.00-------------------------------------------------------------------------------------------------1.00----------------------------------------------------------
.....................................................................................................CAGCTGCCTCTTGCCATCACAG..................................................2211.001.00------------------------------------1.00-----------------------------------------------------------------------------------------------------------------------
....................................................................................................TCAGCTGCCTCTTGCCATCATT...................................................2211.0012.00---------------1.00--------------------------------------------------------------------------------------------------------------------------------------------
.................................................................................................TCCTCAGCTGCCTCTTGCCATTT.....................................................231.000.00--1.00---------------------------------------------------------------------------------------------------------------------------------------------------------
..................................................GTGGGAGAAGAGGCTGGTGT.......................................................................................................201.000.00--------------------------------------------------------------------1.00---------------------------------------------------------------------------------------
..................................................GTGGGAGAAGAGGCTGCTGTGGGTGCCCCCAAGTCCGCTAGCTCAGCTCCTCAGCTGCCTCTTGCCATCACAGTAT...............................................761.000.00-------------------------------------------------------------------1.00----------------------------------------------------------------------------------------
....................CCTCAAGGGTGACTGCGTA......................................................................................................................................191.000.00---------------------------1.00--------------------------------------------------------------------------------------------------------------------------------
....................................................................................................TCAGCTGCCTCTTGCCATCAAAGA.................................................2411.0012.00----------------------------1.00-------------------------------------------------------------------------------------------------------------------------------
....................................................................................................TCAGCTGCCTCTTGCCATCACGGT.................................................2411.0021.00------------1.00-----------------------------------------------------------------------------------------------------------------------------------------------
........................................................................................................CTGCCTCTTGCCATCACAGTGCT..............................................2311.001.00------1.00-----------------------------------------------------------------------------------------------------------------------------------------------------
....................................................................................................TCAGCTGCCTCTTGCCATCACAGCT................................................2511.00201.00----1.00-------------------------------------------------------------------------------------------------------------------------------------------------------
........................AAGGGTGACTGGCTGGGCCTCTACAGGC.........................................................................................................................281.000.00--------------------------------------------------------------------------1.00---------------------------------------------------------------------------------
....................................................................................................TCAGCTGCCTCTTGCCATCAAAG..................................................2311.0012.00--------------------------------------------1.00---------------------------------------------------------------------------------------------------------------
....................................................................................................TCAGCTGCCTCTTGCCATCACACT.................................................2411.0058.00------1.00-----------------------------------------------------------------------------------------------------------------------------------------------------
..................................................GTGGGAGAAGAGGCTGCTGGGGC....................................................................................................231.000.00-------------------------------------------------------------------------------------------------------------------------------------------------------1.00----
.................................................................................................................................................TTTGATGGCTGGTATAA...........171.000.00--------------------------------------------------------------------1.00---------------------------------------------------------------------------------------
.......................CAAGGGTGACTGGCTGGGCCTCTACA............................................................................................................................2611.001.00----------------------------------------------------1.00-------------------------------------------------------------------------------------------------------
...................................................................................................CTCAGCTGCCTCTTGCCATCACAGT.................................................251.000.00------------------------------------------------------------------------------------------------------------------------------1.00-----------------------------
..................................................GTGGGAGAAGAGGCTGCTGTAGA....................................................................................................2311.004.00--------------------------------------------------------------------------------------1.00---------------------------------------------------------------------
...............................................................CTGCTGTGGGTGCCCTGCC...........................................................................................191.000.00----------------------------------------------------------------------1.00-------------------------------------------------------------------------------------
.................................................................................................TCCTCAGCTGCCTCTTGCCATCACT...................................................2511.002.00--------------------------1.00---------------------------------------------------------------------------------------------------------------------------------
...................................................TGGGAGAAGAGGCTGCTGGGG.....................................................................................................211.000.00-------1.00----------------------------------------------------------------------------------------------------------------------------------------------------
....................................................................................................TCAGCTGCCTCTTGCCATCACAGAAT...............................................2611.00201.00---------------------------------------------------------------------------------------------------------------1.00--------------------------------------------
....................................................................................................TCAGCTGCCTCTTGCCATCACCG..................................................2311.0021.00------------------------------------------------------------------------------------------------------------------------------------------------------1.00-----
....................................................................................................TCAGCTGCCTCTTGCCATCATTT..................................................2311.0012.00----1.00-------------------------------------------------------------------------------------------------------------------------------------------------------
..................................................GTGGGAGAAGAGGCTGCTGTGAT....................................................................................................2311.0013.00-----------------------------------------------------------------------------------------------1.00------------------------------------------------------------
....................................................................................................TCAGCTGCCTCTTGCCATCACAGTTG...............................................2611.00201.00---------------------1.00--------------------------------------------------------------------------------------------------------------------------------------
........................................................................................................CTGCCTCTTGCCATCACAGT.................................................2011.001.00----------------------------------1.00-------------------------------------------------------------------------------------------------------------------------
....................................................................................................TCAGCTGCCTCTTGCCATCAGAA..................................................2311.0012.00-----1.00------------------------------------------------------------------------------------------------------------------------------------------------------
....................................................................................................TCAGCTGCCTCTTGCCATCACATA.................................................2411.0058.00---1.00--------------------------------------------------------------------------------------------------------------------------------------------------------
......................................................................................................AGCTGCCTCTTGCCATCACA...................................................2011.001.00-----------------------------------1.00------------------------------------------------------------------------------------------------------------------------
....................................................................................................TCAGCTGCCTCTTGCC.........................................................1640.500.50------0.50-----------------------------------------------------------------------------------------------------------------------------------------------------
....................................................................................................TCAGCTGCCTCTTGCCCTC......................................................1940.250.50------0.25-----------------------------------------------------------------------------------------------------------------------------------------------------

Antisense strand
GGACCCCAGCTCACCTGCATCCTCAAGGGTGACTGGCTGGGCCTCTACAGGTGGGAGAAGAGGCTGCTGTGGGTGCCCCCAAGTCCGCTAGCTCAGCTCCTCAGCTGCCTCTTGCCATCACAGGCGGTTTTTCAAGTCCCCCCATTTTGATGGCTGGTATCGGCAACGACACA
..................................................(((((..(((((((.((((.(((.((.....(((......)))..))))).)))).))))))).))..)))....................................................
..................................................51......................................................................123................................................
SizePerfect hitTotal NormPerfect NormSRR391853(GSM852148)
gender: femalegenotype/variation: ADAR2-/-/AD. (embryo)		SRR546155(SRX180174)
Global profiling of miRNA and the hairpin pre. (ago2 Neuroblastoma)		SRR391848(GSM852143)
gender: femalegenotype/variation: wild typeti. (embryo)		SRR391852(GSM852147)
gender: femalegenotype/variation: ADAR2-/-tis. (embryo)		SRR391851(GSM852146)
gender: femalegenotype/variation: wild typeti. (embryo)		SRR553583(SRX182789)
source: Cerebellum. (Cerebellum)		GSM314557(GSM314557)
ESC dgcr8 (Illumina). (ESC)		SRR279907(GSM689057)
cell type: mouse embryonic stem cellcell line. (ESC)		SRR038742(GSM527277)
small RNA-Seq. (dgcr8 brain)		SRR306541(GSM750584)
19-24nt. (ago2 brain)		SRR346417(SRX098258)
Global profiling of miRNA and the hairpin pre. (Brain)		SRR038744(GSM527279)
small RNA-Seq. (brain)		SRR391846(GSM852141)
gender: femalegenotype/variation: ADAR2-/-tis. (embryo)		SRR306542(GSM750585)
19-24nt. (ago2 brain)		mjTestesWT1()
Testes Data. (testes)		SRR346424(SRX098266)
Global profiling of miRNA and the hairpin pre. (Neuroblastoma)		SRR038745(GSM527280)
small RNA-Seq. (dgcr8 brain)		GSM510444(GSM510444)
brain_rep5. (brain)		SRR391850(GSM852145)
gender: femalegenotype/variation: ADAR2-/-/AD. (embryo)		SRR346422(SRX098264)
Global profiling of miRNA and the hairpin pre. (Muscle)		SRR037906(GSM510442)
brain_rep3. (brain)		SRR391849(GSM852144)
gender: femalegenotype/variation: ADAR2-/-tis. (embryo)		SRR206941(GSM723282)
other. (brain)		mjLiverKO1()
Liver Data. (Zcchc11 liver)		SRR390297(GSM849855)
cell line: NIH-3T3cell type: fibroblastip ant. (fibroblast)		SRR306535(GSM750578)
19-24nt. (ago2 brain)		SRR391845(GSM852140)
gender: femalegenotype/variation: wild typeti. (embryo)		SRR391847(GSM852142)
gender: femalegenotype/variation: ADAR2-/-/AD. (embryo)		SRR206940(GSM723281)
other. (brain)		SRR553582(SRX182788)
source: Brain. (Brain)		SRR059769(GSM562831)
Treg_Drosha. (spleen)		SRR206939(GSM723280)
other. (brain)		SRR394083(GSM855969)
background strain: C57BL6/SV129cell type: KRa. (cell line)		SRR206942(GSM723283)
other. (brain)		SRR306534(GSM750577)
19-24nt. (ago2 brain)		SRR037921(GSM510459)
e12p5_rep3. (embryo)		SRR346423(SRX098265)
Global profiling of miRNA and the hairpin pre. (Brain)		SRR306537(GSM750580)
19-24nt. (ago2 brain)		SRR402762(SRX117945)
source: ES E14 male cells. (ESC)		SRR306536(GSM750579)
19-24nt. (ago2 brain)		Ago1IP517(Rui)
Quantitative functions of Argonaute proteins . (ago1 skin)		GSM314552(GSM314552)
ESC wild type (Illumina). (ESC)		SRR042471(GSM539863)
mouse TFHS cells [09-002]. (spleen)		SRR306543(GSM750586)
19-24nt. (ago2 brain)		SRR390299(GSM849857)
cell line: NIH-3T3cell type: fibroblastip ant. (ago2 fibroblast)		SRR306531(GSM750574)
19-24nt. (ago2 brain)		SRR390300(GSM849858)
cell line: NIH-3T3cell type: fibroblastinfect. (ago2 fibroblast)		SRR038741(GSM527276)
small RNA-Seq. (brain)		SRR306533(GSM750576)
19-24nt. (ago2 brain)		SRR073954(GSM629280)
total RNA. (blood)		mjLiverWT3()
Liver Data. (liver)		Ago3IP812(Rui)
Quantitative functions of Argonaute proteins . (ago3 skin)		SRR029043(GSM433295)
18.5dpc_homo_tdrd1-KO. (tdrd1 testes)		Ago1IP812(Rui)
Quantitative functions of Argonaute proteins . (ago1 skin)		SRR040489(GSM533912)
E18.5 Ago2 catalytically inactive LIVER small RNA. (ago2 liver)		SRR685339(GSM1079783)
Small RNAs (15-50 nts in length) from immorta. (cell line)		SRR279903(GSM689053)
cell type: mouse embryonic stem cellcell line. (ESC)		GSM510454(GSM510454)
newborn_rep10. (total RNA)		SRR037920(GSM510458)
e12p5_rep2. (embryo)		SRR306532(GSM750575)
19-24nt. (ago2 brain)		SRR042448(GSM539840)
mouse B cells activated in vitro with LPS/IL4 replicate 1 [09-002]. (b cell)		SRR279904(GSM689054)
cell type: mouse embryonic stem cellcell line. (ESC)		SRR042469(GSM539861)
mouse Th2 cells [09-002]. (lymph)		SRR042477(GSM539869)
mouse brain tissue [09-002]. (brain)		SRR039610(GSM527274)
small RNA-Seq. (brain)		SRR345203(SRX097264)
source: size fractionated RNA from mouse hipp. (brain)		SRR402766(SRX117949)
source: ES PGK female cells. (ESC)		SRR346421(SRX098263)
Global profiling of miRNA and the hairpin pre. (mixture)		SRR345201(SRX097262)
source: size fractionated RNA from mouse hipp. (brain)		GSM510455(GSM510455)
newborn_rep11. (total RNA)		SRR095853(SRX039174)
sequencing of miRNA from wild type and diseas. (heart)		SRR394084(GSM855970)
background strain: C57BL6/SV129cell type: KRa. (dicer cell line)		SRR023848(GSM307157)
mEFsmallrna_rep1. (cell line)		SRR039186(GSM485326)
shLuc.1309;ROSA-rtTA (+dox). (fibroblast)		SRR042488(GSM539880)
mouse BclXL germinal center B cells [BalbC] [09-002]. (B cell)		SRR306539(GSM750582)
19-24nt. (ago2 brain)		SRR037923(GSM510461)
e9p5_rep1. (embryo)		mjTestesWT3()
Testes Data. (testes)		SRR345207(SRX097268)
source: size fractionated RNA from mouse hipp. (brain)		SRR038740(GSM527275)
small RNA-Seq. (dicer brain)		SRR029042(GSM433294)
18.5dpc_hetero_tdrd1-KO. (tdrd1 testes)		SRR037904(GSM510440)
brain_rep1. (brain)		SRR042458(GSM539850)
mouse basophil cells [09-002]. (b cell)		GSM510456(GSM510456)
newborn_rep12. (total RNA)		SRR306529(GSM750572)
19-24nt. (ago2 brain)		SRR023851(GSM307160)
ZHBT-c412hsmallrna_rep1. (cell line)		SRR346425(SRX098267)
Global profiling of miRNA and the hairpin pre. (Neuroblastoma)		SRR346413(SRX098254)
Global profiling of miRNA and the hairpin pre. (Heart)		SRR345205(SRX097266)
source: size fractionated RNA from mouse hipp. (brain)		mjLiverKO3()
Liver Data. (Zcchc11 liver)		SRR039183(GSM485323)
shLuc.1309 (-dox). (fibroblast)		SRR038743(GSM527278)
small RNA-Seq. (dicer brain)		SRR023852(GSM307161)
ZHBT-c424hsmallrna_rep1. (cell line)		SRR037924(GSM510462)
e9p5_rep2. (embryo)		SRR345204(SRX097265)
source: size fractionated RNA from mouse hipp. (brain)		SRR042475(GSM539867)
mouse embryonic fibroblast cells [09-002]. (fibroblast)		GSM640576(GSM640576)
small RNA in the liver with paternal low prot. (liver)		mjTestesKO6()
Testes Data. (Zcchc11 testes)		SRR028732(GSM400969)
Mili-Tdrd1 KO associated. (mili testes)		SRR037927(GSM510465)
e7p5_rep1. (embryo)		SRR042445(GSM539837)
mouse immature B cells [09-002]. (b cell)		GSM640580(GSM640580)
small RNA in the liver with paternal Low pro. (liver)		SRR279905(GSM689055)
cell type: mouse embryonic stem cellcell line. (ESC)		SRR034118(GSM466728)
Mili IP_Tdrd9+/- replicate1. (mili testes)		SRR059766(GSM562828)
DN3_Drosha. (thymus)		SRR014232(GSM319956)
16.5 dpc MILI. (mili testes)		SRR346419(SRX098260)
Global profiling of miRNA and the hairpin pre. (Lung)		SRR306538(GSM750581)
19-24nt. (ago2 brain)		GSM510452(GSM510452)
newborn_rep8. (total RNA)		SRR073955(GSM629281)
total RNA. (blood)		SRR306530(GSM750573)
19-24nt. (ago2 brain)		GSM566419(GSM566419)
Endougenous small RNA from mouse NIH3T3 cells, without MHV-68 infection. (fibroblast)		SRR306527(GSM750570)
19-24nt. (ago2 brain)		SRR042444(GSM539836)
mouse pre B cells [09-002]. (b cell)		SRR306528(GSM750571)
19-24nt. (ago2 brain)		SRR345196(SRX097257)
source: size fractionated RNA from mouse hipp. (brain)		SRR042456(GSM539848)
mouse hematopoetic progenitor cells [09-002]. (bone marrow)		GSM317183(GSM317183)
Ago-1 IP small RNAs from mouse brain. (ago1 brain)		SRR037944(GSM510482)
293DcrTN_cand5. (cell line)		SRR346420(SRX098261)
Global profiling of miRNA and the hairpin pre. (Uterus)		SRR065047(SRR065047)
Tissue-specific Regulation of Mouse MicroRNA . (liver)		GSM314553(GSM314553)
ESC dcr (Illumina). (ESC)		SRR306540(GSM750583)
19-24nt. (ago2 brain)		SRR402760(SRX117943)
source: ES E14 male cells. (ESC)		SRR037912(GSM510449)
newborn_rep5. (total RNA)		SRR042483(GSM539875)
mouse muscle tissue [09-002]. (muscle)		SRR037905(GSM510441)
brain_rep2. (brain)		SRR525242(SRA056111/SRX170318)
Mus musculus domesticus miRNA sequencing. (ago2 Blood)		GSM314559(GSM314559)
ESC dgcr8 (454). (ESC)		SRR037922(GSM510460)
e12p5_rep4. (embryo)		SRR042473(GSM539865)
mouse nTreg cells [09-002]. (lymph)		SRR553584(SRX182790)
source: Heart. (Heart)		SRR059765(GSM562827)
DN3_control. (thymus)		RuiDcrWT(Rui)
DGCR8-dependent microRNA biogenesis is essent. (skin)		SRR059772(GSM562834)
CD4_Drosha. (spleen)		SRR042443(GSM539835)
mouse pro B cells [09-002]. (b cell)		GSM509279(GSM509279)
MVH-/- E16.5 small RNA. (testes)		SRR345202(SRX097263)
source: size fractionated RNA from mouse hipp. (brain)		Ago3IP805(Rui)
Quantitative functions of Argonaute proteins . (ago3 skin)		SRR095855BC7(SRX039178)
sequencing of miRNA from wild type and diseas. (heart)		SRR029037(GSM433289)
18dpp_homo_tdrd6-KO. (tdrd6 testes)		SRR037929(GSM510467)
e7p5_rep3. (embryo)		SRR065053(SRR065053)
Tissue-specific Regulation of Mouse MicroRNA . (jejunum)		SRR060845(GSM561991)
total RNA. (brain)		RuiDGCR8KO(Rui)
DGCR8-dependent microRNA biogenesis is essent. (dgcr8 skin)		SRR037907(GSM510443)
brain_rep4. (brain)		SRR042449(GSM539841)
mouse B cells activated in vitro with LPS/IL4 replicate 2 [09-002]. (b cell)		SRR402761(SRX117944)
source: ES E14 male cells. (ESC)		SRR042470(GSM539862)
mouse Th17 cells [09-002]. (lymph)		SRR042465(GSM539857)
mouse CD4+ T cells (spleen) [09-002]. (spleen)		RuiDGCR8WT(Rui)
DGCR8-dependent microRNA biogenesis is essent. (skin)		SRR042446(GSM539838)
mouse mature B cells (spleen) replicate 1 [09-002]. (b cell)		SRR034121(GSM466731)
Mili IP_Tdrd9-/- replicate2. (mili testes)		SRR037910(GSM510447)
newborn_rep3. (total RNA)		SRR345198(SRX097259)
source: size fractionated RNA from mouse hipp. (brain)		SRR345199(SRX097260)
source: size fractionated RNA from mouse hipp. (brain)
.........................................................................TGCCCCCAAGTCCG...................................................................................... 1450.600.60----------------------------------------------------------------------------------------------------------------------------------------------------------0.400.20
..........................................................................GCCCCCAAGTCCG...................................................................................... 13100.100.10----------------------------------------------------------------------------------------------------------------------------------------------------------0.10-