ID: mmu-mir-6942
GENE: Zkscan3(3)
chr13:21488397-21488646-


(2)
AGO1.ip 		(13)
AGO2.ip 		(2)
AGO3.ip 		(11)
B-CELL 		(29)
BRAIN 		(4)
CELL-LINE 		(2)
DCR.mut 		(3)
DGCR8.mut 		(8)
EMBRYO 		(5)
ESC 		(4)
FIBROBLAST 		(3)
HEART 		(3)
KIDNEY 		(10)
LIVER 		(5)
LYMPH 		(25)
OTHER 		(4)
OTHER.mut 		(4)
PIWI.ip 		(1)
PIWI.mut 		(8)
SKIN 		(8)
SPLEEN 		(20)
TESTES 		(1)
THYMUS 		(1)
UTERUS

Sense strand
TTAGGGTCTTCTGACTTACATTCAGTCTCTCCAGAACACCCTCACAGACATTTATGATTCTAAGTCCCACAAGATGACACAGAGACATTTGAACGTGGGGATCTCCTCAGCTGCTCTTTGGCAGTTTCCTTGGAGTCCTGGGCCTAGGAGGAGGGGAACATTTGCAACTATAGTGGCTTATGGTTCTCTCCACCTCTCAGTAGTCTTTTACAGAAATACAACTCACAGCTACAGTGAAACGGGAGAACTG
...........................................................................................................................................(((...(((.((((((((.(((..((.((....)).))..))).)))))))).))))))....................................................
...........................................................................................................................................140.........................................................200................................................
SizePerfect hitTotal NormPerfect NormSRR546155(SRX180174)
Global profiling of miRNA and the hairpin pre. (ago2 Neuroblastoma)		SRR553602(SRX182808)
source: Sertoli cells. (Sertoli cells)		mjLiverKO1()
Liver Data. (Zcchc11 liver)		mjLiverWT2()
Liver Data. (liver)		SRR553583(SRX182789)
source: Cerebellum. (Cerebellum)		SRR279907(GSM689057)
cell type: mouse embryonic stem cellcell line. (ESC)		mjLiverWT3()
Liver Data. (liver)		SRR042471(GSM539863)
mouse TFHS cells [09-002]. (spleen)		SRR346424(SRX098266)
Global profiling of miRNA and the hairpin pre. (Neuroblastoma)		SRR553585(SRX182791)
source: Kidney. (Kidney)		SRR390300(GSM849858)
cell line: NIH-3T3cell type: fibroblastinfect. (ago2 fibroblast)		SRR391846(GSM852141)
gender: femalegenotype/variation: ADAR2-/-tis. (embryo)		SRR042469(GSM539861)
mouse Th2 cells [09-002]. (lymph)		mjTestesWT1()
Testes Data. (testes)		Ago3IP805(Rui)
Quantitative functions of Argonaute proteins . (ago3 skin)		SRR042459(GSM539851)
mouse neutrophil cells replicate 1 [09-002]. (blood)		SRR279904(GSM689054)
cell type: mouse embryonic stem cellcell line. (ESC)		SRR391852(GSM852147)
gender: femalegenotype/variation: ADAR2-/-tis. (embryo)		SRR042488(GSM539880)
mouse BclXL germinal center B cells [BalbC] [09-002]. (B cell)		SRR038742(GSM527277)
small RNA-Seq. (dgcr8 brain)		Ago3IP812(Rui)
Quantitative functions of Argonaute proteins . (ago3 skin)		Ago2IP517(Rui)
Quantitative functions of Argonaute proteins . (ago2 skin)		SRR390299(GSM849857)
cell line: NIH-3T3cell type: fibroblastip ant. (ago2 fibroblast)		SRR042458(GSM539850)
mouse basophil cells [09-002]. (b cell)		SRR391853(GSM852148)
gender: femalegenotype/variation: ADAR2-/-/AD. (embryo)		SRR346425(SRX098267)
Global profiling of miRNA and the hairpin pre. (Neuroblastoma)		mjLiverKO3()
Liver Data. (Zcchc11 liver)		SRR346418(SRX098259)
Global profiling of miRNA and the hairpin pre. (Liver)		SRR391847(GSM852142)
gender: femalegenotype/variation: ADAR2-/-/AD. (embryo)		Ago1IP812(Rui)
Quantitative functions of Argonaute proteins . (ago1 skin)		Ago1IP517(Rui)
Quantitative functions of Argonaute proteins . (ago1 skin)		SRR038741(GSM527276)
small RNA-Seq. (brain)		SRR553582(SRX182788)
source: Brain. (Brain)		SRR553586(SRX182792)
source: Testis. (testes)		SRR346417(SRX098258)
Global profiling of miRNA and the hairpin pre. (Brain)		SRR042462(GSM539854)
mouse macrophages [09-002]. (bone marrow)		SRR346414(SRX098255)
Global profiling of miRNA and the hairpin pre. (Spleen)		SRR042480(GSM539872)
mouse kidney tissue [09-002]. (kidney)		SRR042444(GSM539836)
mouse pre B cells [09-002]. (b cell)		SRR042447(GSM539839)
mouse mature B cells (spleen) replicate 2 [09-002]. (b cell)		SRR042463(GSM539855)
mouse natural killer cells [09-002]. (spleen)		SRR042460(GSM539852)
mouse neutrophil cells replicate 2 [09-002]. (blood)		SRR206941(GSM723282)
other. (brain)		SRR346423(SRX098265)
Global profiling of miRNA and the hairpin pre. (Brain)		mjTestesWT2()
Testes Data. (testes)		SRR059769(GSM562831)
Treg_Drosha. (spleen)		SRR345200(SRX097261)
source: size fractionated RNA from mouse hipp. (brain)		SRR042446(GSM539838)
mouse mature B cells (spleen) replicate 1 [09-002]. (b cell)		SRR391851(GSM852146)
gender: femalegenotype/variation: wild typeti. (embryo)		Ago2IP504(Rui)
Quantitative functions of Argonaute proteins . (ago2 skin)		SRR042468(GSM539860)
mouse Th1 cells [09-002]. (lymph)		SRR553584(SRX182790)
source: Heart. (Heart)		SRR394084(GSM855970)
background strain: C57BL6/SV129cell type: KRa. (dicer cell line)		SRR206942(GSM723283)
other. (brain)		SRR391849(GSM852144)
gender: femalegenotype/variation: ADAR2-/-tis. (embryo)		SRR042470(GSM539862)
mouse Th17 cells [09-002]. (lymph)		SRR042484(GSM539876)
mouse salivary gland tissue [09-002]. (salivary gland)		SRR042464(GSM539856)
mouse CD4+CD8+ T cells (thymus) [09-002]. (thymus)		SRR042445(GSM539837)
mouse immature B cells [09-002]. (b cell)		SRR402762(SRX117945)
source: ES E14 male cells. (ESC)		SRR039610(GSM527274)
small RNA-Seq. (brain)		SRR345207(SRX097268)
source: size fractionated RNA from mouse hipp. (brain)		SRR346422(SRX098264)
Global profiling of miRNA and the hairpin pre. (Muscle)		SRR038744(GSM527279)
small RNA-Seq. (brain)		GSM519104(GSM519104)
mouse_granulocyte_nuclei_smallRNAs. (cell line)		GSM640579(GSM640579)
small RNA in the liver with paternal Low pro. (liver)		SRR391845(GSM852140)
gender: femalegenotype/variation: wild typeti. (embryo)		GSM640578(GSM640578)
small RNA in the liver with paternal control. (liver)		SRR042461(GSM539853)
mouse dendritic cells [09-002]. (bone marrow)		SRR042473(GSM539865)
mouse nTreg cells [09-002]. (lymph)		SRR345205(SRX097266)
source: size fractionated RNA from mouse hipp. (brain)		GSM640581(GSM640581)
small RNA in the liver with paternal control. (liver)		SRR038743(GSM527278)
small RNA-Seq. (dicer brain)		SRR042451(GSM539843)
mouse B cells activated in vitro with LPS/aIgD-Dextran [09-002]. (b cell)		SRR042448(GSM539840)
mouse B cells activated in vitro with LPS/IL4 replicate 1 [09-002]. (b cell)		GSM509279(GSM509279)
MVH-/- E16.5 small RNA. (testes)		SRR248526(GSM733814)
cell type: Thy1- spermatogonial stem cellstra. (testes)		SRR306535(GSM750578)
19-24nt. (ago2 brain)		SRR248527(GSM733815)
cell type: spermatogonial stem cell enriched . (testes)		SRR042465(GSM539857)
mouse CD4+ T cells (spleen) [09-002]. (spleen)		SRR042454(GSM539846)
mouse germinal center B cells (lymph node) [09-002]. (b cell)		SRR059770(GSM562832)
Treg_Dicer. (spleen)		GSM509280(GSM509280)
small RNA cloning by length. (testes)		GSM475279(GSM475279)
Miwi-IP. (miwi testes)		GSM509278(GSM509278)
small RNA cloning by length. (piwi testes)		SRR346415(SRX098256)
source: Testis. (Testes)		SRR345203(SRX097264)
source: size fractionated RNA from mouse hipp. (brain)		GSM475280(GSM475280)
Mili-IP. (mili testes)		SRR206940(GSM723281)
other. (brain)		SRR346421(SRX098263)
Global profiling of miRNA and the hairpin pre. (mixture)		SRR038745(GSM527280)
small RNA-Seq. (dgcr8 brain)		SRR042472(GSM539864)
mouse iTreg cells [09-002]. (lymph)		SRR346420(SRX098261)
Global profiling of miRNA and the hairpin pre. (Uterus)		SRR553603(SRX182809)
source: Spermatids. (Spermatids)		SRR346413(SRX098254)
Global profiling of miRNA and the hairpin pre. (Heart)		SRR525244(SRA056111/SRX170320)
Mus musculus domesticus miRNA sequencing. (ago2 Blood)		SRR116846(GSM678422)
Small RNA deep sequencing from mouse epididym. (epididymis)		SRR042452(GSM539844)
mouse B1 B cells [09-002]. (b cell)		SRR306533(GSM750576)
19-24nt. (ago2 brain)		SRR065055(SRR065055)
Tissue-specific Regulation of Mouse MicroRNA . (jejunum)		SRR039183(GSM485323)
shLuc.1309 (-dox). (fibroblast)		SRR023852(GSM307161)
ZHBT-c424hsmallrna_rep1. (cell line)		SRR345202(SRX097263)
source: size fractionated RNA from mouse hipp. (brain)		SRR346416(SRX098257)
Global profiling of miRNA and the hairpin pre. (Kidney)		SRR248523(GSM733811)
cell type: Thy1+ spermatogonial stem cellstra. (testes)		SRR073954(GSM629280)
total RNA. (blood)		SRR306542(GSM750585)
19-24nt. (ago2 brain)		SRR345204(SRX097265)
source: size fractionated RNA from mouse hipp. (brain)		SRR345199(SRX097260)
source: size fractionated RNA from mouse hipp. (brain)		SRR042477(GSM539869)
mouse brain tissue [09-002]. (brain)		RuiDGCR8KO(Rui)
DGCR8-dependent microRNA biogenesis is essent. (dgcr8 skin)		SRR042455(GSM539847)
mouse plasma cells [09-002]. (blood)		RuiDGCR8WT(Rui)
DGCR8-dependent microRNA biogenesis is essent. (skin)		GSM509276(GSM509276)
small RNA cloning by length. (testes)		SRR042475(GSM539867)
mouse embryonic fibroblast cells [09-002]. (fibroblast)		SRR034121(GSM466731)
Mili IP_Tdrd9-/- replicate2. (mili testes)		SRR065052(SRR065052)
Tissue-specific Regulation of Mouse MicroRNA . (jejunum)		SRR095855BC1(SRX039178)
sequencing of miRNA from wild type and diseas. (heart)		GSM640580(GSM640580)
small RNA in the liver with paternal Low pro. (liver)		SRR029043(GSM433295)
18.5dpc_homo_tdrd1-KO. (tdrd1 testes)		SRR391850(GSM852145)
gender: femalegenotype/variation: ADAR2-/-/AD. (embryo)		SRR042466(GSM539858)
mouse CD8+ T cells (spleen) [09-002]. (spleen)		SRR206939(GSM723280)
other. (brain)		SRR042450(GSM539842)
mouse B cells activated in vitro with LPS/IL4 replicate 3 [09-002]. (b cell)		mjTestesWT3()
Testes Data. (testes)		SRR306541(GSM750584)
19-24nt. (ago2 brain)		SRR034119(GSM466729)
Mili IP_Tdrd9+/- replicate2. (mili testes)		SRR306534(GSM750577)
19-24nt. (ago2 brain)		SRR065054(SRR065054)
Tissue-specific Regulation of Mouse MicroRNA . (jejunum)		SRR073955(GSM629281)
total RNA. (blood)		SRR042457(GSM539849)
mouse mast cells [09-002]. (bone marrow)		SRR042487(GSM539879)
mouse BclXL B activated with LPS/IL4 [BalbC] [09-002]. (spleen)		SRR042456(GSM539848)
mouse hematopoetic progenitor cells [09-002]. (bone marrow)		SRR685339(GSM1079783)
Small RNAs (15-50 nts in length) from immorta. (cell line)		SRR014231(GSM319955)
16.5 dpc total. (testes)		GSM510444(GSM510444)
brain_rep5. (brain)		SRR069809(GSM610965)
small RNA sequencing; sample 1. (testes)		SRR306544(GSM750587)
19-24nt. (ago2 brain)		SRR306531(GSM750574)
19-24nt. (ago2 brain)		SRR553604(SRX182810)
source: Spermatocytes. (Spermatocytes)		SRR065047(SRR065047)
Tissue-specific Regulation of Mouse MicroRNA . (liver)		SRR279903(GSM689053)
cell type: mouse embryonic stem cellcell line. (ESC)		SRR042483(GSM539875)
mouse muscle tissue [09-002]. (muscle)		GSM314557(GSM314557)
ESC dgcr8 (Illumina). (ESC)		mjTestesKO8()
Testes Data. (Zcchc11 testes)
................................................................................................................................................TAGGAGGAGGGGAACATTTGC.....................................................................................211181.00181.0048.007.009.00-1.0011.006.001.005.005.00-1.00--3.00-4.00-1.002.002.002.005.00-1.003.002.001.005.002.00--3.002.001.00-1.002.002.00-2.00-1.001.00----1.002.00-1.003.001.00-3.00---1.002.003.001.001.001.003.00-1.00-1.00---1.00-1.00--1.00---1.00--1.00----1.00---------1.00-----1.00-----1.00---1.00-1.00---1.00-1.00----------------1.00---
...............................................................................................................................................CTAGGAGGAGGGGAACATTTGC.....................................................................................22179.0079.006.003.00-19.001.00-5.001.001.00---1.00-4.00-1.00-3.00-1.004.00---1.002.00--2.001.001.00---1.00---1.002.003.003.00------1.00-1.00----1.00---1.00-------1.00--------2.00-------------1.00---1.00-1.00----1.00----------------------------------------1.00-
................................................................................................................................................TAGGAGGAGGGGAACATTTGA.....................................................................................21165.0037.0011.0015.003.00-6.00---1.004.005.00--------1.00---1.00-2.00-1.00-1.001.00-1.001.002.00-2.00------1.00-----1.00-1.00----------1.00-1.00-----------------------------1.00--------1.00-----------------------------------------
................................................................................................................................................TAGGAGGAGGGGAACATTTG......................................................................................20137.0037.001.007.00---2.001.00-1.002.00-2.00------1.001.00-1.00---------3.00--1.001.001.00--1.00----4.002.00-----------------------------1.00-----1.001.00--1.00-------1.00---------------------------------------------------
..............................................................................................................................................CCTAGGAGGAGGGGAACATTTGC.....................................................................................23132.0032.005.00-8.00-1.002.00-1.002.00-2.001.00----1.00--1.001.00------1.00------------1.00-------------1.00-------1.00---1.00------------------------------------------1.00----------------------1.00------------
................................................................................................................................................TAGGAGGAGGGGAACATTT.......................................................................................19113.0013.001.00------2.00----2.00--2.00-------1.00---------------1.00----------------2.001.00------------------------------------------------------------------------------------1.00--
...............................................................................................................................................CTAGGAGGAGGGGAACATTT.......................................................................................20113.0013.00-1.00-----2.00----2.00--2.00--1.00----1.00--------------------------1.00------1.00---------------1.00---------------------------------------1.00-------------------------------
................................................................................................................................................TAGGAGGAGGGGAACATTTGT.....................................................................................21113.0037.001.00-------1.00---1.00--2.00--1.001.00-------------------------1.00-1.00-----------------------1.00------------------------1.00------------------------1.00--------------1.00--------
...............................................................................................................................................CTAGGAGGAGGGGAACATTTGA.....................................................................................22112.008.002.003.00-------------------------1.00-------------------1.00------------------------2.00---1.00--1.00---------------------------------------------------1.00-------------
................................................................................................................................................TAGGAGGAGGGGAACATTTGAA....................................................................................22111.0037.00-2.00--1.00-3.00-------------------------1.00--1.00-----------1.00--------------------------------------------1.00-----------1.00----------------------------------------
.................................................................................................................................................................................................................ACAGAAATACAACTCACAGCT....................21111.0011.00-----------------6.00------3.00-----------------------1.00-----1.00------------------------------------------------------------------------------------------
..............................................................................................................................................CCTAGGAGGAGGGGAACATTTG......................................................................................22110.0010.00----1.00--------------1.00---1.00-------------------1.00---1.00---------------1.00----------1.00----------------------------------------------------1.001.00----1.00-----------
................................................................................................................................................TAGGAGGAGGGGAACATTTGCA....................................................................................2219.009.00--------1.00-5.00-----------------1.00-1.00-----------------------------------1.00------------------------------------------------------------------------------
...............................................................................................................................................CTAGGAGGAGGGGAACATTTG......................................................................................2118.008.00-------1.00----1.00-----1.00-----------1.00----1.00--1.00-----------------------------------------1.00---------------------------------------------------------1.00------
..............................................................................................................................................................................................................TTTACAGAAATACAACTCACAGCTACAG................2818.008.00-------------8.00-----------------------------------------------------------------------------------------------------------------------------------
..............................................................................................................................................CCTAGGAGGAGGGGAACATTT.......................................................................................2116.006.00---------------------------------------1.00------------------1.00-----------1.00--------1.00----1.00---------------------------------------------1.00--------------
...............................................................................................................................................CTAGGAGGAGGGGAACATTTGT.....................................................................................2216.008.00---------------1.00-----------------------1.00-1.00---1.00-------------1.00---------------------1.00---------------------------------------------------------------
..................................................................................................................................................................................TATGGTTCTCTCCACCTCTCAGA.................................................235.000.00--------------------1.00-2.00-1.00----------------------------------1.00-------------------------------------------------------------------------------------
................................................................................................................................................TAGGAGGAGGGGAACATTTGCAA...................................................................................2314.004.00-------1.00---------------------------------------------1.00------------1.00-----------------1.00------------------------------------------------------------
................................................................................................................................................TAGGAGGAGGGGAACATTTGAAA...................................................................................2314.0037.00-1.00-------1.00-1.00-----------------------------------------------------------------------------------------------1.00-------------------------------------
......................................................................................................................................................................................................................................ACAGTGAAACGGGAGAACT.1914.004.00-----------3.00--------------------------------------------------------------------1.00----------------------------------------------------------------
...............................................................................................................................................CTAGGAGGAGGGGAACATTTGAA....................................................................................2313.008.001.00----1.00------------------------------------------------------------------------1.00------------------------------------------------------------------
...............................................................................................................................................CTAGGAGGAGGGGAACATTTGCAA...................................................................................2413.003.001.00---------------------------------------------------------------------1.00--------------------1.00-----------------------------------------------------
..............................................................................................................................................CCTAGGAGGAGGGGAACATTTGCT....................................................................................2413.0032.001.00----------1.00---------------------------------------------------------------------------------------------------------------------------1.00---------
..............................................................................................................................................CCTAGGAGGAGGGGAACATTTGA.....................................................................................2313.0010.001.00---1.00---------------------------------------------1.00----------------------------------------------------------------------------------------------
................................................................................................................................................TAGGAGGAGGGGAACATTTGCAT...................................................................................2313.009.001.00---1.00------------------------------------------------------------------1.00-------------------------------------------------------------------------
................................................................................................................................................TAGGAGGAGGGGAACATTTGTA....................................................................................2213.0037.002.00-------1.00----------------------------------------------------------------------------------------------------------------------------------------
................................................................................................................................................TAGGAGGAGGGGAACATTTAA.....................................................................................2113.0013.00-------2.00--------------------------------------------------1.00--------------------------------------------------------------------------------------
................................................................................................................................................TAGGAGGAGGGGAACATTTGAAT...................................................................................2313.0037.00-1.00------------------------2.00----------------------------------------------------------------------------------------------------------------------
...............................................................................................................................................CTAGGAGGAGGGGAACATTTGCA....................................................................................2313.003.00----1.00---------------------------------1.00--------------------------------------------------------------------------------------1.00-------------------
................................................................................................................................................TAGGAGGAGGGGAACATTTTC.....................................................................................2112.0013.00--1.00----------------------------------1.00-----------------------------------------------------------------------------------------------------------
...............................................................................................................................................CTAGGAGGAGGGGAACAT.........................................................................................1812.002.00-----------------------1.00---------------------------------------------------------------------------------------------------1.00---------------------
..............................................................................................................................................CCTAGGAGGAGGGGAACATT........................................................................................2012.002.00-------1.00-------------------------------------------------------------------------------------------1.00---------------------------------------------
................................................................................................................................................................................................................TACAGAAATACAACTCACAGCTACAGTGA.............2912.002.00-----------------------------------------------------------------------------------1.00---1.00---------------------------------------------------------
................................................................................................................................................TAGGAGGAGGGGAACATTTGCTT...................................................................................2312.00181.00----1.00------1.00-------------------------------------------------------------------------------------------------------------------------------------
................................................................................................................................................TAGGAGGAGGGGAACATTGGC.....................................................................................2112.001.002.00------------------------------------------------------------------------------------------------------------------------------------------------
..................................................................................................................................................................................................................CAGAAATACAACTCACAGCTACAGTGAAACGGT.......332.000.00---------------------------------2.00---------------------------------------------------------------------------------------------------------------
...............................................................................................................................................CTAGGAGGAGGGGAACATT........................................................................................1912.002.001.00--------------1.00---------------------------------------------------------------------------------------------------------------------------------
..............................................................................................................................................CCTAGGAGGAGGGGAACATTTT......................................................................................2212.006.00-------2.00-----------------------------------------------------------------------------------------------------------------------------------------
.................................................................................................................................................................................TTATGGTTCTCTCCACCTCTC....................................................2112.002.00----------------------------------1.00-----------------------------1.00--------------------------------------------------------------------------------
........................................................................GATGACACAGAGACATTTGAACGTGGGGATCTCCTCAGCTGCTCTTTGGCAGTTTCCTTGGAGTCC................................................................................................................6612.002.00-----------------------------------------------------------------------------------------2.00-------------------------------------------------------
.................................................................................................................................................................................................................ACAGAAATACAACTCACAGC.....................2012.002.00------------------------1.00-----------------------1.00------------------------------------------------------------------------------------------------
................................................................................................................................................TAGGAGGAGGGGAACATTTGCT....................................................................................2212.00181.00--------------1.00-----1.00----------------------------------------------------------------------------------------------------------------------------
..................................................................................................................................................................................TATGGTTCTCTCCACCTCTCAGT.................................................2312.002.001.00----------------------------------------------------------------------------------------------------------------------------------------1.00-------
.................................................................................................................................................................................TTATGGTTCTCTCCACCTC......................................................1912.002.00--------------------------------------------------------------------------------------2.00----------------------------------------------------------
................................................................................................................................................TAGGAGGAGGGGAACATTTGCTA...................................................................................2312.00181.00-------------------------------------------1.00-----------------------1.00-----------------------------------------------------------------------------
...............................................................................................................................................CTAGGAGGAGGGGAACATTTTCT....................................................................................2311.0013.00-------------------------------------1.00-----------------------------------------------------------------------------------------------------------
................................................................................................................................................TAGGAGGAGGGGAACATT........................................................................................1811.001.00------------------------------------1.00------------------------------------------------------------------------------------------------------------
.................................................................................................................................................................................TTATGGTTCTCTCCACCTCTCAAT.................................................2411.001.00-----------------------------------------------------------------------------------------------------------------------1.00-------------------------
................................................................................................................................................TAGGAGGAGGGGAACATTTT......................................................................................2011.0013.00----------------------------------------------------------1.00--------------------------------------------------------------------------------------
........................................................................................................................................CCTGGGCCTAGGAGGAGGGGAACAT.........................................................................................2511.001.00------------------------------------------------------------------------------------------------------------------1.00------------------------------
.....................................................................................................................................................................................GGTTCTCTCCACCTCTCAGTAG...............................................2211.001.00---------------------------------------------------------------1.00---------------------------------------------------------------------------------
................................................................................................................................................TAGGAGGAGGGGAACATTAA......................................................................................2011.001.00--------------------------------------------------1.00----------------------------------------------------------------------------------------------
........................................................................................................................................CCTGGGCCTAGGAGGAGGGG..............................................................................................2011.001.00---------------------------------------------------------1.00---------------------------------------------------------------------------------------
..............................................................................................................................................CCTAGGAGGAGGGGAACATTTGCTC...................................................................................2511.0032.00--------------------------------------------------------------------------1.00----------------------------------------------------------------------
..............................................................................................................................................CCTAGGAGGAGGGGAACAT.........................................................................................1911.001.00---------------------------------------------------------------------------------------------------------------1.00---------------------------------
...............................................................................................................................................CTAGGAGGAGGGGAACATTTGAAA...................................................................................2411.008.00-1.00-----------------------------------------------------------------------------------------------------------------------------------------------
........................................................................................................................................CCTGGGCCTAGGAGGAGGGGAAT...........................................................................................231.000.001.00------------------------------------------------------------------------------------------------------------------------------------------------
...........................................................................................................................GTTTCCTTGGAGTCCAGT.............................................................................................................181.000.00---------------------------------------------------------------------------------------------------------1.00---------------------------------------
................................................................................................................................................TAGGAGGAGGGGAACATTTTT.....................................................................................2111.0013.00---------------1.00---------------------------------------------------------------------------------------------------------------------------------
.................................................................................................................................................AGGAGGAGGGGAACATTTG......................................................................................1911.001.00------------------------------------------------------------------------------------------1.00------------------------------------------------------
................................................................................................................................................TAGGAGGAGGGGAACATTTA......................................................................................2011.0013.00----------------------------------------------------------------------------1.00--------------------------------------------------------------------
.............................................................................................................................................GCCTAGGAGGAGGGGAACAT.........................................................................................2011.001.00---------------------------1.00---------------------------------------------------------------------------------------------------------------------
.......................................................................................................................................TCCTGGGCCTAGGAGGAGGGGAACAT.........................................................................................2611.001.00-------------------------------------1.00-----------------------------------------------------------------------------------------------------------
...................ATTCAGTCTCTCCAGAACACCCTC...............................................................................................................................................................................................................2411.001.00--------------------------------------------------------------------------------------------1.00----------------------------------------------------
................................................................................................................................................TAGGAGGAGGGGAACATTTAAC....................................................................................2211.0013.00-----------------------------------------1.00-------------------------------------------------------------------------------------------------------
...............................................................................................................................................CTAGGAGGAGGGGAACATTTGCTT...................................................................................2411.0079.00------------------------------1.00------------------------------------------------------------------------------------------------------------------
........................................................................................................................................................................................................................TACAACTCACAGCTACAGTGAAACGG........2611.001.00-------------------------------------------------------------------------------------------------------------------1.00-----------------------------
.................................................................................................................................................................................TTATGGTTCTCTCCACCTCTCA...................................................2211.001.00-------------------------------1.00-----------------------------------------------------------------------------------------------------------------
...................................................................................................................................................................................................................................GCTACAGTGAAACGGGAGAACT.2211.001.00------------------------------------------------------------------------------------------------------------------------1.00------------------------
...............................................................................................................................................CTAGGAGGAGGGGAACATTTGAAGT..................................................................................2511.008.00-----------------------------1.00-------------------------------------------------------------------------------------------------------------------
................................................................................................................................................TAGGAGGAGGGGAACATTTGAAC...................................................................................2311.0037.001.00------------------------------------------------------------------------------------------------------------------------------------------------
................................................................................................................................................TAGGAGGAGGGGAACATTTAT.....................................................................................2111.0013.00--------------------------------------------------------------------------------------------------------------------------------------------1.00----
................................................................................................GGGGATCTCCTCAGCTG.........................................................................................................................................1711.001.00-------------1.00-----------------------------------------------------------------------------------------------------------------------------------
...............................................................................................................................................CTAGGAGGAGGGGAACATA........................................................................................1911.002.00------------1.00------------------------------------------------------------------------------------------------------------------------------------
........................................................................................................................................CCTGGGCCTAGGAGGAGGGGAACA..........................................................................................2411.001.00------------1.00------------------------------------------------------------------------------------------------------------------------------------
...............................................................................................................................................CTAGGAGGAGGGGAACATTTA......................................................................................2111.0013.00---------------------------------------------------------------------1.00---------------------------------------------------------------------------
........................................................ATTCTAAGTCCCACAAGATGACACAGAG......................................................................................................................................................................2811.001.00---------------------------1.00---------------------------------------------------------------------------------------------------------------------
...................................................................................................................................................................................................................AGAAATACAACTCACAGCT....................1911.001.00-----------------1.00-------------------------------------------------------------------------------------------------------------------------------
................................................................................................................................................TAGGAGGAGGGGAACATTTC......................................................................................2011.0013.00---------------------------------------------------------------------------------------------------------------------------------1.00---------------
..............................................................................................................................................CCTAGGAGGAGGGGAACATTTGT.....................................................................................2311.0010.00-----------------------1.00-------------------------------------------------------------------------------------------------------------------------
.................................................................................................................................................................................TTATGGTTCTCTCCACCTCT.....................................................2011.001.00-------------------1.00-----------------------------------------------------------------------------------------------------------------------------
........................................................................................................................................................................................................................TACAACTCACAGCTACAGTGAAACGGGA......2811.001.00--------------------------------------------------------------------------------------------------------------------------------------1.00----------
...............................................................................................................................................CTAGGAGGAGGGGAACATTAA......................................................................................2111.002.00-----------------------------------1.00-------------------------------------------------------------------------------------------------------------
...............................................................................................................................................CTAGGAGGAGGGGAACATTTGCAGA..................................................................................2511.003.00-----------------------------------------------------1.00-------------------------------------------------------------------------------------------
.................................................................................................................................................................................TTATGGTTCTCTCCACCTCTCAGT.................................................2411.001.00--------------------------------------------------------------------------------------------------------------1.00----------------------------------
................................................................................................................................................TAGGAGGAGGGGAACATTTGAAG...................................................................................2311.0037.001.00------------------------------------------------------------------------------------------------------------------------------------------------
................................................................................................................................................TAGGAGGAGGGGAACATTTGCAACTATAGT............................................................................3011.001.00-------------------------------------------------------------------------------------------------------------------------------------------1.00-----
................................................................................................................................................TAGGAGGAGGGGAACATTTGCAACTAT...............................................................................2711.001.00---------1.00---------------------------------------------------------------------------------------------------------------------------------------
........................................................................................................................................CCTGGGCCTAGGAGGAGGGGAACATT........................................................................................2611.001.00------------1.00------------------------------------------------------------------------------------------------------------------------------------
................................................................................................GGGGATCTCCTCAGCTGCGGC.....................................................................................................................................211.000.00-------------1.00-----------------------------------------------------------------------------------------------------------------------------------
..................................................................................................................................................................................................................................AGCTACAGTGAAACGGG.......1711.001.00----------------1.00--------------------------------------------------------------------------------------------------------------------------------
.................................................................................................................................................AGGAGGAGGGGAACATTTGA.....................................................................................2011.001.00----1.00--------------------------------------------------------------------------------------------------------------------------------------------
...............................................................................................................................................CTAGGAGGAGGGGAACATTTGCT....................................................................................2311.0079.00------------------------------1.00------------------------------------------------------------------------------------------------------------------
................................................................................................................................................................................................................TACAGAAATACAACTCACAGCTACAGTGAAA...........3111.001.00-----------------------------------------------------------------------------------1.00-------------------------------------------------------------
.....................................................................................................................................................................................................................AAATACAACTCACAGCTACAGTGAAACGGGA......3111.001.00---------------------------------------------------------------------------------------1.00---------------------------------------------------------
......................................................................................................................................................................................................................AATACAACTCACAGCTACAG................2011.001.00----------------1.00--------------------------------------------------------------------------------------------------------------------------------
................................................................................................................................................TAGGAGGAGGGGAACATTTGTT....................................................................................2211.0037.00-----------------------1.00-------------------------------------------------------------------------------------------------------------------------
.................................................................................................................................................................................TTATGGTTCTCTCCACCTCTCAGAAT...............................................261.000.00-----------------1.00-------------------------------------------------------------------------------------------------------------------------------
...............................................................................................................................................CTAGGAGGAGGGGAACATTTGAC....................................................................................2311.008.00-1.00-----------------------------------------------------------------------------------------------------------------------------------------------
..............................................................................................................................................CCTAGGAGGAGGGGAACATTTGCAA...................................................................................2511.001.00--------------------------------------------------------------------1.00----------------------------------------------------------------------------
...............................................................................................................................................CTAGGAGGAGGGGAACGTT........................................................................................191.000.00--------------------------------------------------1.00----------------------------------------------------------------------------------------------
.................................................................................................................................................................................................................ACAGAAATACAACTCACACCT....................211.000.00------------------------------------------------1.00------------------------------------------------------------------------------------------------
...............................................................................................................................................CTAGGAGGAGGGGAACATTGGC.....................................................................................2211.002.00--------------1.00----------------------------------------------------------------------------------------------------------------------------------
.............................................................................................................................................................................................................TTTTACAGAAATACAACTCACAGCTACA.................2811.001.00------------------------------------------------------------------------------------------------------------------------------1.00------------------
..................................................................................................................................................................................................................CAGAAATACAACTCACAGCT....................2011.001.00------------------------------------------------------1.00------------------------------------------------------------------------------------------
..............................................................................................................................................CCTAGGAGGAGGGGAACATTTA......................................................................................2211.006.00----------------------------------------------------------------------------------------1.00--------------------------------------------------------
..............................................................................................................................................CCTAGGAGGAGGGGAACATTTAA.....................................................................................2311.006.00--------------------------------------1.00----------------------------------------------------------------------------------------------------------
..................................................................................................GGATCTCCTCAGCTGCGGC.....................................................................................................................................191.000.00----------------------------------------------------------------------------------------1.00--------------------------------------------------------
.............................................................................................................................................GCCTAGGAGGAGGGGAACATTTGCT....................................................................................251.000.00--------------------------------------------------------------------------------------------------1.00----------------------------------------------
................................................................................................................................................TAGGAGGAGGGGAACATTTGCAAGA.................................................................................2511.004.00--------------------1.00----------------------------------------------------------------------------------------------------------------------------
....................................................................................................................................................................................................................GAAATACAACTCACAGCT....................1811.001.00------------------------1.00------------------------------------------------------------------------------------------------------------------------
.........................................................................................................................................................................ATAGTGGCTTATGGTTCTC..............................................................1911.001.00-----------------------------------------------------------------------------------------------------1.00-------------------------------------------
..................................................................................................................................................................................TATGGTTCTCTCCACC........................................................1620.500.50-----------0.50-------------------------------------------------------------------------------------------------------------------------------------
................................................................................................................................................TAGGAGGAGGGGAACAT.........................................................................................1730.330.33------------------------------------------------------------------------------------------------------------------------------------------------0.33
.................................................................................................................................................................................TTATGGTTCTCTCCAC.........................................................1640.250.250.25------------------------------------------------------------------------------------------------------------------------------------------------

Antisense strand
TTAGGGTCTTCTGACTTACATTCAGTCTCTCCAGAACACCCTCACAGACATTTATGATTCTAAGTCCCACAAGATGACACAGAGACATTTGAACGTGGGGATCTCCTCAGCTGCTCTTTGGCAGTTTCCTTGGAGTCCTGGGCCTAGGAGGAGGGGAACATTTGCAACTATAGTGGCTTATGGTTCTCTCCACCTCTCAGTAGTCTTTTACAGAAATACAACTCACAGCTACAGTGAAACGGGAGAACTG
...........................................................................................................................................(((...(((.((((((((.(((..((.((....)).))..))).)))))))).))))))....................................................
...........................................................................................................................................140.........................................................200................................................
SizePerfect hitTotal NormPerfect NormSRR546155(SRX180174)
Global profiling of miRNA and the hairpin pre. (ago2 Neuroblastoma)		SRR553602(SRX182808)
source: Sertoli cells. (Sertoli cells)		mjLiverKO1()
Liver Data. (Zcchc11 liver)		mjLiverWT2()
Liver Data. (liver)		SRR553583(SRX182789)
source: Cerebellum. (Cerebellum)		SRR279907(GSM689057)
cell type: mouse embryonic stem cellcell line. (ESC)		mjLiverWT3()
Liver Data. (liver)		SRR042471(GSM539863)
mouse TFHS cells [09-002]. (spleen)		SRR346424(SRX098266)
Global profiling of miRNA and the hairpin pre. (Neuroblastoma)		SRR553585(SRX182791)
source: Kidney. (Kidney)		SRR390300(GSM849858)
cell line: NIH-3T3cell type: fibroblastinfect. (ago2 fibroblast)		SRR391846(GSM852141)
gender: femalegenotype/variation: ADAR2-/-tis. (embryo)		SRR042469(GSM539861)
mouse Th2 cells [09-002]. (lymph)		mjTestesWT1()
Testes Data. (testes)		Ago3IP805(Rui)
Quantitative functions of Argonaute proteins . (ago3 skin)		SRR042459(GSM539851)
mouse neutrophil cells replicate 1 [09-002]. (blood)		SRR279904(GSM689054)
cell type: mouse embryonic stem cellcell line. (ESC)		SRR391852(GSM852147)
gender: femalegenotype/variation: ADAR2-/-tis. (embryo)		SRR042488(GSM539880)
mouse BclXL germinal center B cells [BalbC] [09-002]. (B cell)		SRR038742(GSM527277)
small RNA-Seq. (dgcr8 brain)		Ago3IP812(Rui)
Quantitative functions of Argonaute proteins . (ago3 skin)		Ago2IP517(Rui)
Quantitative functions of Argonaute proteins . (ago2 skin)		SRR390299(GSM849857)
cell line: NIH-3T3cell type: fibroblastip ant. (ago2 fibroblast)		SRR042458(GSM539850)
mouse basophil cells [09-002]. (b cell)		SRR391853(GSM852148)
gender: femalegenotype/variation: ADAR2-/-/AD. (embryo)		SRR346425(SRX098267)
Global profiling of miRNA and the hairpin pre. (Neuroblastoma)		mjLiverKO3()
Liver Data. (Zcchc11 liver)		SRR346418(SRX098259)
Global profiling of miRNA and the hairpin pre. (Liver)		SRR391847(GSM852142)
gender: femalegenotype/variation: ADAR2-/-/AD. (embryo)		Ago1IP812(Rui)
Quantitative functions of Argonaute proteins . (ago1 skin)		Ago1IP517(Rui)
Quantitative functions of Argonaute proteins . (ago1 skin)		SRR038741(GSM527276)
small RNA-Seq. (brain)		SRR553582(SRX182788)
source: Brain. (Brain)		SRR553586(SRX182792)
source: Testis. (testes)		SRR346417(SRX098258)
Global profiling of miRNA and the hairpin pre. (Brain)		SRR042462(GSM539854)
mouse macrophages [09-002]. (bone marrow)		SRR346414(SRX098255)
Global profiling of miRNA and the hairpin pre. (Spleen)		SRR042480(GSM539872)
mouse kidney tissue [09-002]. (kidney)		SRR042444(GSM539836)
mouse pre B cells [09-002]. (b cell)		SRR042447(GSM539839)
mouse mature B cells (spleen) replicate 2 [09-002]. (b cell)		SRR042463(GSM539855)
mouse natural killer cells [09-002]. (spleen)		SRR042460(GSM539852)
mouse neutrophil cells replicate 2 [09-002]. (blood)		SRR206941(GSM723282)
other. (brain)		SRR346423(SRX098265)
Global profiling of miRNA and the hairpin pre. (Brain)		mjTestesWT2()
Testes Data. (testes)		SRR059769(GSM562831)
Treg_Drosha. (spleen)		SRR345200(SRX097261)
source: size fractionated RNA from mouse hipp. (brain)		SRR042446(GSM539838)
mouse mature B cells (spleen) replicate 1 [09-002]. (b cell)		SRR391851(GSM852146)
gender: femalegenotype/variation: wild typeti. (embryo)		Ago2IP504(Rui)
Quantitative functions of Argonaute proteins . (ago2 skin)		SRR042468(GSM539860)
mouse Th1 cells [09-002]. (lymph)		SRR553584(SRX182790)
source: Heart. (Heart)		SRR394084(GSM855970)
background strain: C57BL6/SV129cell type: KRa. (dicer cell line)		SRR206942(GSM723283)
other. (brain)		SRR391849(GSM852144)
gender: femalegenotype/variation: ADAR2-/-tis. (embryo)		SRR042470(GSM539862)
mouse Th17 cells [09-002]. (lymph)		SRR042484(GSM539876)
mouse salivary gland tissue [09-002]. (salivary gland)		SRR042464(GSM539856)
mouse CD4+CD8+ T cells (thymus) [09-002]. (thymus)		SRR042445(GSM539837)
mouse immature B cells [09-002]. (b cell)		SRR402762(SRX117945)
source: ES E14 male cells. (ESC)		SRR039610(GSM527274)
small RNA-Seq. (brain)		SRR345207(SRX097268)
source: size fractionated RNA from mouse hipp. (brain)		SRR346422(SRX098264)
Global profiling of miRNA and the hairpin pre. (Muscle)		SRR038744(GSM527279)
small RNA-Seq. (brain)		GSM519104(GSM519104)
mouse_granulocyte_nuclei_smallRNAs. (cell line)		GSM640579(GSM640579)
small RNA in the liver with paternal Low pro. (liver)		SRR391845(GSM852140)
gender: femalegenotype/variation: wild typeti. (embryo)		GSM640578(GSM640578)
small RNA in the liver with paternal control. (liver)		SRR042461(GSM539853)
mouse dendritic cells [09-002]. (bone marrow)		SRR042473(GSM539865)
mouse nTreg cells [09-002]. (lymph)		SRR345205(SRX097266)
source: size fractionated RNA from mouse hipp. (brain)		GSM640581(GSM640581)
small RNA in the liver with paternal control. (liver)		SRR038743(GSM527278)
small RNA-Seq. (dicer brain)		SRR042451(GSM539843)
mouse B cells activated in vitro with LPS/aIgD-Dextran [09-002]. (b cell)		SRR042448(GSM539840)
mouse B cells activated in vitro with LPS/IL4 replicate 1 [09-002]. (b cell)		GSM509279(GSM509279)
MVH-/- E16.5 small RNA. (testes)		SRR248526(GSM733814)
cell type: Thy1- spermatogonial stem cellstra. (testes)		SRR306535(GSM750578)
19-24nt. (ago2 brain)		SRR248527(GSM733815)
cell type: spermatogonial stem cell enriched . (testes)		SRR042465(GSM539857)
mouse CD4+ T cells (spleen) [09-002]. (spleen)		SRR042454(GSM539846)
mouse germinal center B cells (lymph node) [09-002]. (b cell)		SRR059770(GSM562832)
Treg_Dicer. (spleen)		GSM509280(GSM509280)
small RNA cloning by length. (testes)		GSM475279(GSM475279)
Miwi-IP. (miwi testes)		GSM509278(GSM509278)
small RNA cloning by length. (piwi testes)		SRR346415(SRX098256)
source: Testis. (Testes)		SRR345203(SRX097264)
source: size fractionated RNA from mouse hipp. (brain)		GSM475280(GSM475280)
Mili-IP. (mili testes)		SRR206940(GSM723281)
other. (brain)		SRR346421(SRX098263)
Global profiling of miRNA and the hairpin pre. (mixture)		SRR038745(GSM527280)
small RNA-Seq. (dgcr8 brain)		SRR042472(GSM539864)
mouse iTreg cells [09-002]. (lymph)		SRR346420(SRX098261)
Global profiling of miRNA and the hairpin pre. (Uterus)		SRR553603(SRX182809)
source: Spermatids. (Spermatids)		SRR346413(SRX098254)
Global profiling of miRNA and the hairpin pre. (Heart)		SRR525244(SRA056111/SRX170320)
Mus musculus domesticus miRNA sequencing. (ago2 Blood)		SRR116846(GSM678422)
Small RNA deep sequencing from mouse epididym. (epididymis)		SRR042452(GSM539844)
mouse B1 B cells [09-002]. (b cell)		SRR306533(GSM750576)
19-24nt. (ago2 brain)		SRR065055(SRR065055)
Tissue-specific Regulation of Mouse MicroRNA . (jejunum)		SRR039183(GSM485323)
shLuc.1309 (-dox). (fibroblast)		SRR023852(GSM307161)
ZHBT-c424hsmallrna_rep1. (cell line)		SRR345202(SRX097263)
source: size fractionated RNA from mouse hipp. (brain)		SRR346416(SRX098257)
Global profiling of miRNA and the hairpin pre. (Kidney)		SRR248523(GSM733811)
cell type: Thy1+ spermatogonial stem cellstra. (testes)		SRR073954(GSM629280)
total RNA. (blood)		SRR306542(GSM750585)
19-24nt. (ago2 brain)		SRR345204(SRX097265)
source: size fractionated RNA from mouse hipp. (brain)		SRR345199(SRX097260)
source: size fractionated RNA from mouse hipp. (brain)		SRR042477(GSM539869)
mouse brain tissue [09-002]. (brain)		RuiDGCR8KO(Rui)
DGCR8-dependent microRNA biogenesis is essent. (dgcr8 skin)		SRR042455(GSM539847)
mouse plasma cells [09-002]. (blood)		RuiDGCR8WT(Rui)
DGCR8-dependent microRNA biogenesis is essent. (skin)		GSM509276(GSM509276)
small RNA cloning by length. (testes)		SRR042475(GSM539867)
mouse embryonic fibroblast cells [09-002]. (fibroblast)		SRR034121(GSM466731)
Mili IP_Tdrd9-/- replicate2. (mili testes)		SRR065052(SRR065052)
Tissue-specific Regulation of Mouse MicroRNA . (jejunum)		SRR095855BC1(SRX039178)
sequencing of miRNA from wild type and diseas. (heart)		GSM640580(GSM640580)
small RNA in the liver with paternal Low pro. (liver)		SRR029043(GSM433295)
18.5dpc_homo_tdrd1-KO. (tdrd1 testes)		SRR391850(GSM852145)
gender: femalegenotype/variation: ADAR2-/-/AD. (embryo)		SRR042466(GSM539858)
mouse CD8+ T cells (spleen) [09-002]. (spleen)		SRR206939(GSM723280)
other. (brain)		SRR042450(GSM539842)
mouse B cells activated in vitro with LPS/IL4 replicate 3 [09-002]. (b cell)		mjTestesWT3()
Testes Data. (testes)		SRR306541(GSM750584)
19-24nt. (ago2 brain)		SRR034119(GSM466729)
Mili IP_Tdrd9+/- replicate2. (mili testes)		SRR306534(GSM750577)
19-24nt. (ago2 brain)		SRR065054(SRR065054)
Tissue-specific Regulation of Mouse MicroRNA . (jejunum)		SRR073955(GSM629281)
total RNA. (blood)		SRR042457(GSM539849)
mouse mast cells [09-002]. (bone marrow)		SRR042487(GSM539879)
mouse BclXL B activated with LPS/IL4 [BalbC] [09-002]. (spleen)		SRR042456(GSM539848)
mouse hematopoetic progenitor cells [09-002]. (bone marrow)		SRR685339(GSM1079783)
Small RNAs (15-50 nts in length) from immorta. (cell line)		SRR014231(GSM319955)
16.5 dpc total. (testes)		GSM510444(GSM510444)
brain_rep5. (brain)		SRR069809(GSM610965)
small RNA sequencing; sample 1. (testes)		SRR306544(GSM750587)
19-24nt. (ago2 brain)		SRR306531(GSM750574)
19-24nt. (ago2 brain)		SRR553604(SRX182810)
source: Spermatocytes. (Spermatocytes)		SRR065047(SRR065047)
Tissue-specific Regulation of Mouse MicroRNA . (liver)		SRR279903(GSM689053)
cell type: mouse embryonic stem cellcell line. (ESC)		SRR042483(GSM539875)
mouse muscle tissue [09-002]. (muscle)		GSM314557(GSM314557)
ESC dgcr8 (Illumina). (ESC)		mjTestesKO8()
Testes Data. (Zcchc11 testes)
...........................................................CTAAGTCCCACAAGATGT............................................................................................................................................................................. 182.000.00----------------------------------------------2.00--------------------------------------------------------------------------------------------------
....................................................................................................................................................................................TGGTTCTCTCCACCTCTCGG.................................................. 201.000.00----------------------------------------------1.00--------------------------------------------------------------------------------------------------
..................CATTCAGTCTCTCCAGAA...................................................................................................................................................................................................................... 1811.001.00----------------------------------------------1.00--------------------------------------------------------------------------------------------------
..................................................TTTATGATTCTAAGTCCGA..................................................................................................................................................................................... 191.000.00---------------------------------------------------------------------------------------------------------------------1.00---------------------------
......................................................................................................................................................................................GTTCTCTCCACCTCTTGGC................................................. 191.000.00------------------------------------------------------------------------------------------------------------1.00------------------------------------