ID: mmu-mir-6904
GENE: Parp1(7)
chr1:182517192-182517441+


(1)
AGO.mut 		(3)
AGO1.ip 		(9)
AGO2.ip 		(2)
AGO3.ip 		(12)
B-CELL 		(13)
BRAIN 		(5)
CELL-LINE 		(2)
DGCR8.mut 		(9)
EMBRYO 		(13)
ESC 		(3)
FIBROBLAST 		(1)
HEART 		(7)
LIVER 		(1)
LUNG 		(1)
LYMPH 		(17)
OTHER 		(6)
OTHER.mut 		(3)
PIWI.ip 		(6)
SKIN 		(6)
SPLEEN 		(18)
TESTES 		(3)
THYMUS 		(3)
TOTAL-RNA

Sense strand
TGCCCTCTGTTTCCCCGCTGCCTGTTGGCGCCTGTCTTCATAAAGTTTTCCCAAAGAAAAGAGTGAAGACCAAGGCTGGCCAGGCTCTGTGGCTTCTATGGTTTCTCCTAAAGCCAGCTGTTTTGTCTTGCCTCCATTCATCCTTTCCTGGGGTTAGAGTTGAGTGGTCGTAGCCTGTTGCTTCTGATCTCTTACCCCAGACAAGCCCCTGTCTAACATGAAGATCCTGACTCTTGGGAAGCTCTCCCAG
..............................................................................................................................................(((..(((((((.((((.....(((..((((....))))..)))..)))).)))))))..))).............................................
............................................................................................................................................141...............................................................207.........................................
SizePerfect hitTotal NormPerfect NormSRR391852(GSM852147)
gender: femalegenotype/variation: ADAR2-/-tis. (embryo)		SRR546155(SRX180174)
Global profiling of miRNA and the hairpin pre. (ago2 Neuroblastoma)		SRR391851(GSM852146)
gender: femalegenotype/variation: wild typeti. (embryo)		SRR402760(SRX117943)
source: ES E14 male cells. (ESC)		SRR391853(GSM852148)
gender: femalegenotype/variation: ADAR2-/-/AD. (embryo)		SRR279904(GSM689054)
cell type: mouse embryonic stem cellcell line. (ESC)		SRR042443(GSM539835)
mouse pro B cells [09-002]. (b cell)		SRR346424(SRX098266)
Global profiling of miRNA and the hairpin pre. (Neuroblastoma)		mjLiverKO1()
Liver Data. (Zcchc11 liver)		SRR402762(SRX117945)
source: ES E14 male cells. (ESC)		SRR391848(GSM852143)
gender: femalegenotype/variation: wild typeti. (embryo)		SRR248525(GSM733813)
cell type: Thy1- spermatogonial stem cellstra. (testes)		GSM314557(GSM314557)
ESC dgcr8 (Illumina). (ESC)		SRR346425(SRX098267)
Global profiling of miRNA and the hairpin pre. (Neuroblastoma)		SRR402761(SRX117944)
source: ES E14 male cells. (ESC)		SRR553602(SRX182808)
source: Sertoli cells. (Sertoli cells)		SRR248526(GSM733814)
cell type: Thy1- spermatogonial stem cellstra. (testes)		mjLiverKO3()
Liver Data. (Zcchc11 liver)		mjLiverWT3()
Liver Data. (liver)		SRR402766(SRX117949)
source: ES PGK female cells. (ESC)		SRR390300(GSM849858)
cell line: NIH-3T3cell type: fibroblastinfect. (ago2 fibroblast)		Ago2IP504(Rui)
Quantitative functions of Argonaute proteins . (ago2 skin)		SRR391850(GSM852145)
gender: femalegenotype/variation: ADAR2-/-/AD. (embryo)		SRR029043(GSM433295)
18.5dpc_homo_tdrd1-KO. (tdrd1 testes)		SRR042448(GSM539840)
mouse B cells activated in vitro with LPS/IL4 replicate 1 [09-002]. (b cell)		SRR279906(GSM689056)
cell type: mouse embryonic stem cellcell line. (ESC)		SRR059767(GSM562829)
DN3_Dicer. (thymus)		SRR042452(GSM539844)
mouse B1 B cells [09-002]. (b cell)		SRR037914(GSM510451)
newborn_rep7. (total RNA)		SRR042449(GSM539841)
mouse B cells activated in vitro with LPS/IL4 replicate 2 [09-002]. (b cell)		SRR042447(GSM539839)
mouse mature B cells (spleen) replicate 2 [09-002]. (b cell)		SRR073954(GSM629280)
total RNA. (blood)		SRR345202(SRX097263)
source: size fractionated RNA from mouse hipp. (brain)		SRR042454(GSM539846)
mouse germinal center B cells (lymph node) [09-002]. (b cell)		SRR248527(GSM733815)
cell type: spermatogonial stem cell enriched . (testes)		SRR023849(GSM307158)
NPCsmallrna_rep1. (cell line)		GSM510456(GSM510456)
newborn_rep12. (total RNA)		SRR206941(GSM723282)
other. (brain)		SRR037929(GSM510467)
e7p5_rep3. (embryo)		SRR345204(SRX097265)
source: size fractionated RNA from mouse hipp. (brain)		SRR042444(GSM539836)
mouse pre B cells [09-002]. (b cell)		SRR525243(SRA056111/SRX170319)
Mus musculus domesticus miRNA sequencing. (ago2 Blood)		SRR040488(GSM533911)
E18.5 wild type LIVER small RNA. (liver)		SRR391846(GSM852141)
gender: femalegenotype/variation: ADAR2-/-tis. (embryo)		SRR279903(GSM689053)
cell type: mouse embryonic stem cellcell line. (ESC)		SRR279907(GSM689057)
cell type: mouse embryonic stem cellcell line. (ESC)		SRR042471(GSM539863)
mouse TFHS cells [09-002]. (spleen)		SRR069809(GSM610965)
small RNA sequencing; sample 1. (testes)		SRR553582(SRX182788)
source: Brain. (Brain)		SRR042473(GSM539865)
mouse nTreg cells [09-002]. (lymph)		Ago3IP812(Rui)
Quantitative functions of Argonaute proteins . (ago3 skin)		GSM314552(GSM314552)
ESC wild type (Illumina). (ESC)		SRR042445(GSM539837)
mouse immature B cells [09-002]. (b cell)		mjTestesKO8()
Testes Data. (Zcchc11 testes)		SRR042451(GSM539843)
mouse B cells activated in vitro with LPS/aIgD-Dextran [09-002]. (b cell)		SRR346419(SRX098260)
Global profiling of miRNA and the hairpin pre. (Lung)		SRR034119(GSM466729)
Mili IP_Tdrd9+/- replicate2. (mili testes)		SRR023847(GSM307156)
mESv6.5smallrna_rep1. (cell line)		SRR059766(GSM562828)
DN3_Drosha. (thymus)		SRR059765(GSM562827)
DN3_control. (thymus)		SRR553583(SRX182789)
source: Cerebellum. (Cerebellum)		Ago1IP812(Rui)
Quantitative functions of Argonaute proteins . (ago1 skin)		SRR042458(GSM539850)
mouse basophil cells [09-002]. (b cell)		SRR042456(GSM539848)
mouse hematopoetic progenitor cells [09-002]. (bone marrow)		SRR042487(GSM539879)
mouse BclXL B activated with LPS/IL4 [BalbC] [09-002]. (spleen)		SRR346423(SRX098265)
Global profiling of miRNA and the hairpin pre. (Brain)		SRR038742(GSM527277)
small RNA-Seq. (dgcr8 brain)		SRR065050(SRR065050)
Tissue-specific Regulation of Mouse MicroRNA . (liver)		SRR306542(GSM750585)
19-24nt. (ago2 brain)		SRR346422(SRX098264)
Global profiling of miRNA and the hairpin pre. (Muscle)		SRR248523(GSM733811)
cell type: Thy1+ spermatogonial stem cellstra. (testes)		SRR306528(GSM750571)
19-24nt. (ago2 brain)		GSM509279(GSM509279)
MVH-/- E16.5 small RNA. (testes)		Ago3IP805(Rui)
Quantitative functions of Argonaute proteins . (ago3 skin)		SRR345198(SRX097259)
source: size fractionated RNA from mouse hipp. (brain)		SRR065054(SRR065054)
Tissue-specific Regulation of Mouse MicroRNA . (jejunum)		SRR042446(GSM539838)
mouse mature B cells (spleen) replicate 1 [09-002]. (b cell)		SRR059769(GSM562831)
Treg_Drosha. (spleen)		SRR037912(GSM510449)
newborn_rep5. (total RNA)		Ago1IP517(Rui)
Quantitative functions of Argonaute proteins . (ago1 skin)		mjTestesKO7()
Testes Data. (Zcchc11 testes)		SRR039184(GSM485324)
shLuc.1309 (+dox). (fibroblast)		SRR042465(GSM539857)
mouse CD4+ T cells (spleen) [09-002]. (spleen)		SRR553604(SRX182810)
source: Spermatocytes. (Spermatocytes)		SRR391845(GSM852140)
gender: femalegenotype/variation: wild typeti. (embryo)		GSM314553(GSM314553)
ESC dcr (Illumina). (ESC)		SRR306531(GSM750574)
19-24nt. (ago2 brain)		SRR014229(GSM319953)
10 dpp MILI. (mili testes)		SRR038745(GSM527280)
small RNA-Seq. (dgcr8 brain)		mjTestesWT2()
Testes Data. (testes)		SRR042455(GSM539847)
mouse plasma cells [09-002]. (blood)		SRR014231(GSM319955)
16.5 dpc total. (testes)		SRR248524(GSM733812)
cell type: Thy1+ spermatogonial stem cellstra. (testes)		GSM519104(GSM519104)
mouse_granulocyte_nuclei_smallRNAs. (cell line)		SRR059768(GSM562830)
Treg_control. (spleen)		SRR042450(GSM539842)
mouse B cells activated in vitro with LPS/IL4 replicate 3 [09-002]. (b cell)		SRR346415(SRX098256)
source: Testis. (Testes)		GSM314559(GSM314559)
ESC dgcr8 (454). (ESC)		SRR279905(GSM689055)
cell type: mouse embryonic stem cellcell line. (ESC)		SRR039154(GSM471931)
HL1_siSrf2_smallRNAseq. (muscle)		SRR525241(SRA056111/SRX170317)
Mus musculus domesticus miRNA sequencing. (ago1 Blood)		SRR525244(SRA056111/SRX170320)
Mus musculus domesticus miRNA sequencing. (ago2 Blood)		SRR039186(GSM485326)
shLuc.1309;ROSA-rtTA (+dox). (fibroblast)		GSM640580(GSM640580)
small RNA in the liver with paternal Low pro. (liver)		SRR346417(SRX098258)
Global profiling of miRNA and the hairpin pre. (Brain)		mjTestesKO6()
Testes Data. (Zcchc11 testes)		SRR037920(GSM510458)
e12p5_rep2. (embryo)		SRR023850(GSM307159)
ZHBT-c40hsmallrna_rep1. (cell line)		SRR345201(SRX097262)
source: size fractionated RNA from mouse hipp. (brain)		SRR029123(GSM416611)
NIH3T3. (cell line)		SRR065055(SRR065055)
Tissue-specific Regulation of Mouse MicroRNA . (jejunum)		SRR040489(GSM533912)
E18.5 Ago2 catalytically inactive LIVER small RNA. (ago2 liver)		SRR042467(GSM539859)
mouse T cells activated in vitro with Concanavalin A [09-002]. (spleen)		Ago2IP517(Rui)
Quantitative functions of Argonaute proteins . (ago2 skin)		SRR014232(GSM319956)
16.5 dpc MILI. (mili testes)		SRR553584(SRX182790)
source: Heart. (Heart)		SRR553586(SRX182792)
source: Testis. (testes)		SRR116846(GSM678422)
Small RNA deep sequencing from mouse epididym. (epididymis)
.................................................................................................................................................TCCTGGGGTTAGAGTTGAGTGG...................................................................................22163.0063.002.001.004.002.001.004.004.002.00-----2.00--1.002.005.001.00-1.001.001.00--1.002.001.001.00----2.00--1.001.00-1.00-1.00--2.00----1.001.001.00-1.00---1.001.00----1.00-1.00--------1.001.00-1.00-----------1.00------1.00-----1.00--------1.001.00----
................................................................................................................................................TTCCTGGGGTTAGAGTTGAGTGG...................................................................................23128.0028.001.00-2.00-1.001.00---1.001.001.003.00-1.001.001.001.00-----1.002.00---2.00-------1.00---------1.00---1.00------2.00-----------------------1.00--1.00-1.00-------------------------------
.................................................................................................................................................TCCTGGGGTTAGAGTTGAGTGGT..................................................................................23114.0014.00-2.001.00--3.001.00---1.00-----1.00-------1.00----------------1.00----------1.00------------------------------------1.00----------1.00-----------------
......................................................................................................................................................................................TCTGATCTCTTACCCCAGAAA...............................................21114.006.00---------3.00----2.00----1.00------------3.00-----------1.00--------1.00------1.00-----------------------------------1.00--------1.00------------
......................................................................................................................................................................................TCTGATCTCTTACCCCAGAAG...............................................21114.006.00-4.00--1.00---5.00----1.002.00----------------------------------------1.00--------------------------------------------------------------
...............................................................................................................................................TTTCCTGGGGTTAGAGTTGAGT.....................................................................................2217.007.00-1.00-----1.00------------4.00------------------------------1.00------------------------------------------------------------------
.................................................................................................................................................TCCTGGGGTTAGAGTTGAGTGGA..................................................................................2317.0063.00--------------------------1.00----------------1.00---------------1.00-1.00-1.00---------------1.00---1.00----------------------------------
...............................................................................................................................................TTTCCTGGGGTTAGAGTTGAGTGG...................................................................................2417.007.00----1.00--1.00-------1.00---1.00-----------------------------------------------1.00-------------------1.00-----1.00------------------------
......................................................................................................................................................................................TCTGATCTCTTACCCCAGA.................................................1916.006.00-------1.00-2.00-1.001.001.00--------------------------------------------------------------------------------------------------------
..................................................................................................................................................CCTGGGGTTAGAGTTGAGTGG...................................................................................2115.005.001.00-1.00------------2.00--------------------------------1.00---------------------------------------------------------------------
.................................................................................................................................................TCCTGGGGTTAGAGTTGAGTGA...................................................................................2215.003.00------1.001.00----------------------------1.00---------1.00------------------------------------------------------1.00----------------
......................................................................................................................................................................................TCTGATCTCTTACCCCAGAGA...............................................2115.006.00--1.003.00---------1.00--------------------------------------------------------------------------------------------------------
...........................................................................................................................................................................................................................GAAGATCCTGACTCTTGGGAAGCT.......2415.005.003.00---2.00-----------------------------------------------------------------------------------------------------------------
......................................................................................................................................................................................................................AACATGAAGATCCTGACTCT................2014.004.00--1.00-------------------2.00------------------------------------------------------------------------1.00----------------------
...........................................................................................................................................ATCCTTTCCTGGGGTTAGAGTTGAG......................................................................................2514.004.00---3.00-----------------------------------------------------------------------------------------------------------------1.00
.................................................................................................................................................TCCTGGGGTTAGAGTTGAGT.....................................................................................2014.004.00---------------------1.00--1.00-1.00-----------------------------------1.00-------------------------------------------------------
................................................................................................................................................TTCCTGGGGTTAGAGTTGAGTGGT..................................................................................2414.004.00----------------1.00--1.00---------------------------------------------------------1.00-------------1.00--------------------------
.....................................................................................................................................................................................TTCTGATCTCTTACCCCAGAGA...............................................2214.001.002.00-1.00-----------------------------------1.00-------------------------------------------------------------------------------
................................................................................................................................................TTCCTGGGGTTAGAGTTGAGT.....................................................................................2114.004.00---------------------2.00--------------------1.00-----------------1.00---------------------------------------------------------
......................................................................................................................................................................................TCTGATCTCTTACCCCAAAAA...............................................214.000.00---4.00------------------------------------------------------------------------------------------------------------------
.................................................................................................................................................TCCTGGGGTTAGAGTTGAGTG....................................................................................2113.003.00----------------------------------------------------------1.00-------------------------------------------1.00-------1.00-------
......................................................................................................................................................................................TCTGATCTCTTACCCCAGACA...............................................2113.003.00-------------------------1.00---------------------------------------1.00----1.00-----------------------------------------------
......................................................................................................................................................................................TCTGATCTCTTACCCCAGAAAA..............................................2213.006.00----1.00----1.00------1.00-----------------------------------------------------------------------------------------------------
......................................................................................................................................................................................TCTGATCTCTTACCCCAGTTT...............................................2113.001.00-----------1.00-----------------------2.00----------------------------------------------------------------------------------
....................................................................................................................................................................................................................CTAACATGAAGATCCTGACTCT................2213.003.00--1.00-------1.00------------------1.00----------------------------------------------------------------------------------------
......................................................................................................................................................................................TCTGATCTCTTACCCCAGAGAAA.............................................2313.006.00--------3.00-------------------------------------------------------------------------------------------------------------
......................................................................................................................................................................................................................AACATGAAGATCCTGACTC.................1913.003.00-----------------------------1.00---1.00---------1.00--------------------------------------------------------------------------
......................................................................................................................................................................................TCTGATCTCTTACCCCAGAAGA..............................................2213.006.00----1.00-----------------1.00--------------------------------------------------------------------------------------------1.00--
...........................................................................................................................................................................................................................GAAGATCCTGACTCTTGGGA...........2013.003.00--1.00-1.00-----1.00-----------------------------------------------------------------------------------------------------------
...............................................................................................................................................TTTCCTGGGGTTAGAGTTGAG......................................................................................2113.003.00------------------------------1.00------------------2.00--------------------------------------------------------------------
................................................................................................................................................TTCCTGGGGTTAGAGTTGAGTG....................................................................................2212.002.00-------------------------------1.00------------1.00-------------------------------------------------------------------------
................................................................................................................................................TTCCTGGGGTTAGAGTTGAGTGT...................................................................................2312.002.00-----------------------1.00---1.00------------------------------------------------------------------------------------------
......................................................................................................................................................................................TCTGATCTCTTACCCCAAAA................................................202.000.00-------------------------------2.00--------------------------------------------------------------------------------------
.................................................................................................................................................TCCTGGGGTTAGAGTTGAGTGT...................................................................................2212.003.00------1.00-------------------1.00-------------------------------------------------------------------------------------------
.....................................................................................................................................................................................TTCTGATCTCTTACCCCAGAAA...............................................2212.001.00----------1.00-----------------------------------------------------------------------------------------------1.00-----------
.......................................................................................................................................................................................................................ACATGAAGATCCTGACT..................1712.002.00-------------------------2.00--------------------------------------------------------------------------------------------
..................................................................................................................................................CCTGGGGTTAGAGTTGAGTGGT..................................................................................2212.002.00-2.00--------------------------------------------------------------------------------------------------------------------
................................................................................................................................................TTCCTGGGGTTAGAGTTGAGTGA...................................................................................2312.002.00----1.00-----------------------------------1.00-----------------------------------------------------------------------------
................................................................................................................................................................................................................CTGTCTAACATGAAGATCC.......................1912.002.00-----1.00--------------------------------------------------------------------------------------------1.00-------------------
......................................................................................................................................................................................................................AACATGAAGATCCTGACTCTT...............2112.002.001.00---1.00-----------------------------------------------------------------------------------------------------------------
.................................................................................................................................................TCCTGGGGTTAGAGTTGCGT.....................................................................................202.000.00-------------------------------------------------------------1.00-----------1.00--------------------------------------------
......................................................................................................................................................................................TCTGATCTCTTACCCCAGAATT..............................................2212.006.00-----------1.00-----------1.00----------------------------------------------------------------------------------------------
.......................................................................................................................................................................................................................ACATGAAGATCCTGACTCT................1912.002.002.00---------------------------------------------------------------------------------------------------------------------
......................................................................................................................................................................................TCTGATCTCTTACCCCAGAAT...............................................2112.006.00-1.00--------------------------------------------------------------------------------------1.00-----------------------------
...........................................................................................................................................................................................................................GAAGATCCTGACTCTTGGGAAG.........2212.002.00----------1.00------------------------------------1.00----------------------------------------------------------------------
................................................................................................................................................TTCCTGGGGTTAGAGTTGAGTGC...................................................................................2311.002.00----------------------------------------------------------------------------------------------1.00-----------------------
......................................................................................................................................................................................................................AACATGAAGATCCTGACTCTTGGGAAGCTC......3011.001.00--------------------------------------------------------------------------------------------------------1.00-------------
........................................................................................................................................................................................................................CATGAAGATCCTGACTCTTG..............2011.001.00-----------------------------------------------1.00----------------------------------------------------------------------
...................................................................................................................................................................................................................TCTAACATGAAGATCCTGACTCTTGGGAAGC........3111.001.00----------------------------------1.00-----------------------------------------------------------------------------------
.............................................................................................................................................CCTTTCCTGGGGTTAGAGTTGAGT.....................................................................................2411.001.00-------------------------------------------------------------------------------------------------------------1.00--------
......................................................................................................................................................................................TCTGATCTCTTACCCCAGACT...............................................211.000.00---------------1.00------------------------------------------------------------------------------------------------------
..................................................................................................................................................CCTGGGGTTAGAGTTGAG......................................................................................1811.001.00-------------------------------------------------------1.00--------------------------------------------------------------
.................................................................................................................................................TCCTGGGGTTAGAGTTGAGGGT...................................................................................2211.001.00----------------------------------------------------------------------------------1.00-----------------------------------
.............................................................................................................................................................................................................................AGATCCTGACTCTTGGGA...........1811.001.001.00---------------------------------------------------------------------------------------------------------------------
..................................................................................................................................................................AGTGGTCGTAGCCTGCAT......................................................................181.000.00--------------------------------------------------------------------------1.00-------------------------------------------
................................................................................................................................................TTCCTGGGGTTAGAGTTGAG......................................................................................2011.001.00------------------------------------------------1.00---------------------------------------------------------------------
......................................................................................................................................................................................TCTGATCTCTTACCCCAGAA................................................2011.006.00-------1.00--------------------------------------------------------------------------------------------------------------
.....................................................................................................................................................................................................................TAACATGAAGATCCTGACTCTTGGGAAGCTC......3111.001.00--------------------------------------------------------------------------------------------------------------------1.00-
......................................................................................................................................................................................TCTGATCTCTTACCCCAGAAAAA.............................................2311.006.00-----------------------------------------------------------------------------------------------------------1.00----------
..................................................................................................................................................CCTGGGGTTAGAGTTGAGTGT...................................................................................211.000.00------1.00---------------------------------------------------------------------------------------------------------------
.................................................................................................................................................TCCTGGGGTTAGAGTTGAG......................................................................................1911.001.001.00---------------------------------------------------------------------------------------------------------------------
......................................................................................................................................................................................................................AACATGAAGATCCTGACT..................1811.001.00---------------------------------1.00------------------------------------------------------------------------------------
................................................................................................................................................TTCCTGGGGTTAGAGTTGAGTA....................................................................................2211.004.00-----------------------------------------1.00----------------------------------------------------------------------------
....................................................................................................................................................................................................................CTAACATGAAGATCCTGCTGT.................211.000.001.00---------------------------------------------------------------------------------------------------------------------
...............................................................................................................................................TTTCCTGGGGTTAGAGTTGAGTAT...................................................................................2411.007.00------------------------------1.00---------------------------------------------------------------------------------------
..........................................................................................................................................................................................................................TGAAGATCCTGACTCTTGGGAAGCTC......2611.001.00--------------------------------------------------------1.00-------------------------------------------------------------
.............................................................................................................................................CCTTTCCTGGGGTTAGAGTTGAG......................................................................................2311.001.00-1.00--------------------------------------------------------------------------------------------------------------------
...............................................................................................................................................TTTCCTGGGGTTAGAGTTGAGTGGA..................................................................................2511.007.001.00---------------------------------------------------------------------------------------------------------------------
.................................................................................................................................................TCCTGGGGTTAGAGTTGAGTGTT..................................................................................2311.003.00------1.00---------------------------------------------------------------------------------------------------------------
......................................................................................................................................................................................................................AACATGAAGATCCTGACTCTTG..............2211.001.00--------------------------------------------------------------------------------------------1.00-------------------------
......................................................................................................................................................................................TCTGATCTCTTACCCCAGAAGT..............................................2211.006.00-----1.00----------------------------------------------------------------------------------------------------------------
.................................................................................................................................................TCCTGGGGTTAGAGTTGAGTGGAT.................................................................................2411.0063.00-------------1.00--------------------------------------------------------------------------------------------------------
....................................................................................................................................................................................................................CTAACATGAAGATCCTGA....................1811.001.00------------------------------------------------------1.00---------------------------------------------------------------
......................................................................................................................................................................................TCTGATCTCTTACCCCAGAGT...............................................2111.006.00-----------1.00----------------------------------------------------------------------------------------------------------
...........................................................AGAGTGAAGACCAAGGCTGG...........................................................................................................................................................................2011.001.00------------------------------------------------------------------------1.00---------------------------------------------
..................................................................................................................................................................................................................GTCTAACATGAAGATCC.......................1711.001.00-------------------------1.00--------------------------------------------------------------------------------------------
................................................................................................................................................TTCCTGGGGTTAGAGTTGAGTGGTAT................................................................................2611.004.00------------------------------1.00---------------------------------------------------------------------------------------
..................................................................................................................................................CCTGGGGTTAGAGTTGAGTGGAA.................................................................................2311.005.00-----------------------------------------------------1.00----------------------------------------------------------------
..................................................................................................................................................................AGTGGTCGTAGCCTGTATGG....................................................................201.000.00-----------------------------------------------------------------------1.00----------------------------------------------
..............................................................................................................................................CTTTCCTGGGGTTAGAGTTGAG......................................................................................2211.001.00-1.00--------------------------------------------------------------------------------------------------------------------
........................................................................................................................................................................................................................CATGAAGATCCTGACCGT................181.000.00---------------------------------1.00------------------------------------------------------------------------------------
...................................................................................................................................................CTGGGGTTAGAGTTGAGTGG...................................................................................2011.001.00-----------------1.00----------------------------------------------------------------------------------------------------
......................................................................................................................................................................................TCTGATCTCTTACCCCAGAAGC..............................................2211.006.001.00---------------------------------------------------------------------------------------------------------------------
......................................................................................................................................................................................TCTGATCTCTTACCCCAGCAGT..............................................2211.001.00------1.00---------------------------------------------------------------------------------------------------------------
......................................................................................................................................................................................TCTGATCTCTTACCCCAGATTT..............................................2211.006.00-----------1.00----------------------------------------------------------------------------------------------------------
.....................................................................................................................................................................................................................TAACATGAAGATCCTGACTCTT...............2211.001.00---------------------------1.00------------------------------------------------------------------------------------------
......................................................................................................................................................................................TCTGATCTCTTACCCCAGATAGA.............................................2311.006.00----------1.00-----------------------------------------------------------------------------------------------------------
................................................................................................................................................TTCCTGGGGTTAGAGTTGAGTGGTTT................................................................................2611.004.00------------------------------------------------------------------------------------------------------------------1.00---
................................................................................................................................................TTCCTGGGGTTAGAGTTGAGCGG...................................................................................2311.001.00---------------------------------------------------------------------1.00------------------------------------------------
.........................................AAAGTTTTCCCAAAGAAAAGA............................................................................................................................................................................................2111.001.001.00---------------------------------------------------------------------------------------------------------------------
.....................................................................................................................................................................................TTCTGATCTCTTACCCCAGA.................................................2011.001.00-1.00--------------------------------------------------------------------------------------------------------------------
.....................................................................................................................................................................................TTCTGATCTCTTACCCCA...................................................1811.001.00------------1.00---------------------------------------------------------------------------------------------------------
......................................................................................................................................................................................................AGACAAGCCCCTGTCTAAC.................................1911.001.00----------1.00-----------------------------------------------------------------------------------------------------------
.............................................................................................................................................................................CCTGTTGCTTCTGATCTCTTACCCCAG..................................................2711.001.00-------1.00--------------------------------------------------------------------------------------------------------------
.........................................................................................................................................................................................................................ATGAAGATCCTGACTCTTGGGAAGC........2511.001.00-------------------------------------1.00--------------------------------------------------------------------------------
......................................................................................................................................................................................TCTGATCTCTTACCCCAG..................................................1811.001.00-------------------------------------------------------------------------------------1.00--------------------------------
.................................................................................................................................................TCCTGGGGTTAGAGTTGA.......................................................................................1811.001.00------------1.00---------------------------------------------------------------------------------------------------------
.............................................................................................................................................................................................................CCCCTGTCTAACATGAAGATCCTG.....................2411.001.00---------------------------------------------------------------------------------------------------------------1.00------
...................................................................................................................................................CTGGGGTTAGAGTTGAGGGG...................................................................................201.000.00-----------------1.00----------------------------------------------------------------------------------------------------
.............................................................................................................................................................AGTTGAGTGGTCGTAGCCTGTTG......................................................................2311.001.00---------1.00------------------------------------------------------------------------------------------------------------
..........................................................................................................................................................................................................................TGAAGATCCTGACTCTTGGGAAGCTCA.....2711.001.00--------------------------------------------------------1.00-------------------------------------------------------------
.......................................................................................................................................................................TCGTAGCCTGTTGCTTCTGATCTCTTACCCCAG..................................................3311.001.00--------------------------------------------------------------------------------1.00-------------------------------------
..................................................................................................................................................CCTGGGGTTAGAGTTGAGTGA...................................................................................211.000.00--------------------------------------------------------------------1.00-------------------------------------------------

Antisense strand
TGCCCTCTGTTTCCCCGCTGCCTGTTGGCGCCTGTCTTCATAAAGTTTTCCCAAAGAAAAGAGTGAAGACCAAGGCTGGCCAGGCTCTGTGGCTTCTATGGTTTCTCCTAAAGCCAGCTGTTTTGTCTTGCCTCCATTCATCCTTTCCTGGGGTTAGAGTTGAGTGGTCGTAGCCTGTTGCTTCTGATCTCTTACCCCAGACAAGCCCCTGTCTAACATGAAGATCCTGACTCTTGGGAAGCTCTCCCAG
..............................................................................................................................................(((..(((((((.((((.....(((..((((....))))..)))..)))).)))))))..))).............................................
............................................................................................................................................141...............................................................207.........................................
SizePerfect hitTotal NormPerfect NormSRR391852(GSM852147)
gender: femalegenotype/variation: ADAR2-/-tis. (embryo)		SRR546155(SRX180174)
Global profiling of miRNA and the hairpin pre. (ago2 Neuroblastoma)		SRR391851(GSM852146)
gender: femalegenotype/variation: wild typeti. (embryo)		SRR402760(SRX117943)
source: ES E14 male cells. (ESC)		SRR391853(GSM852148)
gender: femalegenotype/variation: ADAR2-/-/AD. (embryo)		SRR279904(GSM689054)
cell type: mouse embryonic stem cellcell line. (ESC)		SRR042443(GSM539835)
mouse pro B cells [09-002]. (b cell)		SRR346424(SRX098266)
Global profiling of miRNA and the hairpin pre. (Neuroblastoma)		mjLiverKO1()
Liver Data. (Zcchc11 liver)		SRR402762(SRX117945)
source: ES E14 male cells. (ESC)		SRR391848(GSM852143)
gender: femalegenotype/variation: wild typeti. (embryo)		SRR248525(GSM733813)
cell type: Thy1- spermatogonial stem cellstra. (testes)		GSM314557(GSM314557)
ESC dgcr8 (Illumina). (ESC)		SRR346425(SRX098267)
Global profiling of miRNA and the hairpin pre. (Neuroblastoma)		SRR402761(SRX117944)
source: ES E14 male cells. (ESC)		SRR553602(SRX182808)
source: Sertoli cells. (Sertoli cells)		SRR248526(GSM733814)
cell type: Thy1- spermatogonial stem cellstra. (testes)		mjLiverKO3()
Liver Data. (Zcchc11 liver)		mjLiverWT3()
Liver Data. (liver)		SRR402766(SRX117949)
source: ES PGK female cells. (ESC)		SRR390300(GSM849858)
cell line: NIH-3T3cell type: fibroblastinfect. (ago2 fibroblast)		Ago2IP504(Rui)
Quantitative functions of Argonaute proteins . (ago2 skin)		SRR391850(GSM852145)
gender: femalegenotype/variation: ADAR2-/-/AD. (embryo)		SRR029043(GSM433295)
18.5dpc_homo_tdrd1-KO. (tdrd1 testes)		SRR042448(GSM539840)
mouse B cells activated in vitro with LPS/IL4 replicate 1 [09-002]. (b cell)		SRR279906(GSM689056)
cell type: mouse embryonic stem cellcell line. (ESC)		SRR059767(GSM562829)
DN3_Dicer. (thymus)		SRR042452(GSM539844)
mouse B1 B cells [09-002]. (b cell)		SRR037914(GSM510451)
newborn_rep7. (total RNA)		SRR042449(GSM539841)
mouse B cells activated in vitro with LPS/IL4 replicate 2 [09-002]. (b cell)		SRR042447(GSM539839)
mouse mature B cells (spleen) replicate 2 [09-002]. (b cell)		SRR073954(GSM629280)
total RNA. (blood)		SRR345202(SRX097263)
source: size fractionated RNA from mouse hipp. (brain)		SRR042454(GSM539846)
mouse germinal center B cells (lymph node) [09-002]. (b cell)		SRR248527(GSM733815)
cell type: spermatogonial stem cell enriched . (testes)		SRR023849(GSM307158)
NPCsmallrna_rep1. (cell line)		GSM510456(GSM510456)
newborn_rep12. (total RNA)		SRR206941(GSM723282)
other. (brain)		SRR037929(GSM510467)
e7p5_rep3. (embryo)		SRR345204(SRX097265)
source: size fractionated RNA from mouse hipp. (brain)		SRR042444(GSM539836)
mouse pre B cells [09-002]. (b cell)		SRR525243(SRA056111/SRX170319)
Mus musculus domesticus miRNA sequencing. (ago2 Blood)		SRR040488(GSM533911)
E18.5 wild type LIVER small RNA. (liver)		SRR391846(GSM852141)
gender: femalegenotype/variation: ADAR2-/-tis. (embryo)		SRR279903(GSM689053)
cell type: mouse embryonic stem cellcell line. (ESC)		SRR279907(GSM689057)
cell type: mouse embryonic stem cellcell line. (ESC)		SRR042471(GSM539863)
mouse TFHS cells [09-002]. (spleen)		SRR069809(GSM610965)
small RNA sequencing; sample 1. (testes)		SRR553582(SRX182788)
source: Brain. (Brain)		SRR042473(GSM539865)
mouse nTreg cells [09-002]. (lymph)		Ago3IP812(Rui)
Quantitative functions of Argonaute proteins . (ago3 skin)		GSM314552(GSM314552)
ESC wild type (Illumina). (ESC)		SRR042445(GSM539837)
mouse immature B cells [09-002]. (b cell)		mjTestesKO8()
Testes Data. (Zcchc11 testes)		SRR042451(GSM539843)
mouse B cells activated in vitro with LPS/aIgD-Dextran [09-002]. (b cell)		SRR346419(SRX098260)
Global profiling of miRNA and the hairpin pre. (Lung)		SRR034119(GSM466729)
Mili IP_Tdrd9+/- replicate2. (mili testes)		SRR023847(GSM307156)
mESv6.5smallrna_rep1. (cell line)		SRR059766(GSM562828)
DN3_Drosha. (thymus)		SRR059765(GSM562827)
DN3_control. (thymus)		SRR553583(SRX182789)
source: Cerebellum. (Cerebellum)		Ago1IP812(Rui)
Quantitative functions of Argonaute proteins . (ago1 skin)		SRR042458(GSM539850)
mouse basophil cells [09-002]. (b cell)		SRR042456(GSM539848)
mouse hematopoetic progenitor cells [09-002]. (bone marrow)		SRR042487(GSM539879)
mouse BclXL B activated with LPS/IL4 [BalbC] [09-002]. (spleen)		SRR346423(SRX098265)
Global profiling of miRNA and the hairpin pre. (Brain)		SRR038742(GSM527277)
small RNA-Seq. (dgcr8 brain)		SRR065050(SRR065050)
Tissue-specific Regulation of Mouse MicroRNA . (liver)		SRR306542(GSM750585)
19-24nt. (ago2 brain)		SRR346422(SRX098264)
Global profiling of miRNA and the hairpin pre. (Muscle)		SRR248523(GSM733811)
cell type: Thy1+ spermatogonial stem cellstra. (testes)		SRR306528(GSM750571)
19-24nt. (ago2 brain)		GSM509279(GSM509279)
MVH-/- E16.5 small RNA. (testes)		Ago3IP805(Rui)
Quantitative functions of Argonaute proteins . (ago3 skin)		SRR345198(SRX097259)
source: size fractionated RNA from mouse hipp. (brain)		SRR065054(SRR065054)
Tissue-specific Regulation of Mouse MicroRNA . (jejunum)		SRR042446(GSM539838)
mouse mature B cells (spleen) replicate 1 [09-002]. (b cell)		SRR059769(GSM562831)
Treg_Drosha. (spleen)		SRR037912(GSM510449)
newborn_rep5. (total RNA)		Ago1IP517(Rui)
Quantitative functions of Argonaute proteins . (ago1 skin)		mjTestesKO7()
Testes Data. (Zcchc11 testes)		SRR039184(GSM485324)
shLuc.1309 (+dox). (fibroblast)		SRR042465(GSM539857)
mouse CD4+ T cells (spleen) [09-002]. (spleen)		SRR553604(SRX182810)
source: Spermatocytes. (Spermatocytes)		SRR391845(GSM852140)
gender: femalegenotype/variation: wild typeti. (embryo)		GSM314553(GSM314553)
ESC dcr (Illumina). (ESC)		SRR306531(GSM750574)
19-24nt. (ago2 brain)		SRR014229(GSM319953)
10 dpp MILI. (mili testes)		SRR038745(GSM527280)
small RNA-Seq. (dgcr8 brain)		mjTestesWT2()
Testes Data. (testes)		SRR042455(GSM539847)
mouse plasma cells [09-002]. (blood)		SRR014231(GSM319955)
16.5 dpc total. (testes)		SRR248524(GSM733812)
cell type: Thy1+ spermatogonial stem cellstra. (testes)		GSM519104(GSM519104)
mouse_granulocyte_nuclei_smallRNAs. (cell line)		SRR059768(GSM562830)
Treg_control. (spleen)		SRR042450(GSM539842)
mouse B cells activated in vitro with LPS/IL4 replicate 3 [09-002]. (b cell)		SRR346415(SRX098256)
source: Testis. (Testes)		GSM314559(GSM314559)
ESC dgcr8 (454). (ESC)		SRR279905(GSM689055)
cell type: mouse embryonic stem cellcell line. (ESC)		SRR039154(GSM471931)
HL1_siSrf2_smallRNAseq. (muscle)		SRR525241(SRA056111/SRX170317)
Mus musculus domesticus miRNA sequencing. (ago1 Blood)		SRR525244(SRA056111/SRX170320)
Mus musculus domesticus miRNA sequencing. (ago2 Blood)		SRR039186(GSM485326)
shLuc.1309;ROSA-rtTA (+dox). (fibroblast)		GSM640580(GSM640580)
small RNA in the liver with paternal Low pro. (liver)		SRR346417(SRX098258)
Global profiling of miRNA and the hairpin pre. (Brain)		mjTestesKO6()
Testes Data. (Zcchc11 testes)		SRR037920(GSM510458)
e12p5_rep2. (embryo)		SRR023850(GSM307159)
ZHBT-c40hsmallrna_rep1. (cell line)		SRR345201(SRX097262)
source: size fractionated RNA from mouse hipp. (brain)		SRR029123(GSM416611)
NIH3T3. (cell line)		SRR065055(SRR065055)
Tissue-specific Regulation of Mouse MicroRNA . (jejunum)		SRR040489(GSM533912)
E18.5 Ago2 catalytically inactive LIVER small RNA. (ago2 liver)		SRR042467(GSM539859)
mouse T cells activated in vitro with Concanavalin A [09-002]. (spleen)		Ago2IP517(Rui)
Quantitative functions of Argonaute proteins . (ago2 skin)		SRR014232(GSM319956)
16.5 dpc MILI. (mili testes)		SRR553584(SRX182790)
source: Heart. (Heart)		SRR553586(SRX182792)
source: Testis. (testes)		SRR116846(GSM678422)
Small RNA deep sequencing from mouse epididym. (epididymis)
....................................................................................................................................................................................CTTCTGATCTCTTACCCGA................................................... 191.000.00---------------------------------------------------------------------------------------------------1.00------------------
...........TCCCCGCTGCCTGTTCTT............................................................................................................................................................................................................................. 181.000.00---------------------------------------1.00------------------------------------------------------------------------------
........................................................................................................................................................................................................ACAAGCCCCTGTCTAATT................................ 181.000.00------------------------------------------------------------------------------------------------------------1.00---------
....................................................................................................GTTTCTCCTAAAGCCAGC.................................................................................................................................... 1811.001.00---------------------------------------1.00------------------------------------------------------------------------------