(1) AGO1.ip | (3) AGO2.ip | (2) BRAIN | (7) BREAST | (27) CELL-LINE | (1) FIBROBLAST | (6) HEART | (1) HELA | (1) LIVER | (2) OTHER | (1) RRP40.ip | (16) SKIN |
GTGTGAGTGTTTTAAGCATGAAGGTGATTGAAGCCATGAGGGTGAGTAAGGTCACCCAGGTCCCCAAGAGGGCAGGAGCAGGTGGGGGCAGCGAGGCCAGAGAGGAGGCTGCTGGGACAAAGATGGAGCCTGAGGTGGGGGTGGTGAGGGAGACCAGCTGGCCCACTGGGTCCTGACCCTCTGCTCTCTCCCACCCGCAGTCTCCAGCCAAAAACGGCTCCAAGCCTGTCCACAGCAACCAGCACCCTCA ...............................................................................................................................................(((.((((((..(((.((......((((....)))))).))).))))))...))).................................................... ...............................................................................................................................................144.....................................................200................................................ | Size | Perfect hit | Total Norm | Perfect Norm | SRR326280(GSM769510) total cell content of unperturbed cells was s. (cell line) | SRR387910(GSM843862) antibody for ip: Ago2. (ago2 cell line) | SRR326279(GSM769509) cytoplasmic fraction was isolated using PARIS. (cell line) | DRR000559(DRX000317) THP-1 whole cell RNA, no treatment. (cell line) | SRR326281(GSM769511) Dicer mRNA was knocked down using siDicer, cy. (cell line) | SRR326282(GSM769512) Dicer mRNA was knocked down using siDicer, to. (cell line) | SRR189780(GSM714640) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR330916(SRX091754) tissue: normal skindisease state: normal. (skin) | SRR189779(GSM714639) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR553572(SRX182778) source: Frontal Cortex. (Frontal Cortex) | DRR000556(DRX000314) THP-1 whole cell RNA, after 3 day treatment w. (cell line) | SRR342897(SRX096793) small RNA seq of Left atrial tissue. (heart) | SRR553573(SRX182779) source: Cerebellum. (Cerebellum) | SRR029125(GSM416754) U2OS. (cell line) | DRR000555(DRX000313) THP-1 whole cell RNA, no treatment. (cell line) | SRR330864(SRX091702) tissue: skin psoriatic involveddisease state:. (skin) | SRR342898(SRX096794) small RNA seq of Right atrial tissue. (heart) | SRR330915(SRX091753) tissue: normal skindisease state: normal. (skin) | SRR330890(SRX091728) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR207113(GSM721075) IP against AGO 1 & 2. (ago1/2 cell line) | SRR038852(GSM458535) QF1160MB. (cell line) | DRR000558(DRX000316) THP-1 whole cell RNA, after 3 day treatment w. (cell line) | SRR330877(SRX091715) tissue: skin psoriatic involveddisease state:. (skin) | DRR000557(DRX000315) THP-1 whole cell RNA, after 3 day treatment w. (cell line) | SRR330904(SRX091742) tissue: normal skindisease state: normal. (skin) | SRR207111(GSM721073) Whole cell RNA. (cell line) | SRR330901(SRX091739) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR189782 | DRR000561(DRX000319) Isolation of RNA following immunoprecipitatio. (ago2 cell line) | SRR330861(SRX091699) tissue: skin psoriatic involveddisease state:. (skin) | SRR342894(SRX096790) small RNA seq of Right atrial tissue. (heart) | SRR191489(GSM715599) 147genomic small RNA (size selected RNA from . (breast) | SRR191600(GSM715710) 90genomic small RNA (size selected RNA from t. (breast) | SRR342901(SRX096797) small RNA seq of Left atrial tissue. (heart) | SRR330873(SRX091711) tissue: skin psoriatic involveddisease state:. (skin) | SRR191447(GSM715557) 142genomic small RNA (size selected RNA from . (breast) | DRR001487(DRX001041) Hela long nuclear cell fraction, LNA(+). (hela) | SRR038860(GSM458543) MM426. (cell line) | SRR343333(GSM796036) KSHV (HHV8). (cell line) | SRR342896(SRX096792) small RNA seq of Right atrial tissue. (heart) | SRR330887(SRX091725) tissue: skin psoriatic uninvolveddisease stat. (skin) | RoviraIPAgo2(Rovira) total RNA. (ago2 breast) | SRR037938(GSM510476) 293Red. (cell line) | GSM450609(GSM450609) miRNA sequencing raw reads from post-mortem s. (brain) | SRR330870(SRX091708) tissue: skin psoriatic involveddisease state:. (skin) | SRR363673(GSM830250) cell type: human foreskin fibroblasts (HFF)tr. (fibroblast) | GSM956925Paz8D5(GSM956925) cell line: HEK293 cell linepassages: 15-20ip . (cell line) | SRR037944(GSM510482) 293DcrTN_cand5. (cell line) | SRR207112(GSM721074) RRP40 knockdown. (RRP40 cell line) | SRR191578(GSM715688) 100genomic small RNA (size selected RNA from . (breast) | GSM450602(GSM450602) miRNA sequencing raw reads from post-mortem s. (brain) | SRR039623(GSM531986) HCV(+) HCC Tissue Sample. (liver) | SRR191566(GSM715676) 94genomic small RNA (size selected RNA from t. (breast) | SRR330900(SRX091738) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR060983(GSM569187) Human pre-germinal center B cell [09-001]. (cell line) | SRR060982(GSM569186) Human centrocyte [09-001]. (cell line) | SRR342900(SRX096796) small RNA seq of Right atrial tissue. (heart) | SRR191596(GSM715706) 73genomic small RNA (size selected RNA from t. (breast) | SRR330892(SRX091730) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR107297(GSM677704) 18-30nt fraction of small RNA. (cell line) | SRR330872(SRX091710) tissue: skin psoriatic involveddisease state:. (skin) | SRR330859(SRX091697) tissue: skin psoriatic involveddisease state:. (skin) | SRR444060(SRX128908) Sample 18cDNABarcode: AF-PP-340: ACG CTC TTC . (skin) | SRR039635(GSM518472) THP1_nuc_sRNAs. (cell line) |
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
...................................................................................................................................................................................TCTGCTCTCTCCCACCCGCAGA................................................. | 22 | 1 | 33.00 | 13.00 | 1.00 | 4.00 | 1.00 | 3.00 | - | 1.00 | - | 1.00 | - | 1.00 | - | - | - | - | 3.00 | 2.00 | 1.00 | - | 1.00 | - | - | 2.00 | 1.00 | 2.00 | - | - | 1.00 | - | - | - | 1.00 | - | 1.00 | 1.00 | - | 1.00 | - | - | 1.00 | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | 1.00 | 1.00 | - | - | - | - | - | - | - | - |
...................................................................................................................................................................................TCTGCTCTCTCCCACCCGCAGT................................................. | 22 | 1 | 23.00 | 23.00 | 2.00 | 2.00 | 2.00 | - | 1.00 | 1.00 | - | - | - | - | - | - | 1.00 | 3.00 | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | 1.00 | - | - | - | - | 1.00 | 1.00 | - | - | - | 1.00 | - | - | 1.00 | - | 1.00 | - | - | - | - | - | - | 1.00 | - | - | 1.00 | 1.00 | - | - | - |
...................................................................................................................................................................................TCTGCTCTCTCCCACCCGCAG.................................................. | 21 | 1 | 13.00 | 13.00 | - | - | 2.00 | - | 2.00 | - | - | - | - | - | 3.00 | - | - | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - |
...................................................................................................................................................................................TCTGCTCTCTCCCACCCGC.................................................... | 19 | 1 | 7.00 | 7.00 | 1.00 | - | - | - | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | 2.00 | - | - | 1.00 | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
...................................................................................................................................................................................TCTGCTCTCTCCCACCCGCA................................................... | 20 | 1 | 5.00 | 5.00 | 1.00 | - | - | - | - | 1.00 | - | 1.00 | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
...................................................................................................................................................................................TCTGCTCTCTCCCACCCGCAGC................................................. | 22 | 1 | 5.00 | 13.00 | 3.00 | - | - | 1.00 | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
...................................................................................................................................................................................TCTGCTCTCTCCCACCCGCAGTA................................................ | 23 | 1 | 4.00 | 23.00 | 1.00 | - | - | - | - | - | - | - | - | 1.00 | - | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
....................................................................................GGGGCAGCGAGGCCAGAGAGGAGGCTGCCGGG...................................................................................................................................... | 32 | 2.00 | 0.00 | - | - | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
..................................................................................................AGAGAGGAGGCTGCTGGGACA................................................................................................................................... | 21 | 1 | 2.00 | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
....................................................................................................................................................GGAGACCAGCTGGCCCACTGGGC............................................................................... | 23 | 2.00 | 0.00 | - | - | - | - | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
...................................................................................................................................................................................TCTGCTCTCTCCCACCCGCAGTT................................................ | 23 | 1 | 1.00 | 23.00 | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
.................................................................................................................................................................................CCTCTGCTCTCTCCCACCCGCA................................................... | 22 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - |
.............................................................................................AGGCCAGAGAGGAGGCGGGT......................................................................................................................................... | 20 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
........................................................................................................................................................................................................................GCTCCAAGCCTGTCCACAGCAAC........... | 23 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - |
.............................................................................................................................................TGGTGAGGGAGACCAGCTGGCGCA..................................................................................... | 24 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | |
.......................GTGATTGAAGCCATGAGGGT............................................................................................................................................................................................................... | 20 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
...................................................................................................................................................................................TCTGCTCTCTCCCACCCGA.................................................... | 19 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
.............................................................................................................................................TGGTGAGGGAGACCAGCTGGCAGAT.................................................................................... | 25 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
..................TGAAGGTGATTGAAGCCATGAGGGTG.............................................................................................................................................................................................................. | 26 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
..................TGAAGGTGATTGAAGCCATGAGGGCGAG............................................................................................................................................................................................................ | 28 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
...................................................................................................................................................................................TCTGCTCTCTCCCACCCTC.................................................... | 19 | 2 | 1.00 | 0.50 | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
.............................................................................................................................................TGGTGAGGGAGACCAGCTGGCCCA..................................................................................... | 24 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
......................................................................................................AGGAGGCTGCTGGGACAAAGACGG............................................................................................................................ | 24 | 1.00 | 0.00 | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
...................................................................................................................................................................................TCTGCTCTCTCCCACCCG..................................................... | 18 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
...................................................................................................................................................................................TCTGCTCTCTCCCACCCGCAGAA................................................ | 23 | 1 | 1.00 | 13.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
...................................................................................................................................................................................TCTGCTCTCTCCCACCCGCAGTC................................................ | 23 | 1 | 1.00 | 1.00 | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
...................................................................................................................................................................................TCTGCTCTCTCCCACCCGCAGTTA............................................... | 24 | 1 | 1.00 | 23.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
...................................................................................................................................................................................TCTGCTCTCTCCCACCCGCT................................................... | 20 | 1 | 1.00 | 7.00 | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
.....................................................................................................GAGGAGGCTGCTGGGACAAAGATGGAGCCTGAGGTGGGGGTGGTGAGGGAGACCAGCTGGCCCACTGGGTCCTGACCCTCTGCTCTCTCCCACCCGCA................................................... | 98 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
...................................................................................................................................................................................TCTGCTCTCTCCCACCC...................................................... | 17 | 2 | 0.50 | 0.50 | - | - | - | - | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
.....................................................................................................................CAAAGATGGAGCCTGA..................................................................................................................... | 16 | 4 | 0.50 | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.25 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.25 | - | - |
....................................................................................................AGAGGAGGCTGCTGGGAAAAA................................................................................................................................. | 21 | 7 | 0.14 | 0.14 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.14 |
....................................................................................................AGAGGAGGCTGCTGGGA..................................................................................................................................... | 17 | 7 | 0.14 | 0.14 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.14 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
........................................................................CAGGAGCAGGTGGGGGC................................................................................................................................................................. | 17 | 8 | 0.12 | 0.12 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.12 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
GTGTGAGTGTTTTAAGCATGAAGGTGATTGAAGCCATGAGGGTGAGTAAGGTCACCCAGGTCCCCAAGAGGGCAGGAGCAGGTGGGGGCAGCGAGGCCAGAGAGGAGGCTGCTGGGACAAAGATGGAGCCTGAGGTGGGGGTGGTGAGGGAGACCAGCTGGCCCACTGGGTCCTGACCCTCTGCTCTCTCCCACCCGCAGTCTCCAGCCAAAAACGGCTCCAAGCCTGTCCACAGCAACCAGCACCCTCA ...............................................................................................................................................(((.((((((..(((.((......((((....)))))).))).))))))...))).................................................... ...............................................................................................................................................144.....................................................200................................................ | Size | Perfect hit | Total Norm | Perfect Norm | SRR326280(GSM769510) total cell content of unperturbed cells was s. (cell line) | SRR387910(GSM843862) antibody for ip: Ago2. (ago2 cell line) | SRR326279(GSM769509) cytoplasmic fraction was isolated using PARIS. (cell line) | DRR000559(DRX000317) THP-1 whole cell RNA, no treatment. (cell line) | SRR326281(GSM769511) Dicer mRNA was knocked down using siDicer, cy. (cell line) | SRR326282(GSM769512) Dicer mRNA was knocked down using siDicer, to. (cell line) | SRR189780(GSM714640) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR330916(SRX091754) tissue: normal skindisease state: normal. (skin) | SRR189779(GSM714639) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR553572(SRX182778) source: Frontal Cortex. (Frontal Cortex) | DRR000556(DRX000314) THP-1 whole cell RNA, after 3 day treatment w. (cell line) | SRR342897(SRX096793) small RNA seq of Left atrial tissue. (heart) | SRR553573(SRX182779) source: Cerebellum. (Cerebellum) | SRR029125(GSM416754) U2OS. (cell line) | DRR000555(DRX000313) THP-1 whole cell RNA, no treatment. (cell line) | SRR330864(SRX091702) tissue: skin psoriatic involveddisease state:. (skin) | SRR342898(SRX096794) small RNA seq of Right atrial tissue. (heart) | SRR330915(SRX091753) tissue: normal skindisease state: normal. (skin) | SRR330890(SRX091728) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR207113(GSM721075) IP against AGO 1 & 2. (ago1/2 cell line) | SRR038852(GSM458535) QF1160MB. (cell line) | DRR000558(DRX000316) THP-1 whole cell RNA, after 3 day treatment w. (cell line) | SRR330877(SRX091715) tissue: skin psoriatic involveddisease state:. (skin) | DRR000557(DRX000315) THP-1 whole cell RNA, after 3 day treatment w. (cell line) | SRR330904(SRX091742) tissue: normal skindisease state: normal. (skin) | SRR207111(GSM721073) Whole cell RNA. (cell line) | SRR330901(SRX091739) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR189782 | DRR000561(DRX000319) Isolation of RNA following immunoprecipitatio. (ago2 cell line) | SRR330861(SRX091699) tissue: skin psoriatic involveddisease state:. (skin) | SRR342894(SRX096790) small RNA seq of Right atrial tissue. (heart) | SRR191489(GSM715599) 147genomic small RNA (size selected RNA from . (breast) | SRR191600(GSM715710) 90genomic small RNA (size selected RNA from t. (breast) | SRR342901(SRX096797) small RNA seq of Left atrial tissue. (heart) | SRR330873(SRX091711) tissue: skin psoriatic involveddisease state:. (skin) | SRR191447(GSM715557) 142genomic small RNA (size selected RNA from . (breast) | DRR001487(DRX001041) Hela long nuclear cell fraction, LNA(+). (hela) | SRR038860(GSM458543) MM426. (cell line) | SRR343333(GSM796036) KSHV (HHV8). (cell line) | SRR342896(SRX096792) small RNA seq of Right atrial tissue. (heart) | SRR330887(SRX091725) tissue: skin psoriatic uninvolveddisease stat. (skin) | RoviraIPAgo2(Rovira) total RNA. (ago2 breast) | SRR037938(GSM510476) 293Red. (cell line) | GSM450609(GSM450609) miRNA sequencing raw reads from post-mortem s. (brain) | SRR330870(SRX091708) tissue: skin psoriatic involveddisease state:. (skin) | SRR363673(GSM830250) cell type: human foreskin fibroblasts (HFF)tr. (fibroblast) | GSM956925Paz8D5(GSM956925) cell line: HEK293 cell linepassages: 15-20ip . (cell line) | SRR037944(GSM510482) 293DcrTN_cand5. (cell line) | SRR207112(GSM721074) RRP40 knockdown. (RRP40 cell line) | SRR191578(GSM715688) 100genomic small RNA (size selected RNA from . (breast) | GSM450602(GSM450602) miRNA sequencing raw reads from post-mortem s. (brain) | SRR039623(GSM531986) HCV(+) HCC Tissue Sample. (liver) | SRR191566(GSM715676) 94genomic small RNA (size selected RNA from t. (breast) | SRR330900(SRX091738) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR060983(GSM569187) Human pre-germinal center B cell [09-001]. (cell line) | SRR060982(GSM569186) Human centrocyte [09-001]. (cell line) | SRR342900(SRX096796) small RNA seq of Right atrial tissue. (heart) | SRR191596(GSM715706) 73genomic small RNA (size selected RNA from t. (breast) | SRR330892(SRX091730) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR107297(GSM677704) 18-30nt fraction of small RNA. (cell line) | SRR330872(SRX091710) tissue: skin psoriatic involveddisease state:. (skin) | SRR330859(SRX091697) tissue: skin psoriatic involveddisease state:. (skin) | SRR444060(SRX128908) Sample 18cDNABarcode: AF-PP-340: ACG CTC TTC . (skin) | SRR039635(GSM518472) THP1_nuc_sRNAs. (cell line) |
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
................................................................................GGTGGGGGCAGCGAGGCC........................................................................................................................................................ | 18 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - |
.....................................................................................................................................................................................................................................CCACAGCAACCAGCACCCTCAT | 22 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
....................................................................................................................................................................................................................................TCCACAGCAACCAGCGATT... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | |
................................................AGGTCACCCAGGTCCC.......................................................................................................................................................................................... | 16 | 3 | 0.33 | 0.33 | - | - | - | - | - | - | - | - | - | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
...............................................................................................................CTGGGACAAAGATGGA........................................................................................................................... | 16 | 4 | 0.25 | 0.25 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.25 | - |