| (2) AGO2.ip | (1) B-CELL | (5) BRAIN | (5) BREAST | (23) CELL-LINE | (2) CERVIX | (6) HEART | (2) HELA | (1) LIVER | (2) OTHER | (19) SKIN | (1) TESTES | (2) UTERUS | (1) XRN.ip |
| TCTCTGGTACTTGGTTTGTCCACCTATTGATGGGGGCTCACAGCAGAGACCTCTTGCCAGGGCAGAGTTTGGCTCGGAAGCCCCTCGCCTCATGCTCATCTGAGTGGCTCGGCAGTCAGGCGACAGCCTGCAAGAATGCAGGGGTAAGTCAGGACCACGGGAGGTGTCTGGTGCTGACCCTGGGTCCGGTTGTCCTGCAGGCTTTGGCAGAGCATGAGGACGAGCTCCCGGAGCACTTCAAACCTTCACA ........................................................................................................................................(((((((...((((.(((((.((((.(((.......)))...))))))))))))).)))))))................................................... ..................................................................................................................................131..................................................................200................................................ | Size | Perfect hit | Total Norm | Perfect Norm | SRR387910(GSM843862) antibody for ip: Ago2. (ago2 cell line) | SRR553573(SRX182779) source: Cerebellum. (Cerebellum) | SRR037940(GSM510478) 293cand5_rep2. (cell line) | SRR037939(GSM510477) 293cand5_rep1. (cell line) | SRR342897(SRX096793) small RNA seq of Left atrial tissue. (heart) | DRR001489(DRX001043) Hela short nuclear cell fraction, control. (hela) | SRR330879(SRX091717) tissue: skin psoriatic involveddisease state:. (skin) | SRR342896(SRX096792) small RNA seq of Right atrial tissue. (heart) | SRR553572(SRX182778) source: Frontal Cortex. (Frontal Cortex) | SRR387909(GSM843861) specific-host: Homo sapienshost cell line: Su. (cell line) | SRR342898(SRX096794) small RNA seq of Right atrial tissue. (heart) | SRR553576(SRX182782) source: Testis. (testes) | SRR326279(GSM769509) cytoplasmic fraction was isolated using PARIS. (cell line) | SRR330922(SRX091760) tissue: normal skindisease state: normal. (skin) | SRR330908(SRX091746) tissue: normal skindisease state: normal. (skin) | SRR060169(GSM565979) 5-8F_cytoplasm. (cell line) | SRR330915(SRX091753) tissue: normal skindisease state: normal. (skin) | DRR001488(DRX001042) Hela short nuclear cell fraction, LNA(+). (hela) | SRR095854(SRX039177) miRNA were isolated from FirstChoice Human Br. (brain) | SRR330906(SRX091744) tissue: normal skindisease state: normal. (skin) | SRR330867(SRX091705) tissue: skin psoriatic involveddisease state:. (skin) | SRR330921(SRX091759) tissue: normal skindisease state: normal. (skin) | SRR189786 | GSM416733(GSM416733) HEK293. (cell line) | SRR033727(GSM497072) HIV-positive DL (HIV412). (B cell) | SRR330916(SRX091754) tissue: normal skindisease state: normal. (skin) | GSM450602(GSM450602) miRNA sequencing raw reads from post-mortem s. (brain) | SRR330885(SRX091723) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330865(SRX091703) tissue: skin psoriatic involveddisease state:. (skin) | GSM450598(GSM450598) miRNA sequencing raw reads from post-mortem s. (brain) | SRR330900(SRX091738) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330866(SRX091704) tissue: skin psoriatic involveddisease state:. (skin) | SRR343332(GSM796035) KSHV (HHV8), EBV (HHV-4). (cell line) | SRR060982(GSM569186) Human centrocyte [09-001]. (cell line) | SRR342900(SRX096796) small RNA seq of Right atrial tissue. (heart) | SRR029130(GSM416759) DLD2. (cell line) | TAX577579(Rovira) total RNA. (breast) | SRR039613(GSM531976) Human Normal Liver Tissue Sample 3. (liver) | SRR207116(GSM721078) Nuclear RNA. (cell line) | GSM450608(GSM450608) miRNA sequencing raw reads from post-mortem s. (brain) | SRR330907(SRX091745) tissue: normal skindisease state: normal. (skin) | SRR029125(GSM416754) U2OS. (cell line) | SRR040016(GSM532901) G645N. (cervix) | SRR326281(GSM769511) Dicer mRNA was knocked down using siDicer, cy. (cell line) | SRR191593(GSM715703) 62genomic small RNA (size selected RNA from t. (breast) | SRR330904(SRX091742) tissue: normal skindisease state: normal. (skin) | DRR000555(DRX000313) THP-1 whole cell RNA, no treatment. (cell line) | DRR000557(DRX000315) THP-1 whole cell RNA, after 3 day treatment w. (cell line) | SRR189782 | SRR553574(SRX182780) source: Heart. (Heart) | GSM532886(GSM532886) G850T. (cervix) | TAX577743(Rovira) total RNA. (breast) | SRR094130(GSM651906) small RNA(18-35nt)small RNA deep sequencing o. (uterus) | DRR000561(DRX000319) Isolation of RNA following immunoprecipitatio. (ago2 cell line) | SRR330914(SRX091752) tissue: normal skindisease state: normal. (skin) | SRR330896(SRX091734) tissue: skin psoriatic uninvolveddisease stat. (skin) | TAX577739(Rovira) total RNA. (breast) | SRR330902(SRX091740) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR444061(SRX128909) Sample 19cDNABarcode: AF-PP-341: ACG CTC TTC . (skin) | SRR037931(GSM510469) 293GFP. (cell line) | SRR037935(GSM510473) 293cand3. (cell line) | SRR342895(SRX096791) small RNA seq of Left atrial tissue. (heart) | SRR029054(GSM402329) MCF7_smallRNAseq. (cell line) | SRR039193(GSM494812) HL60 cell line is derived from acute promyelo. (cell line) | SRR207115(GSM721077) XRN1&2 knockdown. (XRN1/XRN2 cell line) | SRR029126(GSM416755) 143B. (cell line) | SRR094131(GSM651907) small RNA(18-35nt)small RNA deep sequencing o. (uterus) | SRR191605(GSM715715) 76genomic small RNA (size selected RNA from t. (breast) | GSM450609(GSM450609) miRNA sequencing raw reads from post-mortem s. (brain) | SRR330923(SRX091761) tissue: normal skindisease state: normal. (skin) | DRR000558(DRX000316) THP-1 whole cell RNA, after 3 day treatment w. (cell line) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ....................................................................................................................................................................................TGGGTCCGGTTGTCCTGCAGT................................................. | 21 | 1 | 22.00 | 9.00 | 4.00 | 2.00 | - | - | 1.00 | 2.00 | - | 3.00 | - | - | - | - | - | 1.00 | - | - | - | 1.00 | - | 2.00 | - | - | - | - | - | - | - | 1.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | 1.00 | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - |
| ....................................................................................................................................................................................TGGGTCCGGTTGTCCTGCAGA................................................. | 21 | 1 | 16.00 | 9.00 | - | 3.00 | - | - | - | 1.00 | 1.00 | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | 1.00 | 1.00 | - | 1.00 | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | 1.00 | - | 1.00 | - | - | - | - | 1.00 | - | - | - | - | 1.00 | - |
| ........................................................................................................................................TGCAGGGGTAAGTCAGGACCACGGGT........................................................................................ | 26 | 1 | 12.00 | 3.00 | - | - | 5.00 | 6.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ....................................................................................................................................................................................TGGGTCCGGTTGTCCTGCAG.................................................. | 20 | 1 | 9.00 | 9.00 | - | 1.00 | - | - | 1.00 | - | - | - | 1.00 | - | 1.00 | - | - | - | 1.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - |
| ...................................................................................................................................................................................CTGGGTCCGGTTGTCCTGCAGT................................................. | 22 | 5.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | |
| .......................................................................................................................................ATGCAGGGGTAAGTCAGGACCACG........................................................................................... | 24 | 1 | 5.00 | 5.00 | - | 1.00 | - | - | - | 1.00 | - | - | - | - | - | 2.00 | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...................................................................................................................................................................................CTGGGTCCGGTTGTCCTGCAGA................................................. | 22 | 4.00 | 0.00 | - | - | - | - | - | - | 2.00 | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..................................................................................................................................................................................CCTGGGTCCGGTTGTCCTGCAGAAA............................................... | 25 | 3.00 | 0.00 | - | - | - | - | - | - | - | - | - | 3.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ........................................................................................................................................TGCAGGGGTAAGTCAGGACCACGG.......................................................................................... | 24 | 1 | 3.00 | 3.00 | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ....................................................................................................................................................................................TGGGTCCGGTTGTCCTGCAGTT................................................ | 22 | 1 | 3.00 | 9.00 | - | - | - | - | - | - | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .......................................................................................................................................ATGCAGGGGTAAGTCAGGACCACGGG......................................................................................... | 26 | 1 | 3.00 | 3.00 | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - |
| ........................................................................................................................................TGCAGGGGTAAGTCAGGACCACGGG......................................................................................... | 25 | 1 | 3.00 | 3.00 | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ....................................................................................................................................................................................TGGGTCCGGTTGTCCTGCAGAA................................................ | 22 | 1 | 3.00 | 9.00 | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .......................................................................................................................................ATGCAGGGGTAAGTCAGGACT.............................................................................................. | 21 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..........................................................................................................................................................................................................TTTGGCAGAGCATGAGGACG............................ | 20 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ......................................................................................................................................AATGCAGGGGTAAGTCAG.................................................................................................. | 18 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - |
| .......................................................................................................................................ATGCAGGGGTAAGTCAGGACCAAAA.......................................................................................... | 25 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | |
| ...........................................................................................................................................................................................................TTGGCAGAGCATGAGAC.............................. | 17 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | |
| ....................................................................................................................................................................................TGGGTCCGGTTGTCCTGCAAT................................................. | 21 | 1.00 | 0.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ....................................................................................................................................................................................TGGGTCCGGTTGTCCTGCAGAT................................................ | 22 | 1 | 1.00 | 9.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ......................................................................................................................................AATGCAGGGGTAAGTCAGGACCACG........................................................................................... | 25 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ....................................................................................................................................................................................TGGGTCCGGTTGTCCTGCAGTAG............................................... | 23 | 1 | 1.00 | 9.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..................................................................................................................................................................................CCTGGGTCCGGTTGTCCTGCAGT................................................. | 23 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ........................................................................................................................................TGCAGGGGTAAGTCAGGACCAAGGG......................................................................................... | 25 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .......................................................................................................................................ATGCAGGGGTAAGTCAGGACCACGGGT........................................................................................ | 27 | 1 | 1.00 | 3.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ......................................................................................................................................AATGCAGGGGTAAGTCAGGACA.............................................................................................. | 22 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ......................................................................................................................................AATGCAGGGGTAAGTCAGGACCAC............................................................................................ | 24 | 1 | 1.00 | 1.00 | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ......................................................................................................................................AATGCAGGGGTAAGTCAGGA................................................................................................ | 20 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - |
| ...................................................................................................................................................GTCAGGACCACGGGAGG...................................................................................... | 17 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ....................................................................................................................................................................................TGGGTCCGGTTGTCCTGCGGAA................................................ | 22 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ........................................................................................................................................TGCAGGGGTAAGTCAGGACCACG........................................................................................... | 23 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ........................................................................................................................................TGCAGGGGTAAGTCAGGACCAA............................................................................................ | 22 | 1.00 | 0.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .......................................................................................................................................ATGCAGGGGTAAGTCAGGACCACGGGTCT...................................................................................... | 29 | 1 | 1.00 | 3.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .......................................................................................................................................ATGCAGGGGTAAGTCAGGACCACGGT......................................................................................... | 26 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ....................................................................................................................................................................................TGGGTCCGGTTGTCCTGCAGC................................................. | 21 | 1 | 1.00 | 9.00 | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...........................................................................................................................................................................................................................ACGAGCTCCCGGAGCAC.............. | 17 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .......................................................................................................................................ATGCAGGGGTAAGTCAGGACCACGG.......................................................................................... | 25 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - |
| .......................................................................................................................................ATGCAGGGGTAAGTCAGGA................................................................................................ | 19 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ......................................................................................................................................AATGCAGGGGTAAGTCAGGAACAC............................................................................................ | 24 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ....................................................................................................................................................................................TGGGTCCGGTTGTCCTGCAGAAT............................................... | 23 | 1 | 1.00 | 9.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ......................................................................................................................................AATGCAGGGGTAAGTCA................................................................................................... | 17 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ....................................................................................................................................................................................TGGGTCCGGTTGTCCTGCAGTTT............................................... | 23 | 1 | 1.00 | 9.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..........................................................................................................................................CAGGGGTAAGTCAGGACCACGGGT........................................................................................ | 24 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .....................................................................................................................................................CAGGACCACGGGAGGGGTC.................................................................................. | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ....................................................................................................................................................................................TGGGTCCGGTTGTCCTGCACT................................................. | 21 | 1.00 | 0.00 | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...................................................................................................................................AAGAATGCAGGGGTAAGTCAGGACCACGGG......................................................................................... | 30 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ........................................................................................................................................TGCAGGGGTAAGTCAGGACCACGGGG........................................................................................ | 26 | 1 | 1.00 | 3.00 | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..................................................................................................................................................................................................................AGCATGAGGACGAGCT........................ | 16 | 2 | 0.50 | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.50 |
| TCTCTGGTACTTGGTTTGTCCACCTATTGATGGGGGCTCACAGCAGAGACCTCTTGCCAGGGCAGAGTTTGGCTCGGAAGCCCCTCGCCTCATGCTCATCTGAGTGGCTCGGCAGTCAGGCGACAGCCTGCAAGAATGCAGGGGTAAGTCAGGACCACGGGAGGTGTCTGGTGCTGACCCTGGGTCCGGTTGTCCTGCAGGCTTTGGCAGAGCATGAGGACGAGCTCCCGGAGCACTTCAAACCTTCACA ........................................................................................................................................(((((((...((((.(((((.((((.(((.......)))...))))))))))))).)))))))................................................... ..................................................................................................................................131..................................................................200................................................ | Size | Perfect hit | Total Norm | Perfect Norm | SRR387910(GSM843862) antibody for ip: Ago2. (ago2 cell line) | SRR553573(SRX182779) source: Cerebellum. (Cerebellum) | SRR037940(GSM510478) 293cand5_rep2. (cell line) | SRR037939(GSM510477) 293cand5_rep1. (cell line) | SRR342897(SRX096793) small RNA seq of Left atrial tissue. (heart) | DRR001489(DRX001043) Hela short nuclear cell fraction, control. (hela) | SRR330879(SRX091717) tissue: skin psoriatic involveddisease state:. (skin) | SRR342896(SRX096792) small RNA seq of Right atrial tissue. (heart) | SRR553572(SRX182778) source: Frontal Cortex. (Frontal Cortex) | SRR387909(GSM843861) specific-host: Homo sapienshost cell line: Su. (cell line) | SRR342898(SRX096794) small RNA seq of Right atrial tissue. (heart) | SRR553576(SRX182782) source: Testis. (testes) | SRR326279(GSM769509) cytoplasmic fraction was isolated using PARIS. (cell line) | SRR330922(SRX091760) tissue: normal skindisease state: normal. (skin) | SRR330908(SRX091746) tissue: normal skindisease state: normal. (skin) | SRR060169(GSM565979) 5-8F_cytoplasm. (cell line) | SRR330915(SRX091753) tissue: normal skindisease state: normal. (skin) | DRR001488(DRX001042) Hela short nuclear cell fraction, LNA(+). (hela) | SRR095854(SRX039177) miRNA were isolated from FirstChoice Human Br. (brain) | SRR330906(SRX091744) tissue: normal skindisease state: normal. (skin) | SRR330867(SRX091705) tissue: skin psoriatic involveddisease state:. (skin) | SRR330921(SRX091759) tissue: normal skindisease state: normal. (skin) | SRR189786 | GSM416733(GSM416733) HEK293. (cell line) | SRR033727(GSM497072) HIV-positive DL (HIV412). (B cell) | SRR330916(SRX091754) tissue: normal skindisease state: normal. (skin) | GSM450602(GSM450602) miRNA sequencing raw reads from post-mortem s. (brain) | SRR330885(SRX091723) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330865(SRX091703) tissue: skin psoriatic involveddisease state:. (skin) | GSM450598(GSM450598) miRNA sequencing raw reads from post-mortem s. (brain) | SRR330900(SRX091738) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330866(SRX091704) tissue: skin psoriatic involveddisease state:. (skin) | SRR343332(GSM796035) KSHV (HHV8), EBV (HHV-4). (cell line) | SRR060982(GSM569186) Human centrocyte [09-001]. (cell line) | SRR342900(SRX096796) small RNA seq of Right atrial tissue. (heart) | SRR029130(GSM416759) DLD2. (cell line) | TAX577579(Rovira) total RNA. (breast) | SRR039613(GSM531976) Human Normal Liver Tissue Sample 3. (liver) | SRR207116(GSM721078) Nuclear RNA. (cell line) | GSM450608(GSM450608) miRNA sequencing raw reads from post-mortem s. (brain) | SRR330907(SRX091745) tissue: normal skindisease state: normal. (skin) | SRR029125(GSM416754) U2OS. (cell line) | SRR040016(GSM532901) G645N. (cervix) | SRR326281(GSM769511) Dicer mRNA was knocked down using siDicer, cy. (cell line) | SRR191593(GSM715703) 62genomic small RNA (size selected RNA from t. (breast) | SRR330904(SRX091742) tissue: normal skindisease state: normal. (skin) | DRR000555(DRX000313) THP-1 whole cell RNA, no treatment. (cell line) | DRR000557(DRX000315) THP-1 whole cell RNA, after 3 day treatment w. (cell line) | SRR189782 | SRR553574(SRX182780) source: Heart. (Heart) | GSM532886(GSM532886) G850T. (cervix) | TAX577743(Rovira) total RNA. (breast) | SRR094130(GSM651906) small RNA(18-35nt)small RNA deep sequencing o. (uterus) | DRR000561(DRX000319) Isolation of RNA following immunoprecipitatio. (ago2 cell line) | SRR330914(SRX091752) tissue: normal skindisease state: normal. (skin) | SRR330896(SRX091734) tissue: skin psoriatic uninvolveddisease stat. (skin) | TAX577739(Rovira) total RNA. (breast) | SRR330902(SRX091740) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR444061(SRX128909) Sample 19cDNABarcode: AF-PP-341: ACG CTC TTC . (skin) | SRR037931(GSM510469) 293GFP. (cell line) | SRR037935(GSM510473) 293cand3. (cell line) | SRR342895(SRX096791) small RNA seq of Left atrial tissue. (heart) | SRR029054(GSM402329) MCF7_smallRNAseq. (cell line) | SRR039193(GSM494812) HL60 cell line is derived from acute promyelo. (cell line) | SRR207115(GSM721077) XRN1&2 knockdown. (XRN1/XRN2 cell line) | SRR029126(GSM416755) 143B. (cell line) | SRR094131(GSM651907) small RNA(18-35nt)small RNA deep sequencing o. (uterus) | SRR191605(GSM715715) 76genomic small RNA (size selected RNA from t. (breast) | GSM450609(GSM450609) miRNA sequencing raw reads from post-mortem s. (brain) | SRR330923(SRX091761) tissue: normal skindisease state: normal. (skin) | DRR000558(DRX000316) THP-1 whole cell RNA, after 3 day treatment w. (cell line) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ...................................GCTCACAGCAGAGACCTCTG................................................................................................................................................................................................... | 20 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..........................................................................................................................................................CCACGGGAGGTGTCT................................................................................. | 15 | 2 | 0.50 | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |