| (2) AGO1.ip | (3) AGO2.ip | (4) BRAIN | (12) BREAST | (13) CELL-LINE | (1) CERVIX | (1) FIBROBLAST | (3) HEART | (1) HELA | (1) KIDNEY | (3) LIVER | (2) OTHER | (29) SKIN | (1) XRN.ip |
| ACAGGAAGGGCTTTCCAAAAACAGAAAATAAATAGCCCGGGCAGAGCCTGGGAGGCAGAGCTGTGCAGGGCACCCGGATGGAGGGCATGAGCAGAGAGATGGGAGGCTGGCCCCAAGGGAAAAAACTGGAGGCCATGGGAGCGGTGTGGTCCAGGGTGGCCTGAGTCCCTGGTGGAGAGGTCACAGGCTGCCCATTCCAGGGGCAACCTGGGCTCCTTGCAGCTGGAGGTGCGGCTGCGGGACGAGACGG ....................................................................................((....)).......(((((...(((((((.((........)))).)))))..(((.((...)).))).(((..(((((...((((.....)).))...)))))..))).)))))................................................... .................................................................................82....................................................................................................................200................................................ | Size | Perfect hit | Total Norm | Perfect Norm | SRR387910(GSM843862) antibody for ip: Ago2. (ago2 cell line) | SRR189782 | SRR387909(GSM843861) specific-host: Homo sapienshost cell line: Su. (cell line) | SRR189779(GSM714639) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR037941(GSM510479) 293DroshaTN. (cell line) | SRR189780(GSM714640) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR330915(SRX091753) tissue: normal skindisease state: normal. (skin) | SRR330868(SRX091706) tissue: skin psoriatic involveddisease state:. (skin) | SRR039637(GSM518474) THP1_total_sRNAs. (cell line) | SRR039619(GSM531982) HBV(+) HCC Tissue Sample 1. (liver) | SRR207113(GSM721075) IP against AGO 1 & 2. (ago1/2 cell line) | SRR330869(SRX091707) tissue: skin psoriatic involveddisease state:. (skin) | TAX577739(Rovira) total RNA. (breast) | SRR330906(SRX091744) tissue: normal skindisease state: normal. (skin) | SRR553575(SRX182781) source: Kidney. (Kidney) | SRR330884(SRX091722) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330872(SRX091710) tissue: skin psoriatic involveddisease state:. (skin) | SRR330895(SRX091733) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR342894(SRX096790) small RNA seq of Right atrial tissue. (heart) | SRR330890(SRX091728) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR342895(SRX096791) small RNA seq of Left atrial tissue. (heart) | SRR330904(SRX091742) tissue: normal skindisease state: normal. (skin) | TAX577590(Rovira) total RNA. (breast) | SRR095854(SRX039177) miRNA were isolated from FirstChoice Human Br. (brain) | SRR330861(SRX091699) tissue: skin psoriatic involveddisease state:. (skin) | SRR191602(GSM715712) 60genomic small RNA (size selected RNA from t. (breast) | TAX577743(Rovira) total RNA. (breast) | SRR060985(GSM569189) Human naive B cell [09-001]. (cell line) | TAX577738(Rovira) total RNA. (breast) | SRR040019(GSM532904) G701T. (cervix) | RoviraIPAgo2(Rovira) total RNA. (ago2 breast) | SRR330886(SRX091724) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330911(SRX091749) tissue: normal skindisease state: normal. (skin) | SRR342896(SRX096792) small RNA seq of Right atrial tissue. (heart) | DRR001489(DRX001043) Hela short nuclear cell fraction, control. (hela) | SRR330919(SRX091757) tissue: normal skindisease state: normal. (skin) | SRR189787 | SRR039625(GSM531988) HBV(-) HCV(-) HCC Tissue Sample. (liver) | SRR330902(SRX091740) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR553573(SRX182779) source: Cerebellum. (Cerebellum) | GSM450600(GSM450600) miRNA sequencing raw reads from post-mortem s. (brain) | TAX577742(Rovira) total RNA. (breast) | SRR207115(GSM721077) XRN1&2 knockdown. (XRN1/XRN2 cell line) | DRR000558(DRX000316) THP-1 whole cell RNA, after 3 day treatment w. (cell line) | SRR191473(GSM715583) 121genomic small RNA (size selected RNA from . (breast) | SRR553572(SRX182778) source: Frontal Cortex. (Frontal Cortex) | SRR330885(SRX091723) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR191618(GSM715728) 148genomic small RNA (size selected RNA from . (breast) | DRR000560(DRX000318) Isolation of RNA following immunoprecipitatio. (ago1 cell line) | SRR330900(SRX091738) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR191633(GSM715743) 85genomic small RNA (size selected RNA from t. (breast) | GSM450602(GSM450602) miRNA sequencing raw reads from post-mortem s. (brain) | SRR330888(SRX091726) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330876(SRX091714) tissue: skin psoriatic involveddisease state:. (skin) | SRR330862(SRX091700) tissue: skin psoriatic involveddisease state:. (skin) | SRR037876(GSM522374) fibroblasts_cell_culture. (fibroblast) | SRR330871(SRX091709) tissue: skin psoriatic involveddisease state:. (skin) | SRR191492(GSM715602) 154genomic small RNA (size selected RNA from . (breast) | SRR107297(GSM677704) 18-30nt fraction of small RNA. (cell line) | SRR330899(SRX091737) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330857(SRX091695) tissue: skin psoriatic involveddisease state:. (skin) | DRR000561(DRX000319) Isolation of RNA following immunoprecipitatio. (ago2 cell line) | SRR330913(SRX091751) tissue: normal skindisease state: normal. (skin) | SRR330917(SRX091755) tissue: normal skindisease state: normal. (skin) | SRR330870(SRX091708) tissue: skin psoriatic involveddisease state:. (skin) | GSM450609(GSM450609) miRNA sequencing raw reads from post-mortem s. (brain) | SRR191587(GSM715697) 50genomic small RNA (size selected RNA from t. (breast) | SRR330901(SRX091739) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330893(SRX091731) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR444058(SRX128906) Sample 16cDNABarcode: AF-PP-335: ACG CTC TTC . (skin) | SRR039622(GSM531985) HCV(+) Adjacent Tissue Sample. (liver) | SRR444061(SRX128909) Sample 19cDNABarcode: AF-PP-341: ACG CTC TTC . (skin) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ....................................................................................................................................................................................TCACAGGCTGCCCATTCCAGA................................................. | 21 | 3 | 55.00 | 7.33 | 13.00 | - | 7.00 | - | 6.00 | - | 2.00 | 1.00 | 1.00 | 1.00 | - | 2.00 | 1.00 | - | 2.00 | 1.00 | - | - | 1.00 | 1.00 | - | 1.00 | - | - | - | 1.00 | 1.00 | - | - | - | - | - | 1.00 | - | - | 1.00 | - | - | - | 1.00 | - | - | 1.00 | 1.00 | - | 1.00 | 1.00 | 1.00 | 1.00 | - | - | - | 1.00 | 1.00 | 1.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ....................................................................................................................................................................................TCACAGGCTGCCCATTCCAGT................................................. | 21 | 3 | 22.00 | 7.33 | 7.00 | 1.00 | - | - | - | - | - | - | 1.00 | - | - | - | 1.00 | 1.00 | - | 1.00 | 2.00 | 1.00 | - | - | 1.00 | - | - | - | 1.00 | - | - | - | 1.00 | - | - | - | - | 1.00 | - | - | - | - | 1.00 | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ....................................................................................................................................................................................TCACAGGCTGCCCATTCCAG.................................................. | 20 | 3 | 7.33 | 7.33 | 0.67 | 3.67 | - | - | - | - | - | - | 0.33 | 0.33 | - | - | - | - | - | - | - | 0.33 | - | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.67 | - | - | - | - | - | - | 0.33 | 0.33 | 0.33 | - | - | - |
| ....................................................................................................................................................................................TCACAGGCTGCCCATTCCAGAT................................................ | 22 | 3 | 6.00 | 7.33 | 6.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ....................................................................................................................................................................................TCACAGGCTGCCCATTCCATT................................................. | 21 | 3 | 4.00 | 2.33 | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ......................................................................................ATGAGCAGAGAGATGGGAGTCCG............................................................................................................................................. | 23 | 3.00 | 0.00 | - | - | - | 3.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ....................................................................................................................................................................................TCACAGGCTGCCCATTCCA................................................... | 19 | 3 | 2.33 | 2.33 | 0.33 | 0.67 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.33 | 0.33 | 0.33 | - | - | - | - | - | - |
| ......................................................................................................................................................................................ACAGGCTGCCCATTCCAGAG................................................ | 20 | 2.00 | 0.00 | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .................................................................................................................................................................................AGGTCACAGGCTGCCCGAC...................................................... | 19 | 1.00 | 0.00 | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ....................................................................................................................................................................................TCACAGGCTGCCCATTCCAATTT............................................... | 23 | 3 | 1.00 | 2.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ....................................................................................................................................................................................TCACAGGCTGCCCATTCCAGC................................................. | 21 | 3 | 1.00 | 7.33 | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ....................................................................................................................................................................................TCACAGGCTGCCCATTCCAGTTT............................................... | 23 | 3 | 1.00 | 7.33 | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ................................................................................................................................................................................GAGGTCACAGGCTGCACCC....................................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ....................................................................................................................................................................................TCACAGGCTGCCCATTCCAGTAT............................................... | 23 | 3 | 1.00 | 7.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ....................................................................................................................................................................................TCACAGGCTGCCCATTCCAGTA................................................ | 22 | 3 | 1.00 | 7.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ....................................................................................................................GGGAAAAAACTGGAGAAC.................................................................................................................... | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ....................................................................................................................GGGAAAAAACTGGAGTA..................................................................................................................... | 17 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ....................................................................................................................................................................................TCACAGGCTGCCCATTCCCAT................................................. | 21 | 3 | 1.00 | 0.67 | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ............................................................................GATGGAGGGCATGAGGGGC........................................................................................................................................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ....................................................................................................................................................................................TCACAGGCTGCCCATTCCCA.................................................. | 20 | 3 | 1.00 | 0.67 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .......................................................................................TGAGCAGAGAGATGGGAGCC............................................................................................................................................... | 20 | 1.00 | 0.00 | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ....................................................................................................................................................................................TCACAGGCTGCCCATTCCCAA................................................. | 21 | 3 | 1.00 | 0.67 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ....................................................................................................................................................................................TCACAGGCTGCCCATTCCAGACA............................................... | 23 | 3 | 1.00 | 7.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ....................................................................................................................................................................................TCACAGGCTGCCCATTCCAAT................................................. | 21 | 3 | 1.00 | 2.33 | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..........................................................AGCTGTGCAGGGCACCCGGATGGAGGGCACG................................................................................................................................................................. | 31 | 1.00 | 0.00 | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ....................................................................................................................................................................................TCACAGGCTGCCCATTCCAGTAA............................................... | 23 | 3 | 1.00 | 7.33 | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ........................................................................................................................................................................................................................................GGCTGCGGGACGAGACGGGGC | 21 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .....................................................................................................................................CATGGGAGCGGTGTGGTCCAGGGTGGCCTG....................................................................................... | 30 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..............................................................................................................................................................................GAGAGGTCACAGGCTGCCCCC....................................................... | 21 | 1.00 | 0.00 | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ....................................................................................................................................................................................TCACAGGCTGCCCATTCCAT.................................................. | 20 | 3 | 1.00 | 2.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ....................................................................................................................................................................................TCACAGGCTGCCCATTCC.................................................... | 18 | 3 | 0.67 | 0.67 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.33 | - | - | - | - | - | - | - | - | - | - |
| ......................................................................CACCCGGATGGAGGGCATGAGCAGA........................................................................................................................................................... | 25 | 2 | 0.50 | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.50 | - | - | - | - | - | - | - | - | - | - | - |
| ..................................................................................................................................................................GAGTCCCTGGTGGAGAGGTCACAGGCTGC........................................................... | 29 | 3 | 0.33 | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.33 | - | - | - | - | - | - | - | - | - |
| ..............................................................................................................................................................................GAGAGGTCACAGGCTGCCCATTC..................................................... | 23 | 3 | 0.33 | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .....................................................................................................................................................................................................................................TGCGGCTGCGGGAC....... | 14 | 7 | 0.29 | 0.29 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.29 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .......................................................................................................................................................................................................................................CGGCTGCGGGACGA..... | 14 | 4 | 0.25 | 0.25 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.25 | - | - |
| ........................................GCAGAGCCTGGGAGGCAGAG.............................................................................................................................................................................................. | 20 | 5 | 0.20 | 0.20 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.20 | - |
| ........................................................................................................................................................................CTGGTGGAGAGGTCA................................................................... | 15 | 10 | 0.10 | 0.10 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.10 |
| ACAGGAAGGGCTTTCCAAAAACAGAAAATAAATAGCCCGGGCAGAGCCTGGGAGGCAGAGCTGTGCAGGGCACCCGGATGGAGGGCATGAGCAGAGAGATGGGAGGCTGGCCCCAAGGGAAAAAACTGGAGGCCATGGGAGCGGTGTGGTCCAGGGTGGCCTGAGTCCCTGGTGGAGAGGTCACAGGCTGCCCATTCCAGGGGCAACCTGGGCTCCTTGCAGCTGGAGGTGCGGCTGCGGGACGAGACGG ....................................................................................((....)).......(((((...(((((((.((........)))).)))))..(((.((...)).))).(((..(((((...((((.....)).))...)))))..))).)))))................................................... .................................................................................82....................................................................................................................200................................................ | Size | Perfect hit | Total Norm | Perfect Norm | SRR387910(GSM843862) antibody for ip: Ago2. (ago2 cell line) | SRR189782 | SRR387909(GSM843861) specific-host: Homo sapienshost cell line: Su. (cell line) | SRR189779(GSM714639) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR037941(GSM510479) 293DroshaTN. (cell line) | SRR189780(GSM714640) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR330915(SRX091753) tissue: normal skindisease state: normal. (skin) | SRR330868(SRX091706) tissue: skin psoriatic involveddisease state:. (skin) | SRR039637(GSM518474) THP1_total_sRNAs. (cell line) | SRR039619(GSM531982) HBV(+) HCC Tissue Sample 1. (liver) | SRR207113(GSM721075) IP against AGO 1 & 2. (ago1/2 cell line) | SRR330869(SRX091707) tissue: skin psoriatic involveddisease state:. (skin) | TAX577739(Rovira) total RNA. (breast) | SRR330906(SRX091744) tissue: normal skindisease state: normal. (skin) | SRR553575(SRX182781) source: Kidney. (Kidney) | SRR330884(SRX091722) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330872(SRX091710) tissue: skin psoriatic involveddisease state:. (skin) | SRR330895(SRX091733) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR342894(SRX096790) small RNA seq of Right atrial tissue. (heart) | SRR330890(SRX091728) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR342895(SRX096791) small RNA seq of Left atrial tissue. (heart) | SRR330904(SRX091742) tissue: normal skindisease state: normal. (skin) | TAX577590(Rovira) total RNA. (breast) | SRR095854(SRX039177) miRNA were isolated from FirstChoice Human Br. (brain) | SRR330861(SRX091699) tissue: skin psoriatic involveddisease state:. (skin) | SRR191602(GSM715712) 60genomic small RNA (size selected RNA from t. (breast) | TAX577743(Rovira) total RNA. (breast) | SRR060985(GSM569189) Human naive B cell [09-001]. (cell line) | TAX577738(Rovira) total RNA. (breast) | SRR040019(GSM532904) G701T. (cervix) | RoviraIPAgo2(Rovira) total RNA. (ago2 breast) | SRR330886(SRX091724) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330911(SRX091749) tissue: normal skindisease state: normal. (skin) | SRR342896(SRX096792) small RNA seq of Right atrial tissue. (heart) | DRR001489(DRX001043) Hela short nuclear cell fraction, control. (hela) | SRR330919(SRX091757) tissue: normal skindisease state: normal. (skin) | SRR189787 | SRR039625(GSM531988) HBV(-) HCV(-) HCC Tissue Sample. (liver) | SRR330902(SRX091740) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR553573(SRX182779) source: Cerebellum. (Cerebellum) | GSM450600(GSM450600) miRNA sequencing raw reads from post-mortem s. (brain) | TAX577742(Rovira) total RNA. (breast) | SRR207115(GSM721077) XRN1&2 knockdown. (XRN1/XRN2 cell line) | DRR000558(DRX000316) THP-1 whole cell RNA, after 3 day treatment w. (cell line) | SRR191473(GSM715583) 121genomic small RNA (size selected RNA from . (breast) | SRR553572(SRX182778) source: Frontal Cortex. (Frontal Cortex) | SRR330885(SRX091723) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR191618(GSM715728) 148genomic small RNA (size selected RNA from . (breast) | DRR000560(DRX000318) Isolation of RNA following immunoprecipitatio. (ago1 cell line) | SRR330900(SRX091738) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR191633(GSM715743) 85genomic small RNA (size selected RNA from t. (breast) | GSM450602(GSM450602) miRNA sequencing raw reads from post-mortem s. (brain) | SRR330888(SRX091726) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330876(SRX091714) tissue: skin psoriatic involveddisease state:. (skin) | SRR330862(SRX091700) tissue: skin psoriatic involveddisease state:. (skin) | SRR037876(GSM522374) fibroblasts_cell_culture. (fibroblast) | SRR330871(SRX091709) tissue: skin psoriatic involveddisease state:. (skin) | SRR191492(GSM715602) 154genomic small RNA (size selected RNA from . (breast) | SRR107297(GSM677704) 18-30nt fraction of small RNA. (cell line) | SRR330899(SRX091737) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330857(SRX091695) tissue: skin psoriatic involveddisease state:. (skin) | DRR000561(DRX000319) Isolation of RNA following immunoprecipitatio. (ago2 cell line) | SRR330913(SRX091751) tissue: normal skindisease state: normal. (skin) | SRR330917(SRX091755) tissue: normal skindisease state: normal. (skin) | SRR330870(SRX091708) tissue: skin psoriatic involveddisease state:. (skin) | GSM450609(GSM450609) miRNA sequencing raw reads from post-mortem s. (brain) | SRR191587(GSM715697) 50genomic small RNA (size selected RNA from t. (breast) | SRR330901(SRX091739) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330893(SRX091731) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR444058(SRX128906) Sample 16cDNABarcode: AF-PP-335: ACG CTC TTC . (skin) | SRR039622(GSM531985) HCV(+) Adjacent Tissue Sample. (liver) | SRR444061(SRX128909) Sample 19cDNABarcode: AF-PP-341: ACG CTC TTC . (skin) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ...................................................................GGGCACCCGGATGG......................................................................................................................................................................... | 14 | 6 | 1.17 | 1.17 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.17 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ....GAAGGGCTTTCCAAAAATA................................................................................................................................................................................................................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .........................................CAGAGCCTGGGAGGCGTGC.............................................................................................................................................................................................. | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ....................ACAGAAAATAAATAGATTT................................................................................................................................................................................................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .................................................GGGAGGCAGAGCTGTCGC....................................................................................................................................................................................... | 18 | 1.00 | 0.00 | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ............................................................................................................................................................TGGCCTGAGTCCCTGAGCC........................................................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ............TTCCAAAAACAGAAAAGGG........................................................................................................................................................................................................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..........................................................................CGGATGGAGGGCATGAGCAGA........................................................................................................................................................... | 21 | 2 | 0.50 | 0.50 | - | - | - | - | - | - | - | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ................................................................................GAGGGCATGAGCAGAGAGATG..................................................................................................................................................... | 21 | 3 | 0.33 | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .......................................GGCAGAGCCTGGGAGGCAGAGCT............................................................................................................................................................................................ | 23 | 3 | 0.33 | 0.33 | - | - | - | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ............................................................................................................................................................................................................................................GCGGGACGAGACG. | 13 | 6 | 0.17 | 0.17 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.17 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...........................................................................................................................................AGCGGTGTGGTCC.................................................................................................. | 13 | 8 | 0.12 | 0.12 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.12 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ....................................................................................................................................CCATGGGAGCGGT......................................................................................................... | 13 | 10 | 0.10 | 0.10 | - | - | - | 0.10 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |