| (2) AGO1.ip | (1) AGO1.ip OTHER.mut | (4) AGO2.ip | (4) B-CELL | (3) BRAIN | (7) BREAST | (17) CELL-LINE | (2) CERVIX | (7) HEART | (4) HELA | (1) KIDNEY | (2) LIVER | (1) OTHER | (20) SKIN | (1) TESTES |
| AGAACACGATCTTCTTCCACATCTCCAGCAAGTTCTCAAGCTCAGAGACGGTGAGTCTCCTGCCACAGCTCAGGCCTGAGGAAGGGGTGCCACCTGGGGCTGCCCAGGAACACAGGTGTCTTTGGCTGGGGAGGCATCCTTGCTTGTGGGAACAGAGGGGTGGGTACATATCTGAAGGTGCATCTGAACTCTTGGCTCCCACAGAACGCCCAGCGCTTTGGAAACCACATCCGCAAAGCCCTGCTGGACATTGC ....................................................................((((....))))..(((((((((.((((((....))))))....(((.((....)).)))....)))))))))...(((((((...(((((..((((.(((........))).))))...)))))...)))))))................................................... ....................................................................69.....................................................................................................................................204................................................ | Size | Perfect hit | Total Norm | Perfect Norm | SRR387910(GSM843862) antibody for ip: Ago2. (ago2 cell line) | SRR189782 | SRR015363(GSM380328) Germinal Center B cell (GC40). (B cell) | SRR207116(GSM721078) Nuclear RNA. (cell line) | SRR060982(GSM569186) Human centrocyte [09-001]. (cell line) | SRR342899(SRX096795) small RNA seq of Left atrial tissue. (heart) | SRR189784 | SRR207114(GSM721076) IP against AGO 1 & 2, RRP40 knockdown. (ago1/2 RRP40 cell line) | SRR330877(SRX091715) tissue: skin psoriatic involveddisease state:. (skin) | SRR342901(SRX096797) small RNA seq of Left atrial tissue. (heart) | SRR330865(SRX091703) tissue: skin psoriatic involveddisease state:. (skin) | DRR000557(DRX000315) THP-1 whole cell RNA, after 3 day treatment w. (cell line) | SRR330892(SRX091730) tissue: skin psoriatic uninvolveddisease stat. (skin) | TAX577741(Rovira) total RNA. (breast) | DRR000561(DRX000319) Isolation of RNA following immunoprecipitatio. (ago2 cell line) | SRR342897(SRX096793) small RNA seq of Left atrial tissue. (heart) | SRR342898(SRX096794) small RNA seq of Right atrial tissue. (heart) | RoviraIPAgo2(Rovira) total RNA. (ago2 breast) | SRR553576(SRX182782) source: Testis. (testes) | SRR330884(SRX091722) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR191604(GSM715714) 74genomic small RNA (size selected RNA from t. (breast) | SRR553575(SRX182781) source: Kidney. (Kidney) | SRR553572(SRX182778) source: Frontal Cortex. (Frontal Cortex) | SRR330903(SRX091741) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330905(SRX091743) tissue: normal skindisease state: normal. (skin) | SRR326279(GSM769509) cytoplasmic fraction was isolated using PARIS. (cell line) | SRR039622(GSM531985) HCV(+) Adjacent Tissue Sample. (liver) | SRR330912(SRX091750) tissue: normal skindisease state: normal. (skin) | SRR330916(SRX091754) tissue: normal skindisease state: normal. (skin) | SRR033727(GSM497072) HIV-positive DL (HIV412). (B cell) | SRR191635(GSM715745) 9genomic small RNA (size selected RNA from to. (breast) | SRR189785 | SRR330876(SRX091714) tissue: skin psoriatic involveddisease state:. (skin) | SRR326281(GSM769511) Dicer mRNA was knocked down using siDicer, cy. (cell line) | SRR040011(GSM532896) G529T. (cervix) | SRR330904(SRX091742) tissue: normal skindisease state: normal. (skin) | SRR039618(GSM531981) HBV(+) Side Tissue Sample 1. (liver) | GSM359175(GSM359175) hela_5_pct. (hela) | SRR033713(GSM497058) Burkitt Lymphoma (BL115). (B cell) | SRR343332(GSM796035) KSHV (HHV8), EBV (HHV-4). (cell line) | TAX577579(Rovira) total RNA. (breast) | SRR207113(GSM721075) IP against AGO 1 & 2. (ago1/2 cell line) | SRR342894(SRX096790) small RNA seq of Right atrial tissue. (heart) | SRR330913(SRX091751) tissue: normal skindisease state: normal. (skin) | SRR029129(GSM416758) SW480. (cell line) | TAX577589(Rovira) total RNA. (breast) | SRR060981(GSM569185) Human centroblast [09-001]. (cell line) | SRR029124(GSM416753) HeLa. (hela) | SRR330869(SRX091707) tissue: skin psoriatic involveddisease state:. (skin) | SRR330890(SRX091728) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR033731(GSM497076) h929 Cell line (h929). (B cell) | SRR342896(SRX096792) small RNA seq of Right atrial tissue. (heart) | SRR330911(SRX091749) tissue: normal skindisease state: normal. (skin) | SRR189781(GSM714641) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR038862(GSM458545) MM472. (cell line) | SRR038863(GSM458546) MM603. (cell line) | SRR040035(GSM532920) G001T. (cervix) | SRR330887(SRX091725) tissue: skin psoriatic uninvolveddisease stat. (skin) | GSM450609(GSM450609) miRNA sequencing raw reads from post-mortem s. (brain) | SRR330919(SRX091757) tissue: normal skindisease state: normal. (skin) | SRR326282(GSM769512) Dicer mRNA was knocked down using siDicer, to. (cell line) | GSM450606(GSM450606) miRNA sequencing raw reads from post-mortem s. (brain) | TAX577744(Rovira) total RNA. (breast) | GSM1105748AGO1(GSM1105748) small RNA sequencing data. (ago1 hela) | SRR330906(SRX091744) tissue: normal skindisease state: normal. (skin) | SRR444060(SRX128908) Sample 18cDNABarcode: AF-PP-340: ACG CTC TTC . (skin) | GSM1105749AGO2(GSM1105749) small RNA sequencing data. (ago2 hela) | SRR038860(GSM458543) MM426. (cell line) | SRR330863(SRX091701) tissue: skin psoriatic involveddisease state:. (skin) | GSM450599(GSM450599) miRNA sequencing raw reads from post-mortem s. (brain) | SRR342895(SRX096791) small RNA seq of Left atrial tissue. (heart) | SRR330874(SRX091712) tissue: skin psoriatic involveddisease state:. (skin) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ......................................................................................................................................................................................TCTGAACTCTTGGCTCCCACAGT................................................. | 23 | 1 | 32.00 | 6.00 | 8.00 | 3.00 | 5.00 | - | 2.00 | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | 1.00 | - | - | 1.00 | - | 1.00 | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | 1.00 | - | 1.00 | - | 1.00 | 1.00 | - | 1.00 | - | 1.00 | 1.00 | - | - | - | - |
| .......................................................................................................................................................................................CTGAACTCTTGGCTCCCACAGT................................................. | 22 | 1 | 14.00 | 4.00 | 6.00 | 1.00 | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | 1.00 | 1.00 | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ......................................................................................................................................................................................TCTGAACTCTTGGCTCCCACAGA................................................. | 23 | 1 | 8.00 | 8.00 | - | - | - | - | - | 1.00 | - | - | - | - | - | 1.00 | 2.00 | 1.00 | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ......................................................................................................................................................................................TCTGAACTCTTGGCTCCCACAG.................................................. | 22 | 1 | 6.00 | 6.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | 1.00 | - | - | - | - | - | - | - | 1.00 | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ......................................................................................................................................................................................TCTGAACTCTTGGCTCCCACA................................................... | 21 | 1 | 5.00 | 5.00 | - | - | - | - | - | - | - | 3.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - |
| .......................................................................................................................................................................................CTGAACTCTTGGCTCCCACAGA................................................. | 22 | 1 | 4.00 | 4.00 | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .....................................................................................................................................................................................ATCTGAACTCTTGGCTCCCACAG.................................................. | 23 | 1 | 4.00 | 4.00 | - | - | - | 4.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .......................................................................................................................................................................................CTGAACTCTTGGCTCCCACAG.................................................. | 21 | 1 | 4.00 | 4.00 | - | 1.00 | - | - | 1.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ......CGATCTTCTTCCACATCTCCAGC................................................................................................................................................................................................................................. | 23 | 1 | 1.00 | 1.00 | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .................................................................................................................................................................................................................CCAGCGCTTTGGAAAAAA........................... | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..................................................................................................................................................................GGTACATATCTGAAGGTGCATCTGAA.................................................................. | 26 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .......................................................................................................................................................................................CTGAACTCTTGGCTCCCACAGTTT............................................... | 24 | 1 | 1.00 | 4.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .........................................................................GCCTGAGGAAGGGGTGCTGGA................................................................................................................................................................ | 21 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ......................................................................................................................................................................................TCTGAACTCTTGGCTCCCACCGT................................................. | 23 | 1.00 | 0.00 | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .......................................................................................................................................................................................................................CTTTGGAAACCACATCCGCAAAGC............... | 24 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...............................................................................................................................................TTGTGGGAACAGAGGGGTGGAA......................................................................................... | 22 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | |
| ......................................................................................................................................................................................TCTGAACTCTTGGCTCCCACAGTTA............................................... | 25 | 1 | 1.00 | 6.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...........................................................................................................................................................................................................GAACGCCCAGCGCTTTGGAAACC............................ | 23 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ......................................................................................................................................................................................................................................CCGCAAAGCCCTGCTATT...... | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .......................................................................................................................................................................................CTGAACTCTTGGCTCCCACT................................................... | 20 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...........................................................................................................................................................................................ACTCTTGGCTCCCACAGC................................................. | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .............................................................................................................................................................................................................................AAACCACATCCGCAAAGC............... | 18 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ................................................................................................................................................................................GGTGCATCTGAACTCTG............................................................. | 17 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...................................................................................................................................................................................................................AGCGCTTTGGAAACCACATCCCCAA.................. | 25 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .............................................................................................................................................................................................................................AAACCACATCCGCAATCG............... | 18 | 1.00 | 0.00 | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..................................................................................................................................................................................................................................ACATCCGCAAAGCCCTGCTG........ | 20 | 1 | 1.00 | 1.00 | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .......................................................................................................................................................................................CTGAACTCTTGGCTCCCACAGTT................................................ | 23 | 1 | 1.00 | 4.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...........................GCAAGTTCTCAAGCTCAGAGACGAACG........................................................................................................................................................................................................ | 27 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...........................................................................................................................................................................................................GAACGCCCAGCGCTTTG.................................. | 17 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .......................................................................................................................CTTTGGCTGGGGAGGCGGTC................................................................................................................... | 20 | 1.00 | 0.00 | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ......................................................................................................................................................................................TCTGAACTCTTGGCTCCCACAGC................................................. | 23 | 1 | 1.00 | 6.00 | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ........................................................................................................................................................................................TGAACTCTTGGCTCCCACAGT................................................. | 21 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...............................................................................................................................................TTGTGGGAACAGAGGGGTGGT.......................................................................................... | 21 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...............................................................................................................................................TTGTGGGAACAGAGGGGTGGGTAT....................................................................................... | 24 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .......................................................................................................................................................................................CTGAACTCTTGGCTCCCACAGAA................................................ | 23 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..AACACGATCTTCTTCC............................................................................................................................................................................................................................................ | 16 | 2 | 0.50 | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.50 | - |
| ....................................................................................................................................................................TACATATCTGAAGGTG.......................................................................... | 16 | 3 | 0.33 | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| AGAACACGATCTTCTTCCACATCTCCAGCAAGTTCTCAAGCTCAGAGACGGTGAGTCTCCTGCCACAGCTCAGGCCTGAGGAAGGGGTGCCACCTGGGGCTGCCCAGGAACACAGGTGTCTTTGGCTGGGGAGGCATCCTTGCTTGTGGGAACAGAGGGGTGGGTACATATCTGAAGGTGCATCTGAACTCTTGGCTCCCACAGAACGCCCAGCGCTTTGGAAACCACATCCGCAAAGCCCTGCTGGACATTGC ....................................................................((((....))))..(((((((((.((((((....))))))....(((.((....)).)))....)))))))))...(((((((...(((((..((((.(((........))).))))...)))))...)))))))................................................... ....................................................................69.....................................................................................................................................204................................................ | Size | Perfect hit | Total Norm | Perfect Norm | SRR387910(GSM843862) antibody for ip: Ago2. (ago2 cell line) | SRR189782 | SRR015363(GSM380328) Germinal Center B cell (GC40). (B cell) | SRR207116(GSM721078) Nuclear RNA. (cell line) | SRR060982(GSM569186) Human centrocyte [09-001]. (cell line) | SRR342899(SRX096795) small RNA seq of Left atrial tissue. (heart) | SRR189784 | SRR207114(GSM721076) IP against AGO 1 & 2, RRP40 knockdown. (ago1/2 RRP40 cell line) | SRR330877(SRX091715) tissue: skin psoriatic involveddisease state:. (skin) | SRR342901(SRX096797) small RNA seq of Left atrial tissue. (heart) | SRR330865(SRX091703) tissue: skin psoriatic involveddisease state:. (skin) | DRR000557(DRX000315) THP-1 whole cell RNA, after 3 day treatment w. (cell line) | SRR330892(SRX091730) tissue: skin psoriatic uninvolveddisease stat. (skin) | TAX577741(Rovira) total RNA. (breast) | DRR000561(DRX000319) Isolation of RNA following immunoprecipitatio. (ago2 cell line) | SRR342897(SRX096793) small RNA seq of Left atrial tissue. (heart) | SRR342898(SRX096794) small RNA seq of Right atrial tissue. (heart) | RoviraIPAgo2(Rovira) total RNA. (ago2 breast) | SRR553576(SRX182782) source: Testis. (testes) | SRR330884(SRX091722) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR191604(GSM715714) 74genomic small RNA (size selected RNA from t. (breast) | SRR553575(SRX182781) source: Kidney. (Kidney) | SRR553572(SRX182778) source: Frontal Cortex. (Frontal Cortex) | SRR330903(SRX091741) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330905(SRX091743) tissue: normal skindisease state: normal. (skin) | SRR326279(GSM769509) cytoplasmic fraction was isolated using PARIS. (cell line) | SRR039622(GSM531985) HCV(+) Adjacent Tissue Sample. (liver) | SRR330912(SRX091750) tissue: normal skindisease state: normal. (skin) | SRR330916(SRX091754) tissue: normal skindisease state: normal. (skin) | SRR033727(GSM497072) HIV-positive DL (HIV412). (B cell) | SRR191635(GSM715745) 9genomic small RNA (size selected RNA from to. (breast) | SRR189785 | SRR330876(SRX091714) tissue: skin psoriatic involveddisease state:. (skin) | SRR326281(GSM769511) Dicer mRNA was knocked down using siDicer, cy. (cell line) | SRR040011(GSM532896) G529T. (cervix) | SRR330904(SRX091742) tissue: normal skindisease state: normal. (skin) | SRR039618(GSM531981) HBV(+) Side Tissue Sample 1. (liver) | GSM359175(GSM359175) hela_5_pct. (hela) | SRR033713(GSM497058) Burkitt Lymphoma (BL115). (B cell) | SRR343332(GSM796035) KSHV (HHV8), EBV (HHV-4). (cell line) | TAX577579(Rovira) total RNA. (breast) | SRR207113(GSM721075) IP against AGO 1 & 2. (ago1/2 cell line) | SRR342894(SRX096790) small RNA seq of Right atrial tissue. (heart) | SRR330913(SRX091751) tissue: normal skindisease state: normal. (skin) | SRR029129(GSM416758) SW480. (cell line) | TAX577589(Rovira) total RNA. (breast) | SRR060981(GSM569185) Human centroblast [09-001]. (cell line) | SRR029124(GSM416753) HeLa. (hela) | SRR330869(SRX091707) tissue: skin psoriatic involveddisease state:. (skin) | SRR330890(SRX091728) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR033731(GSM497076) h929 Cell line (h929). (B cell) | SRR342896(SRX096792) small RNA seq of Right atrial tissue. (heart) | SRR330911(SRX091749) tissue: normal skindisease state: normal. (skin) | SRR189781(GSM714641) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR038862(GSM458545) MM472. (cell line) | SRR038863(GSM458546) MM603. (cell line) | SRR040035(GSM532920) G001T. (cervix) | SRR330887(SRX091725) tissue: skin psoriatic uninvolveddisease stat. (skin) | GSM450609(GSM450609) miRNA sequencing raw reads from post-mortem s. (brain) | SRR330919(SRX091757) tissue: normal skindisease state: normal. (skin) | SRR326282(GSM769512) Dicer mRNA was knocked down using siDicer, to. (cell line) | GSM450606(GSM450606) miRNA sequencing raw reads from post-mortem s. (brain) | TAX577744(Rovira) total RNA. (breast) | GSM1105748AGO1(GSM1105748) small RNA sequencing data. (ago1 hela) | SRR330906(SRX091744) tissue: normal skindisease state: normal. (skin) | SRR444060(SRX128908) Sample 18cDNABarcode: AF-PP-340: ACG CTC TTC . (skin) | GSM1105749AGO2(GSM1105749) small RNA sequencing data. (ago2 hela) | SRR038860(GSM458543) MM426. (cell line) | SRR330863(SRX091701) tissue: skin psoriatic involveddisease state:. (skin) | GSM450599(GSM450599) miRNA sequencing raw reads from post-mortem s. (brain) | SRR342895(SRX096791) small RNA seq of Left atrial tissue. (heart) | SRR330874(SRX091712) tissue: skin psoriatic involveddisease state:. (skin) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ................................................................................................GGGCTGCCCAGGAACACAGG.......................................................................................................................................... | 20 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..AACACGATCTTCTTCCACATCTCCAG.................................................................................................................................................................................................................................. | 26 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .............................................................................................................................................................................................................ACGCCCAGCGCTTTGGC................................ | 17 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...ACACGATCTTCTTCCACAAGCT..................................................................................................................................................................................................................................... | 22 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .............CTTCCACATCTCCAGCAAGTTCTCA........................................................................................................................................................................................................................ | 25 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .....ACGATCTTCTTCCACAATAA..................................................................................................................................................................................................................................... | 20 | 1.00 | 0.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .......................................................................................................................................................ACAGAGGGGTGGGTACAC..................................................................................... | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | |
| .....................TCTCCAGCAAGTTCTCCCAT..................................................................................................................................................................................................................... | 20 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ......CGATCTTCTTCCACATCTCCAGCGG............................................................................................................................................................................................................................... | 25 | 1 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ....CACGATCTTCTTCCACATCTCCAGCAA............................................................................................................................................................................................................................... | 27 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..................................................................................................................................................................................................................CAGCGCTTTGGAAACTTAT......................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..........CTTCTTCCACATCTCCAGCAAGTTCTCAAGCTC................................................................................................................................................................................................................... | 33 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .................................................................................................................................................................................................................CCAGCGCTTTGGAAAC............................. | 16 | 2 | 0.50 | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.50 | - | - | - |
| .......GATCTTCTTCCACATCT...................................................................................................................................................................................................................................... | 17 | 2 | 0.50 | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.50 | - | - |
| ............TCTTCCACATCTCCAG.................................................................................................................................................................................................................................. | 16 | 8 | 0.25 | 0.25 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.12 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.12 |