| (1) AGO1.ip | (1) AGO1.ip OTHER.mut | (3) AGO2.ip | (3) B-CELL | (7) BREAST | (36) CELL-LINE | (2) CERVIX | (4) HEART | (6) HELA | (1) OTHER | (1) RRP40.ip | (16) SKIN | (1) TESTES | (1) UTERUS | (1) XRN.ip |
| ACCATTCTTCCATGGTTTTAACAACTCAGTCTCAAAGTGAGCCGGAGCCAAGGGGAAGAATGAGCCTATGATACTCATTGAACAAACATTTGTGTACAAAGTGTACATATTCTAGGCACTGTGGAAGCTACTGGAGGCACAGATGAGTAAGACATCACCTTGGCCTGCTGTCTATTGAGGTGTCTTCTTGTTTGCCTCAGGCCTCAGTGGTAAACTGACCAGCCGAGGAGTTTGTGTCTGCATCAGTACT .....................................................................................................................................((((((..((..((.((((((((.....(((.....)))......))))))))))..)))))))).................................................... ................................................................................................................................129....................................................................200................................................ | Size | Perfect hit | Total Norm | Perfect Norm | SRR387910(GSM843862) antibody for ip: Ago2. (ago2 cell line) | SRR326280(GSM769510) total cell content of unperturbed cells was s. (cell line) | SRR029125(GSM416754) U2OS. (cell line) | SRR326279(GSM769509) cytoplasmic fraction was isolated using PARIS. (cell line) | DRR000558(DRX000316) THP-1 whole cell RNA, after 3 day treatment w. (cell line) | SRR326281(GSM769511) Dicer mRNA was knocked down using siDicer, cy. (cell line) | DRR001486(DRX001040) Hela long cytoplasmic cell fraction, LNA(+). (hela) | SRR037935(GSM510473) 293cand3. (cell line) | SRR037943(GSM510481) 293DcrTN. (cell line) | SRR037938(GSM510476) 293Red. (cell line) | SRR330906(SRX091744) tissue: normal skindisease state: normal. (skin) | SRR189782 | SRR029129(GSM416758) SW480. (cell line) | DRR000555(DRX000313) THP-1 whole cell RNA, no treatment. (cell line) | SRR330895(SRX091733) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR033712(GSM497057) Burkitt Lymphoma (BL510). (B cell) | SRR037944(GSM510482) 293DcrTN_cand5. (cell line) | DRR001489(DRX001043) Hela short nuclear cell fraction, control. (hela) | RoviraIPAgo2(Rovira) total RNA. (ago2 breast) | SRR330923(SRX091761) tissue: normal skindisease state: normal. (skin) | SRR326282(GSM769512) Dicer mRNA was knocked down using siDicer, to. (cell line) | SRR037937(GSM510475) 293cand2. (cell line) | SRR330902(SRX091740) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR037931(GSM510469) 293GFP. (cell line) | SRR029126(GSM416755) 143B. (cell line) | DRR000561(DRX000319) Isolation of RNA following immunoprecipitatio. (ago2 cell line) | DRR000556(DRX000314) THP-1 whole cell RNA, after 3 day treatment w. (cell line) | DRR001488(DRX001042) Hela short nuclear cell fraction, LNA(+). (hela) | SRR342900(SRX096796) small RNA seq of Right atrial tissue. (heart) | SRR189779(GSM714639) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | DRR000559(DRX000317) THP-1 whole cell RNA, no treatment. (cell line) | GSM416733(GSM416733) HEK293. (cell line) | SRR330861(SRX091699) tissue: skin psoriatic involveddisease state:. (skin) | SRR094131(GSM651907) small RNA(18-35nt)small RNA deep sequencing o. (uterus) | SRR040035(GSM532920) G001T. (cervix) | SRR189787 | SRR191528(GSM715638) 130genomic small RNA (size selected RNA from . (breast) | SRR330863(SRX091701) tissue: skin psoriatic involveddisease state:. (skin) | SRR330881(SRX091719) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR033715(GSM497060) Mantle Cell Lymphoma (Mino122). (B cell) | SRR029054(GSM402329) MCF7_smallRNAseq. (cell line) | GSM1105748AGO1(GSM1105748) small RNA sequencing data. (ago1 hela) | SRR207115(GSM721077) XRN1&2 knockdown. (XRN1/XRN2 cell line) | SRR343333(GSM796036) KSHV (HHV8). (cell line) | DRR001483(DRX001037) Hela long cytoplasmic cell fraction, control. (hela) | SRR342894(SRX096790) small RNA seq of Right atrial tissue. (heart) | SRR330858(SRX091696) tissue: skin psoriatic involveddisease state:. (skin) | SRR037936(GSM510474) 293cand1. (cell line) | SRR330864(SRX091702) tissue: skin psoriatic involveddisease state:. (skin) | SRR060168(GSM565978) 5-8F_nucleus. (cell line) | SRR029124(GSM416753) HeLa. (hela) | SRR342899(SRX096795) small RNA seq of Left atrial tissue. (heart) | SRR207114(GSM721076) IP against AGO 1 & 2, RRP40 knockdown. (ago1/2 RRP40 cell line) | GSM359191(GSM359191) HepG2_3pM_5. (cell line) | SRR330890(SRX091728) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR342897(SRX096793) small RNA seq of Left atrial tissue. (heart) | SRR330888(SRX091726) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330876(SRX091714) tissue: skin psoriatic involveddisease state:. (skin) | TAX577745(Rovira) total RNA. (breast) | SRR037942(GSM510480) 293DroshaTN_cand5. (cell line) | DRR000557(DRX000315) THP-1 whole cell RNA, after 3 day treatment w. (cell line) | SRR330908(SRX091746) tissue: normal skindisease state: normal. (skin) | SRR191607(GSM715717) 192genomic small RNA (size selected RNA from . (breast) | SRR060983(GSM569187) Human pre-germinal center B cell [09-001]. (cell line) | SRR191590(GSM715700) 48genomic small RNA (size selected RNA from t. (breast) | SRR029130(GSM416759) DLD2. (cell line) | SRR029128(GSM416757) H520. (cell line) | TAX577579(Rovira) total RNA. (breast) | SRR444049(SRX128897) Sample 9cDNABarcode: AF-PP-334: ACG CTC TTC C. (skin) | SRR207116(GSM721078) Nuclear RNA. (cell line) | SRR191594(GSM715704) 70genomic small RNA (size selected RNA from t. (breast) | SRR553576(SRX182782) source: Testis. (testes) | SRR189786 | SRR037933(GSM510471) 293cand4_rep2. (cell line) | SRR033717(GSM497062) Mentle Cell Lymphoma (MCL112). (B cell) | SRR040014(GSM532899) G623N. (cervix) | SRR207112(GSM721074) RRP40 knockdown. (RRP40 cell line) | SRR330884(SRX091722) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR553572(SRX182778) source: Frontal Cortex. (Frontal Cortex) | SRR330916(SRX091754) tissue: normal skindisease state: normal. (skin) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ....................................................................................................................................................................................TGTCTTCTTGTTTGCCTCAGT................................................. | 21 | 1 | 49.00 | 13.00 | 6.00 | 4.00 | 6.00 | - | 1.00 | 1.00 | - | 4.00 | 1.00 | - | - | - | 3.00 | - | 3.00 | - | 1.00 | 1.00 | 1.00 | 1.00 | 1.00 | - | - | - | 2.00 | - | - | - | - | - | 1.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | - | 1.00 | - | 1.00 | - | 1.00 | - | 1.00 | 1.00 | - | - | - | - | 1.00 | 1.00 | - | - | - | - | 1.00 | - | - | - | - | 1.00 | - | - | - | 1.00 | - | - | 1.00 | - | - | - | - | - | - |
| ....................................................................................................................................................................................TGTCTTCTTGTTTGCCTCAGA................................................. | 21 | 1 | 49.00 | 13.00 | 17.00 | 6.00 | - | 2.00 | 3.00 | 2.00 | - | - | - | - | - | 1.00 | - | - | - | - | 1.00 | - | - | - | - | - | 2.00 | 1.00 | - | 2.00 | 1.00 | - | - | - | 1.00 | 1.00 | - | - | - | - | - | 1.00 | 1.00 | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | 1.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | 1.00 | - | 1.00 | - | - |
| ....................................................................................................................................................................................TGTCTTCTTGTTTGCCTCAG.................................................. | 20 | 1 | 13.00 | 13.00 | - | 1.00 | - | 3.00 | 1.00 | 2.00 | - | - | - | - | 2.00 | - | - | 1.00 | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ....................................................................................................................................................................................TGTCTTCTTGTTTGCCTCAGTT................................................ | 22 | 1 | 9.00 | 13.00 | - | - | - | - | - | - | - | - | 3.00 | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - |
| ..............................................................................................................TCTAGGCACTGTGGAAGCTACTGGAGGCACAGATGAGTAAGACATCACCTTGGCCTGCTGTCTATTGAGGTGTCTTCTTGTTTGCCTCAGT................................................. | 91 | 4.00 | 0.00 | - | - | - | - | - | - | 4.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ....................................................................................................................................................................................TGTCTTCTTGTTTGCCTCA................................................... | 19 | 1 | 3.00 | 3.00 | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ....................................................................................................................................................................................TGTCTTCTTGTTTGCCTCAGTTAT.............................................. | 24 | 1 | 3.00 | 13.00 | - | - | - | - | - | - | - | - | - | 3.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ....................................................................................................................................................................................TGTCTTCTTGTTTGCCTCCGT................................................. | 21 | 2.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..........................................................................................................ATATTCTAGGCACTGTGGAAGCT......................................................................................................................... | 23 | 1 | 2.00 | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...........................................................................................................................................................................................................TCAGTGGTAAACTGACCAGCCGAGGAGTTT................. | 30 | 1 | 2.00 | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...............................................................................................................................................................TTGGCCTGCTGTCTATTGAGG...................................................................... | 21 | 1 | 2.00 | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ................................................................................................................................................................................................................................GAGGAGTTTGTGTCTGCAT....... | 19 | 1 | 2.00 | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .................................................................................................................................................................................................................................AGGAGTTTGTGTCTGCAT....... | 18 | 1 | 2.00 | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ....................................................................................................................................................................................TGTCTTCTTGTTTGCCTCAGTTA............................................... | 23 | 1 | 1.00 | 13.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...................................................................................................................................TGGAGGCACAGATGAGTAAGACCT............................................................................................... | 24 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ............................................................................................................................AAGCTACTGGAGGCACAG............................................................................................................ | 18 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - |
| ..................................AAGTGAGCCGGAGCCCC....................................................................................................................................................................................................... | 17 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...................................................................................................................................TGGAGGCACAGATGAGTAAGAC................................................................................................. | 22 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...................................................................................................................................................................................GTGTCTTCTTGTTTGCCTCAGT................................................. | 22 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ............................................................................................................................................................................................................CAGTGGTAAACTGACCAGCCGAGGAGTTT................. | 29 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ....................................................................................................................................................................................TGTCTTCTTGTTTGCCTCATT................................................. | 21 | 1 | 1.00 | 3.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ....................................................................................................................................................................................TGTCTTCTTGTTTGCCTCAGTAG............................................... | 23 | 1 | 1.00 | 13.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ................................................................................................................TAGGCACTGTGGAAGCTACTGGAGGC................................................................................................................ | 26 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - |
| ....................................................................................................................................................................................TGTCTTCTTGTTTGCCTCAGTCT............................................... | 23 | 1 | 1.00 | 13.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ......................AACTCAGTCTCAAAGTCCCG................................................................................................................................................................................................................ | 20 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...................................................................................................................................TGGAGGCACAGATGAGTAAGAAA................................................................................................ | 23 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ....................................................................................................................................................................................TGTCTTCTTGTTTGCCTCAGTACT.............................................. | 24 | 1 | 1.00 | 13.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - |
| ....................................................................................................................CACTGTGGAAGCTACTGGAGGCACAGATGAGTAAGACATCACCTTGGCCTGCTGTCTATTGAGGTGTCTTCTTGTTTGCC...................................................... | 80 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ....................................................................................................................................GGAGGCACAGATGAGTAAGACAT............................................................................................... | 23 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .....................................................................................................................................................................................GTCTTCTTGTTTGCCTCAGT................................................. | 20 | 1.00 | 0.00 | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...................................................................................................................................TGGAGGCACAGATGAGTAAG................................................................................................... | 20 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - |
| ....................................................................................................................................................................................TGTCTTCTTGTTTGCCTCAGAT................................................ | 22 | 1 | 1.00 | 13.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ................................................................................................................................................................................................................................GAGGAGTTTGTGTCTGCATCAGTA.. | 24 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .....................................................................GATACTCATTGAACAATAG.................................................................................................................................................................. | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..........................................................................................................................................ACAGATGAGTAAGACATCA............................................................................................. | 19 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ....................................................................................................................................................................................TGTCTTCTTGTTTGCCTCAGAA................................................ | 22 | 1 | 1.00 | 13.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .................................................................................................................AGGCACTGTGGAAGCT......................................................................................................................... | 16 | 2 | 0.50 | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.50 | - |
| ACCATTCTTCCATGGTTTTAACAACTCAGTCTCAAAGTGAGCCGGAGCCAAGGGGAAGAATGAGCCTATGATACTCATTGAACAAACATTTGTGTACAAAGTGTACATATTCTAGGCACTGTGGAAGCTACTGGAGGCACAGATGAGTAAGACATCACCTTGGCCTGCTGTCTATTGAGGTGTCTTCTTGTTTGCCTCAGGCCTCAGTGGTAAACTGACCAGCCGAGGAGTTTGTGTCTGCATCAGTACT .....................................................................................................................................((((((..((..((.((((((((.....(((.....)))......))))))))))..)))))))).................................................... ................................................................................................................................129....................................................................200................................................ | Size | Perfect hit | Total Norm | Perfect Norm | SRR387910(GSM843862) antibody for ip: Ago2. (ago2 cell line) | SRR326280(GSM769510) total cell content of unperturbed cells was s. (cell line) | SRR029125(GSM416754) U2OS. (cell line) | SRR326279(GSM769509) cytoplasmic fraction was isolated using PARIS. (cell line) | DRR000558(DRX000316) THP-1 whole cell RNA, after 3 day treatment w. (cell line) | SRR326281(GSM769511) Dicer mRNA was knocked down using siDicer, cy. (cell line) | DRR001486(DRX001040) Hela long cytoplasmic cell fraction, LNA(+). (hela) | SRR037935(GSM510473) 293cand3. (cell line) | SRR037943(GSM510481) 293DcrTN. (cell line) | SRR037938(GSM510476) 293Red. (cell line) | SRR330906(SRX091744) tissue: normal skindisease state: normal. (skin) | SRR189782 | SRR029129(GSM416758) SW480. (cell line) | DRR000555(DRX000313) THP-1 whole cell RNA, no treatment. (cell line) | SRR330895(SRX091733) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR033712(GSM497057) Burkitt Lymphoma (BL510). (B cell) | SRR037944(GSM510482) 293DcrTN_cand5. (cell line) | DRR001489(DRX001043) Hela short nuclear cell fraction, control. (hela) | RoviraIPAgo2(Rovira) total RNA. (ago2 breast) | SRR330923(SRX091761) tissue: normal skindisease state: normal. (skin) | SRR326282(GSM769512) Dicer mRNA was knocked down using siDicer, to. (cell line) | SRR037937(GSM510475) 293cand2. (cell line) | SRR330902(SRX091740) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR037931(GSM510469) 293GFP. (cell line) | SRR029126(GSM416755) 143B. (cell line) | DRR000561(DRX000319) Isolation of RNA following immunoprecipitatio. (ago2 cell line) | DRR000556(DRX000314) THP-1 whole cell RNA, after 3 day treatment w. (cell line) | DRR001488(DRX001042) Hela short nuclear cell fraction, LNA(+). (hela) | SRR342900(SRX096796) small RNA seq of Right atrial tissue. (heart) | SRR189779(GSM714639) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | DRR000559(DRX000317) THP-1 whole cell RNA, no treatment. (cell line) | GSM416733(GSM416733) HEK293. (cell line) | SRR330861(SRX091699) tissue: skin psoriatic involveddisease state:. (skin) | SRR094131(GSM651907) small RNA(18-35nt)small RNA deep sequencing o. (uterus) | SRR040035(GSM532920) G001T. (cervix) | SRR189787 | SRR191528(GSM715638) 130genomic small RNA (size selected RNA from . (breast) | SRR330863(SRX091701) tissue: skin psoriatic involveddisease state:. (skin) | SRR330881(SRX091719) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR033715(GSM497060) Mantle Cell Lymphoma (Mino122). (B cell) | SRR029054(GSM402329) MCF7_smallRNAseq. (cell line) | GSM1105748AGO1(GSM1105748) small RNA sequencing data. (ago1 hela) | SRR207115(GSM721077) XRN1&2 knockdown. (XRN1/XRN2 cell line) | SRR343333(GSM796036) KSHV (HHV8). (cell line) | DRR001483(DRX001037) Hela long cytoplasmic cell fraction, control. (hela) | SRR342894(SRX096790) small RNA seq of Right atrial tissue. (heart) | SRR330858(SRX091696) tissue: skin psoriatic involveddisease state:. (skin) | SRR037936(GSM510474) 293cand1. (cell line) | SRR330864(SRX091702) tissue: skin psoriatic involveddisease state:. (skin) | SRR060168(GSM565978) 5-8F_nucleus. (cell line) | SRR029124(GSM416753) HeLa. (hela) | SRR342899(SRX096795) small RNA seq of Left atrial tissue. (heart) | SRR207114(GSM721076) IP against AGO 1 & 2, RRP40 knockdown. (ago1/2 RRP40 cell line) | GSM359191(GSM359191) HepG2_3pM_5. (cell line) | SRR330890(SRX091728) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR342897(SRX096793) small RNA seq of Left atrial tissue. (heart) | SRR330888(SRX091726) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330876(SRX091714) tissue: skin psoriatic involveddisease state:. (skin) | TAX577745(Rovira) total RNA. (breast) | SRR037942(GSM510480) 293DroshaTN_cand5. (cell line) | DRR000557(DRX000315) THP-1 whole cell RNA, after 3 day treatment w. (cell line) | SRR330908(SRX091746) tissue: normal skindisease state: normal. (skin) | SRR191607(GSM715717) 192genomic small RNA (size selected RNA from . (breast) | SRR060983(GSM569187) Human pre-germinal center B cell [09-001]. (cell line) | SRR191590(GSM715700) 48genomic small RNA (size selected RNA from t. (breast) | SRR029130(GSM416759) DLD2. (cell line) | SRR029128(GSM416757) H520. (cell line) | TAX577579(Rovira) total RNA. (breast) | SRR444049(SRX128897) Sample 9cDNABarcode: AF-PP-334: ACG CTC TTC C. (skin) | SRR207116(GSM721078) Nuclear RNA. (cell line) | SRR191594(GSM715704) 70genomic small RNA (size selected RNA from t. (breast) | SRR553576(SRX182782) source: Testis. (testes) | SRR189786 | SRR037933(GSM510471) 293cand4_rep2. (cell line) | SRR033717(GSM497062) Mentle Cell Lymphoma (MCL112). (B cell) | SRR040014(GSM532899) G623N. (cervix) | SRR207112(GSM721074) RRP40 knockdown. (RRP40 cell line) | SRR330884(SRX091722) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR553572(SRX182778) source: Frontal Cortex. (Frontal Cortex) | SRR330916(SRX091754) tissue: normal skindisease state: normal. (skin) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ....................................................................................................................................................................................................TCAGGCCTCAGTGGTAAAC................................... | 19 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .......................................................................................................................................................................................................GGCCTCAGTGGTAAACT.................................. | 17 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ....................................................................................................................CACTGTGGAAGCTACTGGTT.................................................................................................................. | 20 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | |
| .................................................................................................................................................................................................................GTAAACTGACCAGCCGAGGAGTTT................. | 24 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..........................................CGGAGCCAAGGGGAATCA.............................................................................................................................................................................................. | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ....................................................................................................................................................................CTGCTGTCTATTGAGG...................................................................... | 16 | 2 | 0.50 | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.50 |
| ....................................................................................................................................................................................................................AACTGACCAGCCGAG....................... | 15 | 3 | 0.33 | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...........................................................................................................................................CAGATGAGTAAGACAT............................................................................................... | 16 | 4 | 0.25 | 0.25 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.25 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |