| (2) AGO2.ip | (1) AGO3.ip | (3) B-CELL | (5) BRAIN | (6) BREAST | (16) CELL-LINE | (2) CERVIX | (2) FIBROBLAST | (6) HEART | (2) HELA | (2) OTHER | (21) SKIN | (1) XRN.ip |
| CTGACAGCGTCTGTGGCCAAGAGGAGGTCTTTCATTGGGACTCCCTACTGGTGAGGCTGCGCCTGGGGCGGAGGGGTAGGGGCCACAGAGCAGGGCACCCGGCCATCCCATCTGTGACCCCACCTCTAGGATGGCTCCCGAGGTGGCTGCTGTGGAGCGCAAAGGTGGCTACAATGAGC .......................................................................((((((.((((.((((((....(((.....)))......)))))).)))))))))).................................................... .................................................................66.............................................................129................................................ | Size | Perfect hit | Total Norm | Perfect Norm | SRR015363(GSM380328) Germinal Center B cell (GC40). (B cell) | SRR387910(GSM843862) antibody for ip: Ago2. (ago2 cell line) | SRR342896(SRX096792) small RNA seq of Right atrial tissue. (heart) | SRR553572(SRX182778) source: Frontal Cortex. (Frontal Cortex) | SRR189782 | SRR330889(SRX091727) tissue: skin psoriatic uninvolveddisease stat. (skin) | DRR001488(DRX001042) Hela short nuclear cell fraction, LNA(+). (hela) | DRR000559(DRX000317) THP-1 whole cell RNA, no treatment. (cell line) | SRR330922(SRX091760) tissue: normal skindisease state: normal. (skin) | SRR326279(GSM769509) cytoplasmic fraction was isolated using PARIS. (cell line) | DRR000555(DRX000313) THP-1 whole cell RNA, no treatment. (cell line) | SRR342900(SRX096796) small RNA seq of Right atrial tissue. (heart) | SRR033729(GSM497074) splenic MZL (Splenic414). (B cell) | TAX577743(Rovira) total RNA. (breast) | SRR207115(GSM721077) XRN1&2 knockdown. (XRN1/XRN2 cell line) | SRR553573(SRX182779) source: Cerebellum. (Cerebellum) | SRR342894(SRX096790) small RNA seq of Right atrial tissue. (heart) | GSM450598(GSM450598) miRNA sequencing raw reads from post-mortem s. (brain) | SRR040028(GSM532913) G026N. (cervix) | SRR444050(SRX128898) Sample 10cDNABarcode: AF-PP-335: ACG CTC TTC . (skin) | GSM450602(GSM450602) miRNA sequencing raw reads from post-mortem s. (brain) | SRR060984(GSM569188) Human plasma cell [09-001]. (cell line) | SRR189780(GSM714640) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR330905(SRX091743) tissue: normal skindisease state: normal. (skin) | SRR343334 | SRR330891(SRX091729) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330904(SRX091742) tissue: normal skindisease state: normal. (skin) | DRR000557(DRX000315) THP-1 whole cell RNA, after 3 day treatment w. (cell line) | SRR330875(SRX091713) tissue: skin psoriatic involveddisease state:. (skin) | TAX577740(Rovira) total RNA. (breast) | GSM339994(GSM339994) hues6. (cell line) | GSM450608(GSM450608) miRNA sequencing raw reads from post-mortem s. (brain) | SRR037876(GSM522374) fibroblasts_cell_culture. (fibroblast) | SRR330862(SRX091700) tissue: skin psoriatic involveddisease state:. (skin) | DRR000561(DRX000319) Isolation of RNA following immunoprecipitatio. (ago2 cell line) | SRR363675(GSM830252) cell type: human foreskin fibroblasts (HFF)tr. (fibroblast) | GSM450604(GSM450604) miRNA sequencing raw reads from post-mortem s. (brain) | SRR330920(SRX091758) tissue: normal skindisease state: normal. (skin) | SRR330869(SRX091707) tissue: skin psoriatic involveddisease state:. (skin) | SRR342897(SRX096793) small RNA seq of Left atrial tissue. (heart) | SRR342898(SRX096794) small RNA seq of Right atrial tissue. (heart) | DRR000556(DRX000314) THP-1 whole cell RNA, after 3 day treatment w. (cell line) | SRR107296(GSM677703) 18-30nt fraction of small RNA. (cell line) | SRR330917(SRX091755) tissue: normal skindisease state: normal. (skin) | SRR330890(SRX091728) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330864(SRX091702) tissue: skin psoriatic involveddisease state:. (skin) | SRR330899(SRX091737) tissue: skin psoriatic uninvolveddisease stat. (skin) | TAX577589(Rovira) total RNA. (breast) | SRR060981(GSM569185) Human centroblast [09-001]. (cell line) | SRR189784 | SRR342899(SRX096795) small RNA seq of Left atrial tissue. (heart) | SRR060985(GSM569189) Human naive B cell [09-001]. (cell line) | TAX577588(Rovira) total RNA. (breast) | SRR330919(SRX091757) tissue: normal skindisease state: normal. (skin) | SRR330863(SRX091701) tissue: skin psoriatic involveddisease state:. (skin) | SRR330923(SRX091761) tissue: normal skindisease state: normal. (skin) | GSM450599(GSM450599) miRNA sequencing raw reads from post-mortem s. (brain) | SRR330867(SRX091705) tissue: skin psoriatic involveddisease state:. (skin) | DRR000562(DRX000320) Isolation of RNA following immunoprecipitatio. (ago3 cell line) | SRR039193(GSM494812) HL60 cell line is derived from acute promyelo. (cell line) | SRR330906(SRX091744) tissue: normal skindisease state: normal. (skin) | SRR191606(GSM715716) 84genomic small RNA (size selected RNA from t. (breast) | SRR040018(GSM532903) G701N. (cervix) | TAX577739(Rovira) total RNA. (breast) | SRR330902(SRX091740) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR033715(GSM497060) Mantle Cell Lymphoma (Mino122). (B cell) | SRR330866(SRX091704) tissue: skin psoriatic involveddisease state:. (skin) | DRR001489(DRX001043) Hela short nuclear cell fraction, control. (hela) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ............................................................................................................CATCTGTGACCCCACCTCTAG.................................................. | 21 | 1 | 16.00 | 16.00 | - | - | 4.00 | - | - | 1.00 | - | - | - | - | 1.00 | - | - | - | - | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | 1.00 | - | 1.00 | 1.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | 1.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - |
| ......................................................................GAGGGGTAGGGGCCACAGAGCAG...................................................................................... | 23 | 1 | 13.00 | 13.00 | - | 3.00 | - | - | - | - | - | 1.00 | - | 1.00 | - | - | - | - | - | - | - | 1.00 | - | - | - | 1.00 | - | - | - | - | - | 1.00 | - | - | 1.00 | - | - | - | - | - | 1.00 | - | - | - | - | 1.00 | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - |
| ............................................................................................................CATCTGTGACCCCACCTCTAGT................................................. | 22 | 1 | 11.00 | 16.00 | - | - | 1.00 | 1.00 | - | - | - | - | - | - | - | 2.00 | - | - | 1.00 | - | - | - | 1.00 | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | 1.00 | - | - | - |
| ......................................................................GAGGGGTAGGGGCCACAGAG......................................................................................... | 20 | 1 | 9.00 | 9.00 | 7.00 | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...........................................................................................................CCATCTGTGACCCCACCTCTAG.................................................. | 22 | 1 | 6.00 | 6.00 | - | - | - | - | 1.00 | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - |
| ............................................................................................................CATCTGTGACCCCACCTCTAGA................................................. | 22 | 1 | 3.00 | 16.00 | - | - | - | - | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ............................................................................................................CATCTGTGACCCCACCTCTAGTT................................................ | 23 | 1 | 3.00 | 16.00 | - | 3.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...........................................................................................................CCATCTGTGACCCCACCTCT.................................................... | 20 | 1 | 2.00 | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - |
| ...........................................................................................................CCATCTGTGACCCCACCTCTAA.................................................. | 22 | 1 | 2.00 | 1.00 | - | - | 1.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ............................................................................................................CATCTGTGACCCCACCTCTAGTA................................................ | 23 | 1 | 2.00 | 16.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ......................................................................GAGGGGTAGGGGCCACAGAGCA....................................................................................... | 22 | 1 | 2.00 | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..GACAGCGTCTGTGGCCAAGAGGAG......................................................................................................................................................... | 24 | 1 | 1.00 | 1.00 | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ............................................................................................................CATCTGTGACCCCACCTCTAGTAA............................................... | 24 | 1 | 1.00 | 16.00 | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...........................................................................................................CCATCTGTGACCCCACCTCTCG.................................................. | 22 | 1 | 1.00 | 2.00 | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ........................................................CTGCGCCTGGGGCGGCGGG........................................................................................................ | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .TGACAGCGTCTGTGGCCAAGAGGAG......................................................................................................................................................... | 25 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ....................................................................CGGAGGGGTAGGGGCCACAGAGCAT...................................................................................... | 25 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...........................................................................................................CCATCTGTGACCCCACCTCTA................................................... | 21 | 1 | 1.00 | 1.00 | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...........................................................................................................................................GAGGTGGCTGCTGTGGAGCGC................... | 21 | 1 | 1.00 | 1.00 | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ............................................................................................................CATCTGTGACCCCACCTCTAGAAA............................................... | 24 | 1 | 1.00 | 16.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .................................................................................................................................................GCTGCTGTGGAGCGCAAAGGTGGCT......... | 25 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ............................................................................................................CATCTGTGACCCCACCTCCAG.................................................. | 21 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ............................................................................................................CATCTGTGACCCCACCTCTAT.................................................. | 21 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ................................................................................................ACCCGGCCATCCCATAG.................................................................. | 17 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ....................................................................CGGAGGGGTAGGGGCCACAGCGCT....................................................................................... | 24 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..................................................................................................................................................CTGCTGTGGAGCGCAAAGG.............. | 19 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - |
| ..............................TTCATTGGGACTCCCTACTGG................................................................................................................................ | 21 | 2 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.50 | - |
| .....................................................................GGAGGGGTAGGGGCCACAGAGCAT...................................................................................... | 24 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...................................................................................................................................................TGCTGTGGAGCGCAAAGGTGGCT......... | 23 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .............................................TACTGGTGAGGCTGCCCC.................................................................................................................... | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ............................................................................................................CATCTGTGACCCCACCTCTA................................................... | 20 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - |
| ............................................................................................................CATCTGTGACCCCACCTCTATT................................................. | 22 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...............................................................TGGGGCGGAGGGGTAGGGGTA............................................................................................... | 21 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...........................................................................................................CCATCTGTGACCCCACCTCTAT.................................................. | 22 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - |
| ..GACAGCGTCTGTGGCCAAGAGGAGGT....................................................................................................................................................... | 26 | 1 | 1.00 | 1.00 | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ......................................................................GAGGGGTAGGGGCCACAGAGCAGA..................................................................................... | 24 | 1 | 1.00 | 13.00 | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ......................................................................GAGGGGTAGGGGCCACAGAGCAGT..................................................................................... | 24 | 1 | 1.00 | 13.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - |
| ...........................................................................................................CCATCTGTGACCCCACCTCTAGA................................................. | 23 | 1 | 1.00 | 6.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...........................................................................GTAGGGGCCACAGAGCAGAA.................................................................................... | 20 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..........................................................................................................................................CGAGGTGGCTGCTGTGGA....................... | 18 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..............................TTCATTGGGACTCCCTACTG................................................................................................................................. | 20 | 2 | 0.50 | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.50 |
| ............................................................................................................................................AGGTGGCTGCTGTGGA....................... | 16 | 7 | 0.14 | 0.14 | - | - | - | 0.14 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| CTGACAGCGTCTGTGGCCAAGAGGAGGTCTTTCATTGGGACTCCCTACTGGTGAGGCTGCGCCTGGGGCGGAGGGGTAGGGGCCACAGAGCAGGGCACCCGGCCATCCCATCTGTGACCCCACCTCTAGGATGGCTCCCGAGGTGGCTGCTGTGGAGCGCAAAGGTGGCTACAATGAGC .......................................................................((((((.((((.((((((....(((.....)))......)))))).)))))))))).................................................... .................................................................66.............................................................129................................................ | Size | Perfect hit | Total Norm | Perfect Norm | SRR015363(GSM380328) Germinal Center B cell (GC40). (B cell) | SRR387910(GSM843862) antibody for ip: Ago2. (ago2 cell line) | SRR342896(SRX096792) small RNA seq of Right atrial tissue. (heart) | SRR553572(SRX182778) source: Frontal Cortex. (Frontal Cortex) | SRR189782 | SRR330889(SRX091727) tissue: skin psoriatic uninvolveddisease stat. (skin) | DRR001488(DRX001042) Hela short nuclear cell fraction, LNA(+). (hela) | DRR000559(DRX000317) THP-1 whole cell RNA, no treatment. (cell line) | SRR330922(SRX091760) tissue: normal skindisease state: normal. (skin) | SRR326279(GSM769509) cytoplasmic fraction was isolated using PARIS. (cell line) | DRR000555(DRX000313) THP-1 whole cell RNA, no treatment. (cell line) | SRR342900(SRX096796) small RNA seq of Right atrial tissue. (heart) | SRR033729(GSM497074) splenic MZL (Splenic414). (B cell) | TAX577743(Rovira) total RNA. (breast) | SRR207115(GSM721077) XRN1&2 knockdown. (XRN1/XRN2 cell line) | SRR553573(SRX182779) source: Cerebellum. (Cerebellum) | SRR342894(SRX096790) small RNA seq of Right atrial tissue. (heart) | GSM450598(GSM450598) miRNA sequencing raw reads from post-mortem s. (brain) | SRR040028(GSM532913) G026N. (cervix) | SRR444050(SRX128898) Sample 10cDNABarcode: AF-PP-335: ACG CTC TTC . (skin) | GSM450602(GSM450602) miRNA sequencing raw reads from post-mortem s. (brain) | SRR060984(GSM569188) Human plasma cell [09-001]. (cell line) | SRR189780(GSM714640) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR330905(SRX091743) tissue: normal skindisease state: normal. (skin) | SRR343334 | SRR330891(SRX091729) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330904(SRX091742) tissue: normal skindisease state: normal. (skin) | DRR000557(DRX000315) THP-1 whole cell RNA, after 3 day treatment w. (cell line) | SRR330875(SRX091713) tissue: skin psoriatic involveddisease state:. (skin) | TAX577740(Rovira) total RNA. (breast) | GSM339994(GSM339994) hues6. (cell line) | GSM450608(GSM450608) miRNA sequencing raw reads from post-mortem s. (brain) | SRR037876(GSM522374) fibroblasts_cell_culture. (fibroblast) | SRR330862(SRX091700) tissue: skin psoriatic involveddisease state:. (skin) | DRR000561(DRX000319) Isolation of RNA following immunoprecipitatio. (ago2 cell line) | SRR363675(GSM830252) cell type: human foreskin fibroblasts (HFF)tr. (fibroblast) | GSM450604(GSM450604) miRNA sequencing raw reads from post-mortem s. (brain) | SRR330920(SRX091758) tissue: normal skindisease state: normal. (skin) | SRR330869(SRX091707) tissue: skin psoriatic involveddisease state:. (skin) | SRR342897(SRX096793) small RNA seq of Left atrial tissue. (heart) | SRR342898(SRX096794) small RNA seq of Right atrial tissue. (heart) | DRR000556(DRX000314) THP-1 whole cell RNA, after 3 day treatment w. (cell line) | SRR107296(GSM677703) 18-30nt fraction of small RNA. (cell line) | SRR330917(SRX091755) tissue: normal skindisease state: normal. (skin) | SRR330890(SRX091728) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330864(SRX091702) tissue: skin psoriatic involveddisease state:. (skin) | SRR330899(SRX091737) tissue: skin psoriatic uninvolveddisease stat. (skin) | TAX577589(Rovira) total RNA. (breast) | SRR060981(GSM569185) Human centroblast [09-001]. (cell line) | SRR189784 | SRR342899(SRX096795) small RNA seq of Left atrial tissue. (heart) | SRR060985(GSM569189) Human naive B cell [09-001]. (cell line) | TAX577588(Rovira) total RNA. (breast) | SRR330919(SRX091757) tissue: normal skindisease state: normal. (skin) | SRR330863(SRX091701) tissue: skin psoriatic involveddisease state:. (skin) | SRR330923(SRX091761) tissue: normal skindisease state: normal. (skin) | GSM450599(GSM450599) miRNA sequencing raw reads from post-mortem s. (brain) | SRR330867(SRX091705) tissue: skin psoriatic involveddisease state:. (skin) | DRR000562(DRX000320) Isolation of RNA following immunoprecipitatio. (ago3 cell line) | SRR039193(GSM494812) HL60 cell line is derived from acute promyelo. (cell line) | SRR330906(SRX091744) tissue: normal skindisease state: normal. (skin) | SRR191606(GSM715716) 84genomic small RNA (size selected RNA from t. (breast) | SRR040018(GSM532903) G701N. (cervix) | TAX577739(Rovira) total RNA. (breast) | SRR330902(SRX091740) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR033715(GSM497060) Mantle Cell Lymphoma (Mino122). (B cell) | SRR330866(SRX091704) tissue: skin psoriatic involveddisease state:. (skin) | DRR001489(DRX001043) Hela short nuclear cell fraction, control. (hela) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ................................................................................................ACCCGGCCATCCCATCTG................................................................. | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | |
| .......................................................GCTGCGCCTGGGGCGGTC.......................................................................................................... | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ............................................................................................................................................AGGTGGCTGCTGTGGATCCG................... | 20 | 7 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..............................................................................................GCACCCGGCCATCCCAGT................................................................... | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..........................................................................................................CCCATCTGTGACCCC.......................................................... | 15 | 9 | 0.11 | 0.11 | - | - | - | 0.11 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |