| (1) AGO2.ip | (1) BRAIN | (12) BREAST | (11) CELL-LINE | (7) CERVIX | (1) FIBROBLAST | (3) HEART | (4) LIVER | (1) OTHER | (52) SKIN | (3) UTERUS | (1) XRN.ip |
| ACTCTGCTCACCTATGCCACTCGAGATGACCTCATCTACACCCGCATCAGGTACATCCTGGGCCCCCCAAGTGTGAACCATGCATATGGCCTCATCCTGGCCAACTGCAGGCCTGCCTAGGTTCCTTCCTGGAAACCAAAGGGGCACCTGGGTCCCCTAGGGACAGAGGGGGCACTGGGCAGACAGTGTGTGCAAGATAGAGTCCAGGGCCACCTTCTGGCTGAGCCACACTGAGTCCATTACCCCCAGGGGAGGGATGGTATGCCGCATCTGGAGGGCCATCTTGGCACAGCGAGCAG .......................................................................................................................................................................(((((...(((((...(((((((.((.((.((((....(((....))))))).))..))))))))).)))))...))))).................................................... .................................................................................................................................................................162....................................................................................249................................................ | Size | Perfect hit | Total Norm | Perfect Norm | SRR444048(SRX128896) Sample 8cDNABarcode: AF-PP-333: ACG CTC TTC C. (skin) | SRR040028(GSM532913) G026N. (cervix) | SRR189782 | SRR390724(GSM850203) small rna immunoprecipitated. (cell line) | SRR444057(SRX128905) Sample 15cDNABarcode: AF-PP-334: ACG CTC TTC . (skin) | SRR330923(SRX091761) tissue: normal skindisease state: normal. (skin) | SRR444046(SRX128894) Sample 7cDNABarcode: AF-PP-342: ACG CTC TTC C. (skin) | SRR330866(SRX091704) tissue: skin psoriatic involveddisease state:. (skin) | SRR330901(SRX091739) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR444058(SRX128906) Sample 16cDNABarcode: AF-PP-335: ACG CTC TTC . (skin) | SRR444061(SRX128909) Sample 19cDNABarcode: AF-PP-341: ACG CTC TTC . (skin) | SRR444060(SRX128908) Sample 18cDNABarcode: AF-PP-340: ACG CTC TTC . (skin) | SRR342900(SRX096796) small RNA seq of Right atrial tissue. (heart) | SRR207116(GSM721078) Nuclear RNA. (cell line) | TAX577740(Rovira) total RNA. (breast) | SRR037942(GSM510480) 293DroshaTN_cand5. (cell line) | SRR330916(SRX091754) tissue: normal skindisease state: normal. (skin) | SRR330902(SRX091740) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR207115(GSM721077) XRN1&2 knockdown. (XRN1/XRN2 cell line) | SRR029131(GSM416760) MCF7. (cell line) | SRR342896(SRX096792) small RNA seq of Right atrial tissue. (heart) | SRR094131(GSM651907) small RNA(18-35nt)small RNA deep sequencing o. (uterus) | SRR330867(SRX091705) tissue: skin psoriatic involveddisease state:. (skin) | SRR330877(SRX091715) tissue: skin psoriatic involveddisease state:. (skin) | SRR330899(SRX091737) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330859(SRX091697) tissue: skin psoriatic involveddisease state:. (skin) | SRR037936(GSM510474) 293cand1. (cell line) | SRR330914(SRX091752) tissue: normal skindisease state: normal. (skin) | SRR444053(SRX128901) Sample 13cDNABarcode: AF-PP-341: ACG CTC TTC . (skin) | SRR444062(SRX128910) Sample 27_3cDNABarcode: AF-PP-343: ACG CTC TT. (skin) | SRR444049(SRX128897) Sample 9cDNABarcode: AF-PP-334: ACG CTC TTC C. (skin) | SRR330910(SRX091748) tissue: normal skindisease state: normal. (skin) | SRR330874(SRX091712) tissue: skin psoriatic involveddisease state:. (skin) | SRR330876(SRX091714) tissue: skin psoriatic involveddisease state:. (skin) | SRR330887(SRX091725) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330873(SRX091711) tissue: skin psoriatic involveddisease state:. (skin) | SRR330921(SRX091759) tissue: normal skindisease state: normal. (skin) | SRR330890(SRX091728) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330893(SRX091731) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330883(SRX091721) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR191402(GSM715512) 43genomic small RNA (size selected RNA from t. (breast) | SRR330907(SRX091745) tissue: normal skindisease state: normal. (skin) | SRR040016(GSM532901) G645N. (cervix) | SRR330904(SRX091742) tissue: normal skindisease state: normal. (skin) | SRR040011(GSM532896) G529T. (cervix) | SRR040024(GSM532909) G613N. (cervix) | SRR330912(SRX091750) tissue: normal skindisease state: normal. (skin) | SRR330868(SRX091706) tissue: skin psoriatic involveddisease state:. (skin) | SRR330905(SRX091743) tissue: normal skindisease state: normal. (skin) | SRR060984(GSM569188) Human plasma cell [09-001]. (cell line) | SRR039619(GSM531982) HBV(+) HCC Tissue Sample 1. (liver) | SRR330894(SRX091732) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR094132(GSM651908) small RNA(18-35nt)small RNA deep sequencing o. (uterus) | SRR191618(GSM715728) 148genomic small RNA (size selected RNA from . (breast) | SRR330885(SRX091723) tissue: skin psoriatic uninvolveddisease stat. (skin) | DRR000559(DRX000317) THP-1 whole cell RNA, no treatment. (cell line) | SRR189779(GSM714639) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | TAX577744(Rovira) total RNA. (breast) | SRR095854(SRX039177) miRNA were isolated from FirstChoice Human Br. (brain) | SRR553573(SRX182779) source: Cerebellum. (Cerebellum) | TAX577739(Rovira) total RNA. (breast) | SRR189783 | SRR191434(GSM715544) 171genomic small RNA (size selected RNA from . (breast) | SRR191606(GSM715716) 84genomic small RNA (size selected RNA from t. (breast) | SRR330906(SRX091744) tissue: normal skindisease state: normal. (skin) | SRR444043(SRX128891) Sample 4cDNABarcode: AF-PP-339: ACG CTC TTC C. (skin) | SRR039193(GSM494812) HL60 cell line is derived from acute promyelo. (cell line) | SRR039621(GSM531984) HBV(+) HCC Tissue Sample 2. (liver) | RoviraIPAgo2(Rovira) total RNA. (ago2 breast) | SRR330919(SRX091757) tissue: normal skindisease state: normal. (skin) | TAX577589(Rovira) total RNA. (breast) | SRR191581(GSM715691) 104genomic small RNA (size selected RNA from . (breast) | SRR342898(SRX096794) small RNA seq of Right atrial tissue. (heart) | SRR330915(SRX091753) tissue: normal skindisease state: normal. (skin) | SRR330869(SRX091707) tissue: skin psoriatic involveddisease state:. (skin) | SRR040043(GSM532928) G428T. (cervix) | SRR330920(SRX091758) tissue: normal skindisease state: normal. (skin) | SRR094130(GSM651906) small RNA(18-35nt)small RNA deep sequencing o. (uterus) | SRR191463(GSM715573) 111genomic small RNA (size selected RNA from . (breast) | SRR040010(GSM532895) G529N. (cervix) | SRR363675(GSM830252) cell type: human foreskin fibroblasts (HFF)tr. (fibroblast) | SRR191600(GSM715710) 90genomic small RNA (size selected RNA from t. (breast) | SRR038852(GSM458535) QF1160MB. (cell line) | SRR039617(GSM531980) HBV(+) Adjacent Tissue Sample 1. (liver) | SRR039620(GSM531983) HBV(+) Adjacent Tissue Sample 2. (liver) | SRR444055(SRX128903) Sample 27_2cDNABarcode: AF-PP-343: ACG CTC TT. (skin) | SRR444045(SRX128893) Sample 6cDNABarcode: AF-PP-341: ACG CTC TTC C. (skin) | SRR444047(SRX128895) Sample 27_1cDNABarcode: AF-PP-343: ACG CTC TT. (skin) | SRR444052(SRX128900) Sample 12cDNABarcode: AF-PP-340: ACG CTC TTC . (skin) | SRR444041(SRX128889) Sample 2cDNABarcode: AF-PP-334: ACG CTC TTC C. (skin) | SRR189785 | SRR330895(SRX091733) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330891(SRX091729) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR444054(SRX128902) Sample 14cDNABarcode: AF-PP-342: ACG CTC TTC . (skin) | SRR444059(SRX128907) Sample 17cDNABarcode: AF-PP-339: ACG CTC TTC . (skin) | SRR330886(SRX091724) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330889(SRX091727) tissue: skin psoriatic uninvolveddisease stat. (skin) | GSM532885(GSM532885) G850N. (cervix) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ....................................................................................................................................................................................................................................CACTGAGTCCATTACCCCCAGT................................................. | 22 | 1 | 25.00 | 5.00 | - | 3.00 | - | - | - | - | - | 2.00 | - | - | - | - | 1.00 | - | - | - | 1.00 | 1.00 | - | - | 1.00 | - | 2.00 | - | 2.00 | 1.00 | - | - | - | - | - | - | - | 1.00 | - | 1.00 | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | 1.00 | 1.00 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ....................................................................................................................................................................................................................................CACTGAGTCCATTACCCCCAGA................................................. | 22 | 1 | 9.00 | 5.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | 2.00 | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ......................................................................................................................................................................AGGGGGCACTGGGCAGACAGT................................................................................................................ | 21 | 1 | 7.00 | 7.00 | - | - | - | - | - | 3.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ......................................................................................................................................................................AGGGGGCACTGGGCAGACAGTGT.............................................................................................................. | 23 | 1 | 6.00 | 6.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | 2.00 | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ......................................................................................................................................................................AGGGGGCACTGGGCAGACAG................................................................................................................. | 20 | 1 | 5.00 | 5.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | 1.00 | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ....................................................................................................................................................................................................................................CACTGAGTCCATTACCCCCAG.................................................. | 21 | 1 | 5.00 | 5.00 | - | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .....................................................................................................................................................................................................................................ACTGAGTCCATTACCCCCAGT................................................. | 21 | 4.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ............................................................................................................................CTTCCTGGAAACCAAAG.............................................................................................................................................................. | 17 | 7 | 3.71 | 3.71 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.71 | - | - | 0.14 | - | - | - | 0.14 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.86 | - | 0.71 | - | - | - | - | - | - | - | - | - | 0.14 |
| ......................................................................................................................................................................AGGGGGCACTGGGCAGACAGTGTG............................................................................................................. | 24 | 1 | 2.00 | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .....................................................................................................................................................................GAGGGGGCACTGGGCAGACAGTGA.............................................................................................................. | 24 | 2.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ......................................................................................................................................................................AGGGGGCACTGGGCAGACA.................................................................................................................. | 19 | 1 | 2.00 | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ............................................................................................................................................................................................................................................CCATTACCCCCAGGGGAG............................................. | 18 | 1 | 2.00 | 2.00 | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ......................................................................................................................................................................AGGGGGCACTGGGCAGACAGTGTGT............................................................................................................ | 25 | 1 | 2.00 | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ....................................................................................................................................................................................................................................CACTGAGTCCATTACCCCCCGT................................................. | 22 | 2.00 | 0.00 | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .....................................................................................................................................................................................................................................ACTGAGTCCATTACCCCC.................................................... | 18 | 1 | 2.00 | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..................................TCTACACCCGCATCAGGGGAG.................................................................................................................................................................................................................................................... | 21 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .............................................................................................................................TTCCTGGAAACCAAAGTCTT.......................................................................................................................................................... | 20 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ........................GATGACCTCATCTACACCCGCATCAGGGGAG.................................................................................................................................................................................................................................................... | 31 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .....................................................................................................................................................................................................................................ACTGAGTCCATTACCCCCCGT................................................. | 21 | 1 | 1.00 | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .............................................................................................................................TTCCTGGAAACCAAAGTC............................................................................................................................................................ | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..........................................................................................................................................AAGGGGCACCTGGGTCCCCTAGGGACAGAGGG................................................................................................................................. | 32 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ....................................................................................................................................................................................................................................CACTGAGTCCATTACCCCCATT................................................. | 22 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ............................................................................................................AGGCCTGCCTAGGTTTGC............................................................................................................................................................................. | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ....................................................................................................................................................................................................................................CACTGAGTCCATTACCCCCAAAAA............................................... | 24 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ....................................................................................................................................................................................................................................CACTGAGTCCATTACCCC..................................................... | 18 | 1 | 1.00 | 1.00 | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ....................................................................................................................................................................................................................................CACTGAGTCCATTACCCCCAT.................................................. | 21 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .................................................................................................................................TGGAAACCAAAGGGGCACCTGG.................................................................................................................................................... | 22 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ....................................................................................................................................................................................................................................CACTGAGTCCATTACCC...................................................... | 17 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .............................................................................................................................................................................................................................................................GGGATGGTATGCCGCATC............................ | 18 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ....................................TACACCCGCATCAGGGGAG.................................................................................................................................................................................................................................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ....................................................................................................................................................................................................................................CACTGAGTCCATTACCCCCTGT................................................. | 22 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ......................................................................................................................................................................AGGGGGCACTGGGCAGACAGA................................................................................................................ | 21 | 1 | 1.00 | 5.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ......................................................................................................................................................................AGGGGGCACTGGGCAGACAGTAA.............................................................................................................. | 23 | 1 | 1.00 | 7.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ....................................................................................................................................................................................................................................CACTGAGTCCATTACCCCCAGTAG............................................... | 24 | 1 | 1.00 | 5.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ....................................................................................................................................................................................................................................CACTGAGTCCATTACCCTCAG.................................................. | 21 | 1 | 1.00 | 1.00 | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ......................................................................................................................................................................AGGGGGCACTGGGCAGACAGTGA.............................................................................................................. | 23 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ......................................................................................................................................................................AGGGGGCACTGGGCAGACAGTT............................................................................................................... | 22 | 1 | 1.00 | 7.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .............................................................................................................................TTCCTGGAAACCAAAGTCT........................................................................................................................................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .................................ATCTACACCCGCATCAGGGGAG.................................................................................................................................................................................................................................................... | 22 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .....................................................................................................................................................................................................................................ACTGAGTCCATTACCCCCAGA................................................. | 21 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ........................................................................................................................................................................................................................................GAGTCCATTACCCCCAGT................................................. | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...................................CTACACCCGCATCA.......................................................................................................................................................................................................................................................... | 14 | 4 | 0.25 | 0.25 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.25 | - | - | - | - | - | - | - |
| ............................................................................................................................................................CTAGGGACAGAGGGGG............................................................................................................................... | 16 | 8 | 0.12 | 0.12 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.12 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ACTCTGCTCACCTATGCCACTCGAGATGACCTCATCTACACCCGCATCAGGTACATCCTGGGCCCCCCAAGTGTGAACCATGCATATGGCCTCATCCTGGCCAACTGCAGGCCTGCCTAGGTTCCTTCCTGGAAACCAAAGGGGCACCTGGGTCCCCTAGGGACAGAGGGGGCACTGGGCAGACAGTGTGTGCAAGATAGAGTCCAGGGCCACCTTCTGGCTGAGCCACACTGAGTCCATTACCCCCAGGGGAGGGATGGTATGCCGCATCTGGAGGGCCATCTTGGCACAGCGAGCAG .......................................................................................................................................................................(((((...(((((...(((((((.((.((.((((....(((....))))))).))..))))))))).)))))...))))).................................................... .................................................................................................................................................................162....................................................................................249................................................ | Size | Perfect hit | Total Norm | Perfect Norm | SRR444048(SRX128896) Sample 8cDNABarcode: AF-PP-333: ACG CTC TTC C. (skin) | SRR040028(GSM532913) G026N. (cervix) | SRR189782 | SRR390724(GSM850203) small rna immunoprecipitated. (cell line) | SRR444057(SRX128905) Sample 15cDNABarcode: AF-PP-334: ACG CTC TTC . (skin) | SRR330923(SRX091761) tissue: normal skindisease state: normal. (skin) | SRR444046(SRX128894) Sample 7cDNABarcode: AF-PP-342: ACG CTC TTC C. (skin) | SRR330866(SRX091704) tissue: skin psoriatic involveddisease state:. (skin) | SRR330901(SRX091739) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR444058(SRX128906) Sample 16cDNABarcode: AF-PP-335: ACG CTC TTC . (skin) | SRR444061(SRX128909) Sample 19cDNABarcode: AF-PP-341: ACG CTC TTC . (skin) | SRR444060(SRX128908) Sample 18cDNABarcode: AF-PP-340: ACG CTC TTC . (skin) | SRR342900(SRX096796) small RNA seq of Right atrial tissue. (heart) | SRR207116(GSM721078) Nuclear RNA. (cell line) | TAX577740(Rovira) total RNA. (breast) | SRR037942(GSM510480) 293DroshaTN_cand5. (cell line) | SRR330916(SRX091754) tissue: normal skindisease state: normal. (skin) | SRR330902(SRX091740) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR207115(GSM721077) XRN1&2 knockdown. (XRN1/XRN2 cell line) | SRR029131(GSM416760) MCF7. (cell line) | SRR342896(SRX096792) small RNA seq of Right atrial tissue. (heart) | SRR094131(GSM651907) small RNA(18-35nt)small RNA deep sequencing o. (uterus) | SRR330867(SRX091705) tissue: skin psoriatic involveddisease state:. (skin) | SRR330877(SRX091715) tissue: skin psoriatic involveddisease state:. (skin) | SRR330899(SRX091737) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330859(SRX091697) tissue: skin psoriatic involveddisease state:. (skin) | SRR037936(GSM510474) 293cand1. (cell line) | SRR330914(SRX091752) tissue: normal skindisease state: normal. (skin) | SRR444053(SRX128901) Sample 13cDNABarcode: AF-PP-341: ACG CTC TTC . (skin) | SRR444062(SRX128910) Sample 27_3cDNABarcode: AF-PP-343: ACG CTC TT. (skin) | SRR444049(SRX128897) Sample 9cDNABarcode: AF-PP-334: ACG CTC TTC C. (skin) | SRR330910(SRX091748) tissue: normal skindisease state: normal. (skin) | SRR330874(SRX091712) tissue: skin psoriatic involveddisease state:. (skin) | SRR330876(SRX091714) tissue: skin psoriatic involveddisease state:. (skin) | SRR330887(SRX091725) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330873(SRX091711) tissue: skin psoriatic involveddisease state:. (skin) | SRR330921(SRX091759) tissue: normal skindisease state: normal. (skin) | SRR330890(SRX091728) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330893(SRX091731) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330883(SRX091721) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR191402(GSM715512) 43genomic small RNA (size selected RNA from t. (breast) | SRR330907(SRX091745) tissue: normal skindisease state: normal. (skin) | SRR040016(GSM532901) G645N. (cervix) | SRR330904(SRX091742) tissue: normal skindisease state: normal. (skin) | SRR040011(GSM532896) G529T. (cervix) | SRR040024(GSM532909) G613N. (cervix) | SRR330912(SRX091750) tissue: normal skindisease state: normal. (skin) | SRR330868(SRX091706) tissue: skin psoriatic involveddisease state:. (skin) | SRR330905(SRX091743) tissue: normal skindisease state: normal. (skin) | SRR060984(GSM569188) Human plasma cell [09-001]. (cell line) | SRR039619(GSM531982) HBV(+) HCC Tissue Sample 1. (liver) | SRR330894(SRX091732) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR094132(GSM651908) small RNA(18-35nt)small RNA deep sequencing o. (uterus) | SRR191618(GSM715728) 148genomic small RNA (size selected RNA from . (breast) | SRR330885(SRX091723) tissue: skin psoriatic uninvolveddisease stat. (skin) | DRR000559(DRX000317) THP-1 whole cell RNA, no treatment. (cell line) | SRR189779(GSM714639) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | TAX577744(Rovira) total RNA. (breast) | SRR095854(SRX039177) miRNA were isolated from FirstChoice Human Br. (brain) | SRR553573(SRX182779) source: Cerebellum. (Cerebellum) | TAX577739(Rovira) total RNA. (breast) | SRR189783 | SRR191434(GSM715544) 171genomic small RNA (size selected RNA from . (breast) | SRR191606(GSM715716) 84genomic small RNA (size selected RNA from t. (breast) | SRR330906(SRX091744) tissue: normal skindisease state: normal. (skin) | SRR444043(SRX128891) Sample 4cDNABarcode: AF-PP-339: ACG CTC TTC C. (skin) | SRR039193(GSM494812) HL60 cell line is derived from acute promyelo. (cell line) | SRR039621(GSM531984) HBV(+) HCC Tissue Sample 2. (liver) | RoviraIPAgo2(Rovira) total RNA. (ago2 breast) | SRR330919(SRX091757) tissue: normal skindisease state: normal. (skin) | TAX577589(Rovira) total RNA. (breast) | SRR191581(GSM715691) 104genomic small RNA (size selected RNA from . (breast) | SRR342898(SRX096794) small RNA seq of Right atrial tissue. (heart) | SRR330915(SRX091753) tissue: normal skindisease state: normal. (skin) | SRR330869(SRX091707) tissue: skin psoriatic involveddisease state:. (skin) | SRR040043(GSM532928) G428T. (cervix) | SRR330920(SRX091758) tissue: normal skindisease state: normal. (skin) | SRR094130(GSM651906) small RNA(18-35nt)small RNA deep sequencing o. (uterus) | SRR191463(GSM715573) 111genomic small RNA (size selected RNA from . (breast) | SRR040010(GSM532895) G529N. (cervix) | SRR363675(GSM830252) cell type: human foreskin fibroblasts (HFF)tr. (fibroblast) | SRR191600(GSM715710) 90genomic small RNA (size selected RNA from t. (breast) | SRR038852(GSM458535) QF1160MB. (cell line) | SRR039617(GSM531980) HBV(+) Adjacent Tissue Sample 1. (liver) | SRR039620(GSM531983) HBV(+) Adjacent Tissue Sample 2. (liver) | SRR444055(SRX128903) Sample 27_2cDNABarcode: AF-PP-343: ACG CTC TT. (skin) | SRR444045(SRX128893) Sample 6cDNABarcode: AF-PP-341: ACG CTC TTC C. (skin) | SRR444047(SRX128895) Sample 27_1cDNABarcode: AF-PP-343: ACG CTC TT. (skin) | SRR444052(SRX128900) Sample 12cDNABarcode: AF-PP-340: ACG CTC TTC . (skin) | SRR444041(SRX128889) Sample 2cDNABarcode: AF-PP-334: ACG CTC TTC C. (skin) | SRR189785 | SRR330895(SRX091733) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330891(SRX091729) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR444054(SRX128902) Sample 14cDNABarcode: AF-PP-342: ACG CTC TTC . (skin) | SRR444059(SRX128907) Sample 17cDNABarcode: AF-PP-339: ACG CTC TTC . (skin) | SRR330886(SRX091724) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330889(SRX091727) tissue: skin psoriatic uninvolveddisease stat. (skin) | GSM532885(GSM532885) G850N. (cervix) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ............................................................................................................................................................................................................................................................................................TGGCACAGCGAGCAG | 15 | 4 | 29.00 | 29.00 | 9.25 | - | - | - | 3.75 | 0.25 | 3.00 | - | - | 1.50 | 2.75 | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.25 | - | 1.25 | 0.50 | - | 0.25 | 0.25 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.75 | - | 0.50 | 0.25 | - | 0.25 | 0.25 | 0.25 | 0.25 | 0.25 | 0.25 | - |
| ............................................................................................................................................................................................................................................................................................TGGCACAGCGAGCA. | 14 | 6 | 5.67 | 5.67 | 2.00 | - | - | - | 0.17 | - | 0.17 | - | - | 1.33 | - | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.67 | - | 0.33 | - | 0.17 | - | - | 0.17 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.17 | - | - | - | - | - | - | - | - | - |
| ...................................................................................................................................................................................................................................................................GTATGCCGCATCTGGAGTGAT................... | 21 | 3.00 | 0.00 | - | - | - | 3.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..................................................................................................................................................................ACAGAGGGGGCACTGGG........................................................................................................................ | 17 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...............................TCATCTACACCCGCA............................................................................................................................................................................................................................................................. | 15 | 1 | 1.00 | 1.00 | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...................................................................................................................................................................................................................................................................GTATGCCGCATCTGGAGTGTT................... | 21 | 1.00 | 0.00 | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...................................................TACATCCTGGGCCCCTGTG..................................................................................................................................................................................................................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ............................ACCTCATCTACACCCGCATCAGGTACATCC................................................................................................................................................................................................................................................. | 30 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..........................................................................................CTCATCCTGGCCAACTGA............................................................................................................................................................................................... | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...................................CTACACCCGCATCAGGG....................................................................................................................................................................................................................................................... | 17 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...............................TCATCTACACCCGC.............................................................................................................................................................................................................................................................. | 14 | 2 | 0.50 | 0.50 | - | - | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |