(2) AGO2.ip | (3) B-CELL | (16) BRAIN | (1) DGCR8.mut | (2) EMBRYO | (5) ESC | (1) HEART | (4) LIVER | (9) OTHER | (2) OTHER.mut | (1) PANCREAS | (1) PIWI.ip | (4) SPLEEN | (5) TESTES | (2) THYMUS |
CCTTTGGTGAAAGACCCCTTCTAAGACCCAGTACTGCACTCAGGGACACTGAGGGAAGAGTACCAGGCCAGCTTTCAGCCTGGGCCCTGTCTGTGGGCAGAGGGATAAGCACTGGTCCCTAGAAGATGGGACTACAAAGGAGGGACTGACGGGGCTGGGGCTTACACCACTCTCTGGCTTACTGTTGTTCTTCATCACAGGAGAACTCCCCCATTGGCATCAAAGTCCTGCAGCTGATCCTGGATGACCC ..................................................................................(((((((((.((..((..........))..(((((((........)))))))..........)).))))))))).............................................................................................. ................................................................................81...............................................................................162...................................................................................... | Size | Perfect hit | Total Norm | Perfect Norm | SRR345196(SRX097257) source: size fractionated RNA from mouse hipp. (brain) | SRR345197(SRX097258) source: size fractionated RNA from mouse hipp. (brain) | SRR345200(SRX097261) source: size fractionated RNA from mouse hipp. (brain) | SRR345199(SRX097260) source: size fractionated RNA from mouse hipp. (brain) | SRR345198(SRX097259) source: size fractionated RNA from mouse hipp. (brain) | SRR345203(SRX097264) source: size fractionated RNA from mouse hipp. (brain) | SRR402760(SRX117943) source: ES E14 male cells. (ESC) | SRR345201(SRX097262) source: size fractionated RNA from mouse hipp. (brain) | SRR345202(SRX097263) source: size fractionated RNA from mouse hipp. (brain) | SRR345204(SRX097265) source: size fractionated RNA from mouse hipp. (brain) | SRR345205(SRX097266) source: size fractionated RNA from mouse hipp. (brain) | SRR029043(GSM433295) 18.5dpc_homo_tdrd1-KO. (tdrd1 testes) | GSM640578(GSM640578) small RNA in the liver with paternal control. (liver) | SRR073955(GSM629281) total RNA. (blood) | GSM640580(GSM640580) small RNA in the liver with paternal Low pro. (liver) | SRR042463(GSM539855) mouse natural killer cells [09-002]. (spleen) | SRR345206(SRX097267) source: size fractionated RNA from mouse hipp. (brain) | SRR248526(GSM733814) cell type: Thy1- spermatogonial stem cellstra. (testes) | SRR039153(GSM471930) HL1_siSrf1_smallRNAseq. (muscle) | SRR553583(SRX182789) source: Cerebellum. (Cerebellum) | SRR042454(GSM539846) mouse germinal center B cells (lymph node) [09-002]. (b cell) | SRR391848(GSM852143) gender: femalegenotype/variation: wild typeti. (embryo) | SRR059770(GSM562832) Treg_Dicer. (spleen) | SRR402762(SRX117945) source: ES E14 male cells. (ESC) | SRR345207(SRX097268) source: size fractionated RNA from mouse hipp. (brain) | SRR248524(GSM733812) cell type: Thy1+ spermatogonial stem cellstra. (testes) | GSM640581(GSM640581) small RNA in the liver with paternal control. (liver) | SRR306541(GSM750584) 19-24nt. (ago2 brain) | SRR042467(GSM539859) mouse T cells activated in vitro with Concanavalin A [09-002]. (spleen) | SRR042448(GSM539840) mouse B cells activated in vitro with LPS/IL4 replicate 1 [09-002]. (b cell) | SRR039154(GSM471931) HL1_siSrf2_smallRNAseq. (muscle) | SRR306542(GSM750585) 19-24nt. (ago2 brain) | SRR059765(GSM562827) DN3_control. (thymus) | GSM314557(GSM314557) ESC dgcr8 (Illumina). (ESC) | SRR059767(GSM562829) DN3_Dicer. (thymus) | SRR042481(GSM539873) mouse pancreatic tissue [09-002]. (pancreas) | SRR038742(GSM527277) small RNA-Seq. (dgcr8 brain) | SRR042462(GSM539854) mouse macrophages [09-002]. (bone marrow) | SRR042466(GSM539858) mouse CD8+ T cells (spleen) [09-002]. (spleen) | SRR279907(GSM689057) cell type: mouse embryonic stem cellcell line. (ESC) | SRR042455(GSM539847) mouse plasma cells [09-002]. (blood) | SRR042444(GSM539836) mouse pre B cells [09-002]. (b cell) | SRR402766(SRX117949) source: ES PGK female cells. (ESC) | GSM640579(GSM640579) small RNA in the liver with paternal Low pro. (liver) | SRR059774(GSM562836) MEF_control. (MEF) | SRR073954(GSM629280) total RNA. (blood) | SRR553584(SRX182790) source: Heart. (Heart) | mjTestesKO5() Testes Data. (Zcchc11 testes) | SRR014233(GSM319957) 16.5 dpc MIWI2. (miwi2 testes) | SRR391846(GSM852141) gender: femalegenotype/variation: ADAR2-/-tis. (embryo) | SRR346417(SRX098258) Global profiling of miRNA and the hairpin pre. (Brain) | SRR039152(GSM471929) HL1_siNon_smallRNAseq. (muscle) |
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
...........................................................................................................................................GAGGGACTGACGGGGGCAT............................................................................................ | 19 | 1 | 111.00 | 31.00 | 15.00 | 2.00 | 11.00 | 32.00 | 8.00 | 15.00 | - | 6.00 | 8.00 | 2.00 | - | - | - | - | - | 2.00 | - | - | 1.00 | - | 2.00 | - | - | - | - | - | - | - | 1.00 | 1.00 | - | - | - | - | - | - | - | - | 1.00 | - | 1.00 | 1.00 | - | - | - | - | - | 1.00 | - | - | - | 1.00 |
...........................................................................................................................................GAGGGACTGACGGGGGCA............................................................................................. | 18 | 1 | 97.00 | 31.00 | 23.00 | 14.00 | 17.00 | 5.00 | 15.00 | 9.00 | - | 5.00 | 2.00 | - | - | - | - | 1.00 | - | 1.00 | - | - | 1.00 | - | - | - | - | 2.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
...........................................................................................................................................GAGGGACTGACGGGGGC.............................................................................................. | 17 | 1 | 64.00 | 31.00 | 3.00 | 10.00 | 5.00 | - | 3.00 | 6.00 | 23.00 | 1.00 | 3.00 | 3.00 | - | - | - | 3.00 | - | - | - | 2.00 | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
...........................................................................................................................................GAGGGACTGACGGGGG............................................................................................... | 16 | 1 | 44.00 | 31.00 | 5.00 | 17.00 | 3.00 | 2.00 | 3.00 | 2.00 | 6.00 | 2.00 | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - |
...........................................................................................................................................GAGGGACTGACGGGG................................................................................................ | 15 | 1 | 31.00 | 31.00 | 8.00 | 1.00 | 4.00 | 1.00 | 2.00 | 5.00 | - | - | - | 1.00 | 6.00 | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
...........................................................................................................................................GAGGGACTGACGGGGGCAC............................................................................................ | 19 | 1 | 10.00 | 31.00 | - | 2.00 | 2.00 | 2.00 | 4.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
...........................................................................................................................................GAGGGACTGACGGGGGCAG............................................................................................ | 19 | 1 | 8.00 | 31.00 | - | 1.00 | 4.00 | 3.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
............................................................................................................................................AGGGACTGACGGGGCC.............................................................................................. | 16 | 5.00 | 0.00 | - | 3.00 | 1.00 | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
...........................................................................................................................................GAGGGACTGACGGGGAA.............................................................................................. | 17 | 1 | 5.00 | 31.00 | 5.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
............................................................................................................................................AGGGACTGACGGGGCCA............................................................................................. | 17 | 3.00 | 0.00 | - | 1.00 | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
...........................................................................................................................................GAGGGACTGACGGGGGGAT............................................................................................ | 19 | 1 | 3.00 | 31.00 | 2.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
...........................................................................................................................................GAGGGACTGACGGGGGCG............................................................................................. | 18 | 1 | 3.00 | 31.00 | 1.00 | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
...........................................................................................................................................GAGGGACTGACGGGGCCAT............................................................................................ | 19 | 1 | 3.00 | 1.00 | - | - | - | 2.00 | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
...........................................................................................................................................GAGGGACTGACGGGGGAAT............................................................................................ | 19 | 1 | 3.00 | 31.00 | - | - | - | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
.........................................................................................................................................AGGAGGGACTGACGGG................................................................................................. | 16 | 1 | 2.00 | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
...........................................................................................................................................GAGGGACTGACGGGGGCAA............................................................................................ | 19 | 1 | 2.00 | 31.00 | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
............................................................................................................................................AGGGACTGACGGGGCAT............................................................................................. | 17 | 2.00 | 0.00 | - | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
...........................................................................................................................................GAGGGACTGACGGGGGTAT............................................................................................ | 19 | 1 | 2.00 | 31.00 | 1.00 | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
..............................................................................................................................................GGACTGACGGGGCTGTTC.......................................................................................... | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
...........................................................................................................................................GAGGGACTGACGGGGGGA............................................................................................. | 18 | 1 | 1.00 | 31.00 | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
...........................................................................................................................................GAGGGACTGACGGGGTCA............................................................................................. | 18 | 1 | 1.00 | 31.00 | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
.....................................................................................................................CCTAGAAGATGGGACCAGC.................................................................................................................. | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | |
...............................................................................................................................................................................................................CCCCCATTGGCATCAACA......................... | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | |
....................................................................................................................................................................................................................................TGCAGCTGATCCTGGGTAT... | 19 | 1.00 | 0.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
............................................................................................................................................AGGGACTGACGGGGCCCT............................................................................................ | 18 | 1.00 | 0.00 | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
.........................................AGGGACACTGAGGGAATT............................................................................................................................................................................................... | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | |
...........................................................................................................................................GAGGGACTGACGGGGGCGT............................................................................................ | 19 | 1 | 1.00 | 31.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
............................................................................................................................................AGGGACTGACGGGGCAA............................................................................................. | 17 | 1.00 | 0.00 | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
...........................................................................................................................................GAGGGACTGACGGGGC............................................................................................... | 16 | 1 | 1.00 | 1.00 | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
...........................................................................................................................................GAGGGACTGACGGGGACCG............................................................................................ | 19 | 1 | 1.00 | 31.00 | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
...........................................................................................................................................GAGGGACTGACGGGGGGCA............................................................................................ | 19 | 1 | 1.00 | 31.00 | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
...........................................................................................................................................GAGGGACTGACGGGGCCTTT........................................................................................... | 20 | 1 | 1.00 | 1.00 | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
...........................................................................................................................................GAGGGACTGACGGGGGAGT............................................................................................ | 19 | 1 | 1.00 | 31.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
...........................................................................................................................................GAGGGACTGACGGGGCCTT............................................................................................ | 19 | 1 | 1.00 | 1.00 | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
.....................................................................................CCTGTCTGTGGGCAGGG.................................................................................................................................................... | 17 | 1.00 | 0.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
.................................................................................................................................................................................CTTACTGTTGTTCTTCATCACAA.................................................. | 23 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
...........................................................................................................................................GAGGGACTGACGGGGCCA............................................................................................. | 18 | 1 | 1.00 | 1.00 | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
............................................................................................................................................AGGGACTGACGGGGCA.............................................................................................. | 16 | 1.00 | 0.00 | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
...........................................................................................................................................GAGGGACTGACGGGGGGC............................................................................................. | 18 | 1 | 1.00 | 31.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
...........................................................................................................................................GAGGGACTGACGGGGCA.............................................................................................. | 17 | 1 | 1.00 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
...........................................................................................................................................GAGGGACTGACGGGGTCAT............................................................................................ | 19 | 1 | 1.00 | 31.00 | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
...........................................................................................................................................GAGGGACTGACGGGGTG.............................................................................................. | 17 | 1 | 1.00 | 31.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
.........................................................................................................................................................................CTCTCTGGCTTACTGTTGTTCTTCATCACAG.................................................. | 31 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - |
............................................................................................................................................AGGGACTGACGGGGCCAG............................................................................................ | 18 | 1.00 | 0.00 | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
..............................................................................................................................................................................TGGCTTACTGTTGTTCTTCATCA..................................................... | 23 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
...........................................................................................................................................GAGGGACTGACGGGGGCC............................................................................................. | 18 | 1 | 1.00 | 31.00 | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
...........................................................................................................................................GAGGGACTGACGGGGGCGC............................................................................................ | 19 | 1 | 1.00 | 31.00 | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
............................................................................................................................................AGGGACTGACGGGGCCGT............................................................................................ | 18 | 1.00 | 0.00 | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
CCTTTGGTGAAAGACCCCTTCTAAGACCCAGTACTGCACTCAGGGACACTGAGGGAAGAGTACCAGGCCAGCTTTCAGCCTGGGCCCTGTCTGTGGGCAGAGGGATAAGCACTGGTCCCTAGAAGATGGGACTACAAAGGAGGGACTGACGGGGCTGGGGCTTACACCACTCTCTGGCTTACTGTTGTTCTTCATCACAGGAGAACTCCCCCATTGGCATCAAAGTCCTGCAGCTGATCCTGGATGACCC ..................................................................................(((((((((.((..((..........))..(((((((........)))))))..........)).))))))))).............................................................................................. ................................................................................81...............................................................................162...................................................................................... | Size | Perfect hit | Total Norm | Perfect Norm | SRR345196(SRX097257) source: size fractionated RNA from mouse hipp. (brain) | SRR345197(SRX097258) source: size fractionated RNA from mouse hipp. (brain) | SRR345200(SRX097261) source: size fractionated RNA from mouse hipp. (brain) | SRR345199(SRX097260) source: size fractionated RNA from mouse hipp. (brain) | SRR345198(SRX097259) source: size fractionated RNA from mouse hipp. (brain) | SRR345203(SRX097264) source: size fractionated RNA from mouse hipp. (brain) | SRR402760(SRX117943) source: ES E14 male cells. (ESC) | SRR345201(SRX097262) source: size fractionated RNA from mouse hipp. (brain) | SRR345202(SRX097263) source: size fractionated RNA from mouse hipp. (brain) | SRR345204(SRX097265) source: size fractionated RNA from mouse hipp. (brain) | SRR345205(SRX097266) source: size fractionated RNA from mouse hipp. (brain) | SRR029043(GSM433295) 18.5dpc_homo_tdrd1-KO. (tdrd1 testes) | GSM640578(GSM640578) small RNA in the liver with paternal control. (liver) | SRR073955(GSM629281) total RNA. (blood) | GSM640580(GSM640580) small RNA in the liver with paternal Low pro. (liver) | SRR042463(GSM539855) mouse natural killer cells [09-002]. (spleen) | SRR345206(SRX097267) source: size fractionated RNA from mouse hipp. (brain) | SRR248526(GSM733814) cell type: Thy1- spermatogonial stem cellstra. (testes) | SRR039153(GSM471930) HL1_siSrf1_smallRNAseq. (muscle) | SRR553583(SRX182789) source: Cerebellum. (Cerebellum) | SRR042454(GSM539846) mouse germinal center B cells (lymph node) [09-002]. (b cell) | SRR391848(GSM852143) gender: femalegenotype/variation: wild typeti. (embryo) | SRR059770(GSM562832) Treg_Dicer. (spleen) | SRR402762(SRX117945) source: ES E14 male cells. (ESC) | SRR345207(SRX097268) source: size fractionated RNA from mouse hipp. (brain) | SRR248524(GSM733812) cell type: Thy1+ spermatogonial stem cellstra. (testes) | GSM640581(GSM640581) small RNA in the liver with paternal control. (liver) | SRR306541(GSM750584) 19-24nt. (ago2 brain) | SRR042467(GSM539859) mouse T cells activated in vitro with Concanavalin A [09-002]. (spleen) | SRR042448(GSM539840) mouse B cells activated in vitro with LPS/IL4 replicate 1 [09-002]. (b cell) | SRR039154(GSM471931) HL1_siSrf2_smallRNAseq. (muscle) | SRR306542(GSM750585) 19-24nt. (ago2 brain) | SRR059765(GSM562827) DN3_control. (thymus) | GSM314557(GSM314557) ESC dgcr8 (Illumina). (ESC) | SRR059767(GSM562829) DN3_Dicer. (thymus) | SRR042481(GSM539873) mouse pancreatic tissue [09-002]. (pancreas) | SRR038742(GSM527277) small RNA-Seq. (dgcr8 brain) | SRR042462(GSM539854) mouse macrophages [09-002]. (bone marrow) | SRR042466(GSM539858) mouse CD8+ T cells (spleen) [09-002]. (spleen) | SRR279907(GSM689057) cell type: mouse embryonic stem cellcell line. (ESC) | SRR042455(GSM539847) mouse plasma cells [09-002]. (blood) | SRR042444(GSM539836) mouse pre B cells [09-002]. (b cell) | SRR402766(SRX117949) source: ES PGK female cells. (ESC) | GSM640579(GSM640579) small RNA in the liver with paternal Low pro. (liver) | SRR059774(GSM562836) MEF_control. (MEF) | SRR073954(GSM629280) total RNA. (blood) | SRR553584(SRX182790) source: Heart. (Heart) | mjTestesKO5() Testes Data. (Zcchc11 testes) | SRR014233(GSM319957) 16.5 dpc MIWI2. (miwi2 testes) | SRR391846(GSM852141) gender: femalegenotype/variation: ADAR2-/-tis. (embryo) | SRR346417(SRX098258) Global profiling of miRNA and the hairpin pre. (Brain) | SRR039152(GSM471929) HL1_siNon_smallRNAseq. (muscle) |
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
.............................................................................................................................................GGGACTGACGGGGCTGCCA.......................................................................................... | 19 | 15.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | 3.00 | 1.00 | - | 2.00 | - | - | - | - | - | - | 1.00 | 2.00 | - | - | - | 1.00 | - | - | - | - | - | - | - | 1.00 | - | - | 1.00 | - | - | - | - | - | 1.00 | 1.00 | - | - | - | 1.00 | - | - | - | |
.............................................................................................................................................GGGACTGACGGGGCTGCC........................................................................................... | 18 | 8.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | 2.00 | 3.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
..........................................................................................................................................GGAGGGACTGACGGGGCA.............................................................................................. | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
.............................................................................................................................................GGGACTGACGGGGCTCCCA.......................................................................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
....................................................................................................................................................................................ACTGTTGTTCTTCATCTTTT.................................................. | 20 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
.............................................................................................................................................GGGACTGACGGGGCTGCCC.......................................................................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
..............................................................................................................................................................................................................................AAGTCCTGCAGCTGAAGGG......... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | |
...........................................................................................................................................................................................................................GGATCAGCTGCAGGACTTTGA.......... | 21 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
..........................................................................................................................................GGAGGGACTGACGGGGCTA............................................................................................. | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |