ID: uc009rno.10
GENE: Uba7(11)
chr9:107880827-107881006+


(1)
AGO.mut 		(2)
AGO1.ip 		(4)
AGO2.ip 		(1)
AGO3.ip 		(10)
B-CELL 		(10)
BRAIN 		(1)
CELL-LINE 		(12)
EMBRYO 		(1)
ESC 		(3)
FIBROBLAST 		(1)
HEART 		(2)
KIDNEY 		(10)
LIVER 		(2)
LUNG 		(4)
LYMPH 		(15)
OTHER 		(1)
OTHER.mut 		(1)
OVARY 		(1)
PANCREAS 		(1)
PIWI.ip 		(1)
SKIN 		(9)
SPLEEN 		(7)
TESTES 		(3)
THYMUS 		(2)
TOTAL-RNA 		(1)
UTERUS

Sense strand
TGTTTGGAACTGATCTTCAAGAGAAACTGAGTGACCAACACTACCTCTTGGTGAGCTGGGGGATGCTAGTGGGGAATGTCTTTGGGAAATCCACACCACATGCTCTGGCTAAGACTGTTTCTGTCACCAGGTGGGTGCTGGTGCCATTGGCTGTGAGATGCTCAAAGTCTTTGCCCTAGT
.....................................................(((..(((.(((...(((.(((...((.....))..))).)))..))).)))..)))......................................................................
..................................................51.................................................................118............................................................
SizePerfect hitTotal NormPerfect NormSRR346421(SRX098263)
Global profiling of miRNA and the hairpin pre. (mixture)		SRR042471(GSM539863)
mouse TFHS cells [09-002]. (spleen)		SRR042458(GSM539850)
mouse basophil cells [09-002]. (b cell)		SRR345200(SRX097261)
source: size fractionated RNA from mouse hipp. (brain)		SRR391848(GSM852143)
gender: femalegenotype/variation: wild typeti. (embryo)		SRR042457(GSM539849)
mouse mast cells [09-002]. (bone marrow)		SRR042473(GSM539865)
mouse nTreg cells [09-002]. (lymph)		SRR073955(GSM629281)
total RNA. (blood)		mjLiverKO1()
Liver Data. (Zcchc11 liver)		SRR059769(GSM562831)
Treg_Drosha. (spleen)		SRR037905(GSM510441)
brain_rep2. (brain)		GSM510444(GSM510444)
brain_rep5. (brain)		SRR042469(GSM539861)
mouse Th2 cells [09-002]. (lymph)		mjTestesWT3()
Testes Data. (testes)		SRR042459(GSM539851)
mouse neutrophil cells replicate 1 [09-002]. (blood)		SRR042447(GSM539839)
mouse mature B cells (spleen) replicate 2 [09-002]. (b cell)		SRR042488(GSM539880)
mouse BclXL germinal center B cells [BalbC] [09-002]. (B cell)		SRR039153(GSM471930)
HL1_siSrf1_smallRNAseq. (muscle)		SRR040489(GSM533912)
E18.5 Ago2 catalytically inactive LIVER small RNA. (ago2 liver)		SRR059767(GSM562829)
DN3_Dicer. (thymus)		SRR042487(GSM539879)
mouse BclXL B activated with LPS/IL4 [BalbC] [09-002]. (spleen)		SRR042465(GSM539857)
mouse CD4+ T cells (spleen) [09-002]. (spleen)		SRR042468(GSM539860)
mouse Th1 cells [09-002]. (lymph)		SRR391851(GSM852146)
gender: femalegenotype/variation: wild typeti. (embryo)		SRR042448(GSM539840)
mouse B cells activated in vitro with LPS/IL4 replicate 1 [09-002]. (b cell)		SRR346413(SRX098254)
Global profiling of miRNA and the hairpin pre. (Heart)		SRR248526(GSM733814)
cell type: Thy1- spermatogonial stem cellstra. (testes)		SRR042451(GSM539843)
mouse B cells activated in vitro with LPS/aIgD-Dextran [09-002]. (b cell)		mjLiverWT3()
Liver Data. (liver)		SRR059770(GSM562832)
Treg_Dicer. (spleen)		SRR525244(SRA056111/SRX170320)
Mus musculus domesticus miRNA sequencing. (ago2 Blood)		SRR306541(GSM750584)
19-24nt. (ago2 brain)		SRR042452(GSM539844)
mouse B1 B cells [09-002]. (b cell)		SRR042449(GSM539841)
mouse B cells activated in vitro with LPS/IL4 replicate 2 [09-002]. (b cell)		SRR042453(GSM539845)
mouse marginal zone B cells (spleen) [09-002]. (b cell)		SRR391853(GSM852148)
gender: femalegenotype/variation: ADAR2-/-/AD. (embryo)		GSM640579(GSM640579)
small RNA in the liver with paternal Low pro. (liver)		SRR346414(SRX098255)
Global profiling of miRNA and the hairpin pre. (Spleen)		SRR248527(GSM733815)
cell type: spermatogonial stem cell enriched . (testes)		SRR042466(GSM539858)
mouse CD8+ T cells (spleen) [09-002]. (spleen)		SRR391852(GSM852147)
gender: femalegenotype/variation: ADAR2-/-tis. (embryo)		SRR039154(GSM471931)
HL1_siSrf2_smallRNAseq. (muscle)		SRR039152(GSM471929)
HL1_siNon_smallRNAseq. (muscle)		SRR391850(GSM852145)
gender: femalegenotype/variation: ADAR2-/-/AD. (embryo)		SRR037925(GSM510463)
e9p5_rep3. (embryo)		SRR042450(GSM539842)
mouse B cells activated in vitro with LPS/IL4 replicate 3 [09-002]. (b cell)		GSM640581(GSM640581)
small RNA in the liver with paternal control. (liver)		SRR059766(GSM562828)
DN3_Drosha. (thymus)		SRR346419(SRX098260)
Global profiling of miRNA and the hairpin pre. (Lung)		SRR042484(GSM539876)
mouse salivary gland tissue [09-002]. (gland)		SRR042460(GSM539852)
mouse neutrophil cells replicate 2 [09-002]. (blood)		SRR039184(GSM485324)
shLuc.1309 (+dox). (fibroblast)		SRR345197(SRX097258)
source: size fractionated RNA from mouse hipp. (brain)		SRR042470(GSM539862)
mouse Th17 cells [09-002]. (lymph)		SRR391846(GSM852141)
gender: femalegenotype/variation: ADAR2-/-tis. (embryo)		SRR037904(GSM510440)
brain_rep1. (brain)		SRR042467(GSM539859)
mouse T cells activated in vitro with Concanavalin A [09-002]. (spleen)		SRR306539(GSM750582)
19-24nt. (ago2 brain)		SRR042478(GSM539870)
mouse lung tissue [09-002]. (lung)		SRR042486(GSM539878)
mouse ovaries [09-002]. (ovary)		SRR037929(GSM510467)
e7p5_rep3. (embryo)		SRR037928(GSM510466)
e7p5_rep2. (embryo)		SRR037923(GSM510461)
e9p5_rep1. (embryo)		SRR391849(GSM852144)
gender: femalegenotype/variation: ADAR2-/-tis. (embryo)		SRR042480(GSM539872)
mouse kidney tissue [09-002]. (kidney)		SRR346417(SRX098258)
Global profiling of miRNA and the hairpin pre. (Brain)		SRR069809(GSM610965)
small RNA sequencing; sample 1. (testes)		SRR042462(GSM539854)
mouse macrophages [09-002]. (bone marrow)		SRR525243(SRA056111/SRX170319)
Mus musculus domesticus miRNA sequencing. (ago2 Blood)		Ago3IP805(Rui)
Quantitative functions of Argonaute proteins . (ago3 skin)		SRR525240(SRA056111/SRX170316)
Mus musculus domesticus miRNA sequencing. (ago1 Blood)		SRR345205(SRX097266)
source: size fractionated RNA from mouse hipp. (brain)		SRR037901(GSM510437)
testes_rep2. (testes)		GSM640580(GSM640580)
small RNA in the liver with paternal Low pro. (liver)		SRR346418(SRX098259)
Global profiling of miRNA and the hairpin pre. (Liver)		SRR279904(GSM689054)
cell type: mouse embryonic stem cellcell line. (ESC)		SRR525241(SRA056111/SRX170317)
Mus musculus domesticus miRNA sequencing. (ago1 Blood)		SRR040488(GSM533911)
E18.5 wild type LIVER small RNA. (liver)		SRR065058(SRR065058)
Tissue-specific Regulation of Mouse MicroRNA . (pancreas)		GSM475281(GSM475281)
total RNA. (testes)		SRR042463(GSM539855)
mouse natural killer cells [09-002]. (spleen)		SRR037936(GSM510474)
293cand1. (cell line)		GSM510454(GSM510454)
newborn_rep10. (total RNA)		SRR042446(GSM539838)
mouse mature B cells (spleen) replicate 1 [09-002]. (b cell)		SRR553585(SRX182791)
source: Kidney. (Kidney)		SRR032476(GSM485234)
sRNA_delayed_deep_sequencing. (uterus)		SRR042475(GSM539867)
mouse embryonic fibroblast cells [09-002]. (fibroblast)		GSM475279(GSM475279)
Miwi-IP. (miwi testes)		SRR039185(GSM485325)
shLuc.1309;ROSA-rtTA (-dox). (fibroblast)		SRR059765(GSM562827)
DN3_control. (thymus)		GSM510456(GSM510456)
newborn_rep12. (total RNA)		SRR077864(GSM637801)
18-30 nt small RNAs. (liver)		SRR039610(GSM527274)
small RNA-Seq. (brain)		SRR042461(GSM539853)
mouse dendritic cells [09-002]. (bone marrow)		SRR077866(GSM637803)
18-30 nt small RNAs. (liver)		SRR037924(GSM510462)
e9p5_rep2. (embryo)
............................................................................................ACACCACATGCTCTGGCTAAGA..................................................................22170.0070.00-5.005.00-3.003.001.002.00-3.001.004.001.004.00-1.00--1.00----2.00-1.001.00-----1.00-1.001.001.002.002.00----1.00--1.00-1.001.001.00----1.001.00-1.001.00-----1.001.001.00-1.00-1.001.001.00-----1.001.00-1.001.001.00-----1.001.001.00---
............................................................................................ACACCACATGCTCTGGCTAAG...................................................................21136.0036.00-3.002.00--1.002.00---2.00-1.00-3.002.001.00----1.002.00--1.001.002.00-----------1.00------1.00--1.00---1.00---------1.00----1.00-1.00------1.001.00------1.001.00--1.00------
............................................................................................ACACCACATGCTCTGGCTAAGT..................................................................22119.0036.00----2.00--3.00----1.00------2.00-1.00---1.001.00------------------1.00-2.001.00-1.00-----------------------1.00------------1.00------1.00-
............................................................................................ACACCACATGCTCTGGCTAA....................................................................20115.0015.00-1.001.00-1.00----1.00---------1.002.001.00----------1.00------1.00----2.00-----------------1.00-------------1.00------------------1.00
..................................................GTGAGCTGGGGGATGCTAGTGGGGAATGTCTTTGGGAAATCCACACCACATGCTCTGGCTAAGACTGTTTCTGTCACCAG..................................................80114.0014.0014.00-----------------------------------------------------------------------------------------------
............................................................................................ACACCACATGCTCTGGCT......................................................................1819.009.00---9.00--------------------------------------------------------------------------------------------
............................................................................................ACACCACATGCTCTGGCTATGT..................................................................2216.001.00-1.00---2.00---1.00----1.001.00--------------------------------------------------------------------------------
......................................................................................................CTCTGGCTAAGACTGTTTCTG.........................................................2115.005.00--------5.00---------------------------------------------------------------------------------------
...........................................................................................CACACCACATGCTCTGGCTAAGA..................................................................2315.005.00-1.001.00---1.00--------------------1.00--------1.00-----------------------------------------------------------
.............................................................................................CACCACATGCTCTGGCTAAGA..................................................................2114.004.00----------------------------3.00----1.00--------------------------------------------------------------
...........................................................................................CACACCACATGCTCTGGCTAAG...................................................................2214.004.00----------------------1.00-3.00-----------------------------------------------------------------------
.........................................TACCTCTTGGTGAGCCGGC........................................................................................................................194.000.00-------------------------------2.00--------1.00----------------1.00--------------------------------------
..................................................GTGAGCTGGGGGATGCTAGTGG............................................................................................................2214.004.00-1.001.00---1.00-------------1.00---------------------------------------------------------------------------
............................................................................................ACACCACATGCTCTGGCTAAGAC.................................................................2313.003.00----------1.00------------1.00----------------1.00-------------------------------------------------------
..................................................GTGAGCTGGGGGATGCTAGTGGGGAATGTCTTTGGGAAATCCACACCACATGCTCTGGCTAAGACTGTTTCTGTCACCAGA.................................................8113.0014.003.00-----------------------------------------------------------------------------------------------
............................................................................................ACACCACATGCTCTGGCTAT....................................................................2012.001.00------1.00-----------------------1.00-----------------------------------------------------------------
...............................................................TGCTAGTGGGGAATGTCTTTGGG..............................................................................................2312.002.00------------------2.00-----------------------------------------------------------------------------
............................................................................................ACACCACATGCTCTGGCTAAT...................................................................2112.0015.00----1.00-------------------------1.00-----------------------------------------------------------------
............................................................................................ACACCACATGCTCTGGCTAAGAT.................................................................2312.0070.00----------------2.00-------------------------------------------------------------------------------
............................................................................................ACACCACATGCTCTGGCTGAGA..................................................................2211.009.00---------------------------------------------------------------------------------------------1.00--
............................................................................................ACACCACATGCTCTGGCTAAGAAA................................................................2411.0070.00----------------------------------1.00-------------------------------------------------------------
...................................................TGAGCTGGGGGATGCTGTGG.............................................................................................................201.000.00----------------------------------------------------1.00-------------------------------------------
............................................................................................ACACCACATGCTCTGGCTAATA..................................................................2211.0015.00---------------------------------1.00--------------------------------------------------------------
..................................................GTGAGCTGGGGGATGCTAGTGA............................................................................................................221.000.00------------1.00-----------------------------------------------------------------------------------
..................................................GTGAGCTGGGGGATGCTAGTGGGGAATGTCTTTGGGAAATCCACACCACATGCTCTGGCTAAGACTGTTTCTGTCACC....................................................7811.001.001.00-----------------------------------------------------------------------------------------------
..................................................GTGAGCTGGGGGATGCTAGTAT............................................................................................................221.000.00-1.00----------------------------------------------------------------------------------------------
..................................................................................................................................................TTGGCTGTGAGATGCCATT...............191.000.00---------------------------------------------------------------------------------1.00--------------
............................................................................................ACACCACATGCTCTGGCTAAGAA.................................................................2311.0070.00-----1.00------------------------------------------------------------------------------------------
...........................................................................................CACACCACATGCTCTGGCTATGT..................................................................231.000.00-----------------------------1.00------------------------------------------------------------------
............................................................................................ACACCACATGCTCTGGCTA.....................................................................1911.001.00-------------------------------------------1.00----------------------------------------------------
...........................................................................................CACACCACATGCTCTGGCTAA....................................................................2111.001.00--1.00---------------------------------------------------------------------------------------------
........................................................TGGGGGATGCTAGTGGGGA.........................................................................................................1911.001.00------------------1.00-----------------------------------------------------------------------------
........................................................................................................CTGGCTAAGACTGTTTCTGTCA......................................................2211.001.00---------------------------------------------1.00--------------------------------------------------
..................................................GTGAGCTGGGGGATGCTAGTGGT...........................................................................................................2311.004.00-1.00----------------------------------------------------------------------------------------------
............................................................................................ACACCACATGCTCTGGCTGT....................................................................2011.009.00----------------1.00-------------------------------------------------------------------------------
...........................................................................................CACACCACATGCTCTGGCTAT....................................................................211.000.00-----------------------------1.00------------------------------------------------------------------
............................................................................................ACACCACATGCTCTGGCTACG...................................................................2111.001.00----------------------------------------------------------------1.00-------------------------------
........ACTGATCTTCAAGAGAAACTGAG.....................................................................................................................................................2311.001.00-------1.00----------------------------------------------------------------------------------------
..................................................GTGAGCTGGGGGATGCTAGTGGGGA.........................................................................................................2511.001.00----------------------------------------------------------------------------------------1.00-------
............................................................................................ACACCACATGCTCTGGCA......................................................................181.000.00---1.00--------------------------------------------------------------------------------------------
.......................................................................GGGAATGTCTTTGGGATG...........................................................................................181.000.00---------------------------------------------------------------------------1.00--------------------
..................................................GTGAGCTGGGGGATGCTAGTGGGA..........................................................................................................241.000.00------------------------------------------------------------1.00-----------------------------------

Antisense strand
TGTTTGGAACTGATCTTCAAGAGAAACTGAGTGACCAACACTACCTCTTGGTGAGCTGGGGGATGCTAGTGGGGAATGTCTTTGGGAAATCCACACCACATGCTCTGGCTAAGACTGTTTCTGTCACCAGGTGGGTGCTGGTGCCATTGGCTGTGAGATGCTCAAAGTCTTTGCCCTAGT
.....................................................(((..(((.(((...(((.(((...((.....))..))).)))..))).)))..)))......................................................................
..................................................51.................................................................118............................................................
SizePerfect hitTotal NormPerfect NormSRR346421(SRX098263)
Global profiling of miRNA and the hairpin pre. (mixture)		SRR042471(GSM539863)
mouse TFHS cells [09-002]. (spleen)		SRR042458(GSM539850)
mouse basophil cells [09-002]. (b cell)		SRR345200(SRX097261)
source: size fractionated RNA from mouse hipp. (brain)		SRR391848(GSM852143)
gender: femalegenotype/variation: wild typeti. (embryo)		SRR042457(GSM539849)
mouse mast cells [09-002]. (bone marrow)		SRR042473(GSM539865)
mouse nTreg cells [09-002]. (lymph)		SRR073955(GSM629281)
total RNA. (blood)		mjLiverKO1()
Liver Data. (Zcchc11 liver)		SRR059769(GSM562831)
Treg_Drosha. (spleen)		SRR037905(GSM510441)
brain_rep2. (brain)		GSM510444(GSM510444)
brain_rep5. (brain)		SRR042469(GSM539861)
mouse Th2 cells [09-002]. (lymph)		mjTestesWT3()
Testes Data. (testes)		SRR042459(GSM539851)
mouse neutrophil cells replicate 1 [09-002]. (blood)		SRR042447(GSM539839)
mouse mature B cells (spleen) replicate 2 [09-002]. (b cell)		SRR042488(GSM539880)
mouse BclXL germinal center B cells [BalbC] [09-002]. (B cell)		SRR039153(GSM471930)
HL1_siSrf1_smallRNAseq. (muscle)		SRR040489(GSM533912)
E18.5 Ago2 catalytically inactive LIVER small RNA. (ago2 liver)		SRR059767(GSM562829)
DN3_Dicer. (thymus)		SRR042487(GSM539879)
mouse BclXL B activated with LPS/IL4 [BalbC] [09-002]. (spleen)		SRR042465(GSM539857)
mouse CD4+ T cells (spleen) [09-002]. (spleen)		SRR042468(GSM539860)
mouse Th1 cells [09-002]. (lymph)		SRR391851(GSM852146)
gender: femalegenotype/variation: wild typeti. (embryo)		SRR042448(GSM539840)
mouse B cells activated in vitro with LPS/IL4 replicate 1 [09-002]. (b cell)		SRR346413(SRX098254)
Global profiling of miRNA and the hairpin pre. (Heart)		SRR248526(GSM733814)
cell type: Thy1- spermatogonial stem cellstra. (testes)		SRR042451(GSM539843)
mouse B cells activated in vitro with LPS/aIgD-Dextran [09-002]. (b cell)		mjLiverWT3()
Liver Data. (liver)		SRR059770(GSM562832)
Treg_Dicer. (spleen)		SRR525244(SRA056111/SRX170320)
Mus musculus domesticus miRNA sequencing. (ago2 Blood)		SRR306541(GSM750584)
19-24nt. (ago2 brain)		SRR042452(GSM539844)
mouse B1 B cells [09-002]. (b cell)		SRR042449(GSM539841)
mouse B cells activated in vitro with LPS/IL4 replicate 2 [09-002]. (b cell)		SRR042453(GSM539845)
mouse marginal zone B cells (spleen) [09-002]. (b cell)		SRR391853(GSM852148)
gender: femalegenotype/variation: ADAR2-/-/AD. (embryo)		GSM640579(GSM640579)
small RNA in the liver with paternal Low pro. (liver)		SRR346414(SRX098255)
Global profiling of miRNA and the hairpin pre. (Spleen)		SRR248527(GSM733815)
cell type: spermatogonial stem cell enriched . (testes)		SRR042466(GSM539858)
mouse CD8+ T cells (spleen) [09-002]. (spleen)		SRR391852(GSM852147)
gender: femalegenotype/variation: ADAR2-/-tis. (embryo)		SRR039154(GSM471931)
HL1_siSrf2_smallRNAseq. (muscle)		SRR039152(GSM471929)
HL1_siNon_smallRNAseq. (muscle)		SRR391850(GSM852145)
gender: femalegenotype/variation: ADAR2-/-/AD. (embryo)		SRR037925(GSM510463)
e9p5_rep3. (embryo)		SRR042450(GSM539842)
mouse B cells activated in vitro with LPS/IL4 replicate 3 [09-002]. (b cell)		GSM640581(GSM640581)
small RNA in the liver with paternal control. (liver)		SRR059766(GSM562828)
DN3_Drosha. (thymus)		SRR346419(SRX098260)
Global profiling of miRNA and the hairpin pre. (Lung)		SRR042484(GSM539876)
mouse salivary gland tissue [09-002]. (gland)		SRR042460(GSM539852)
mouse neutrophil cells replicate 2 [09-002]. (blood)		SRR039184(GSM485324)
shLuc.1309 (+dox). (fibroblast)		SRR345197(SRX097258)
source: size fractionated RNA from mouse hipp. (brain)		SRR042470(GSM539862)
mouse Th17 cells [09-002]. (lymph)		SRR391846(GSM852141)
gender: femalegenotype/variation: ADAR2-/-tis. (embryo)		SRR037904(GSM510440)
brain_rep1. (brain)		SRR042467(GSM539859)
mouse T cells activated in vitro with Concanavalin A [09-002]. (spleen)		SRR306539(GSM750582)
19-24nt. (ago2 brain)		SRR042478(GSM539870)
mouse lung tissue [09-002]. (lung)		SRR042486(GSM539878)
mouse ovaries [09-002]. (ovary)		SRR037929(GSM510467)
e7p5_rep3. (embryo)		SRR037928(GSM510466)
e7p5_rep2. (embryo)		SRR037923(GSM510461)
e9p5_rep1. (embryo)		SRR391849(GSM852144)
gender: femalegenotype/variation: ADAR2-/-tis. (embryo)		SRR042480(GSM539872)
mouse kidney tissue [09-002]. (kidney)		SRR346417(SRX098258)
Global profiling of miRNA and the hairpin pre. (Brain)		SRR069809(GSM610965)
small RNA sequencing; sample 1. (testes)		SRR042462(GSM539854)
mouse macrophages [09-002]. (bone marrow)		SRR525243(SRA056111/SRX170319)
Mus musculus domesticus miRNA sequencing. (ago2 Blood)		Ago3IP805(Rui)
Quantitative functions of Argonaute proteins . (ago3 skin)		SRR525240(SRA056111/SRX170316)
Mus musculus domesticus miRNA sequencing. (ago1 Blood)		SRR345205(SRX097266)
source: size fractionated RNA from mouse hipp. (brain)		SRR037901(GSM510437)
testes_rep2. (testes)		GSM640580(GSM640580)
small RNA in the liver with paternal Low pro. (liver)		SRR346418(SRX098259)
Global profiling of miRNA and the hairpin pre. (Liver)		SRR279904(GSM689054)
cell type: mouse embryonic stem cellcell line. (ESC)		SRR525241(SRA056111/SRX170317)
Mus musculus domesticus miRNA sequencing. (ago1 Blood)		SRR040488(GSM533911)
E18.5 wild type LIVER small RNA. (liver)		SRR065058(SRR065058)
Tissue-specific Regulation of Mouse MicroRNA . (pancreas)		GSM475281(GSM475281)
total RNA. (testes)		SRR042463(GSM539855)
mouse natural killer cells [09-002]. (spleen)		SRR037936(GSM510474)
293cand1. (cell line)		GSM510454(GSM510454)
newborn_rep10. (total RNA)		SRR042446(GSM539838)
mouse mature B cells (spleen) replicate 1 [09-002]. (b cell)		SRR553585(SRX182791)
source: Kidney. (Kidney)		SRR032476(GSM485234)
sRNA_delayed_deep_sequencing. (uterus)		SRR042475(GSM539867)
mouse embryonic fibroblast cells [09-002]. (fibroblast)		GSM475279(GSM475279)
Miwi-IP. (miwi testes)		SRR039185(GSM485325)
shLuc.1309;ROSA-rtTA (-dox). (fibroblast)		SRR059765(GSM562827)
DN3_control. (thymus)		GSM510456(GSM510456)
newborn_rep12. (total RNA)		SRR077864(GSM637801)
18-30 nt small RNAs. (liver)		SRR039610(GSM527274)
small RNA-Seq. (brain)		SRR042461(GSM539853)
mouse dendritic cells [09-002]. (bone marrow)		SRR077866(GSM637803)
18-30 nt small RNAs. (liver)		SRR037924(GSM510462)
e9p5_rep2. (embryo)
.......AACTGATCTTCAAGAGGC........................................................................................................................................................... 188.000.00-----------------4.00-----------------------2.002.00-----------------------------------------------------
..................................................................................................................................GTGGGTGCTGGTGCCAGG................................ 181.000.00------------------------------------------------------1.00-----------------------------------------
.............................................TCTTGGTGAGCTGGGGGAACAG................................................................................................................. 221.000.00-------------------------------------------------------------1.00----------------------------------
.............................................................................GTCTTTGGGAAATCCACACCAC................................................................................. 2211.001.00-----------------------------------1.00------------------------------------------------------------
.....................................ACACTACCTCTTGGTGAGCT........................................................................................................................... 2011.001.00---------------------------------------------------1.00--------------------------------------------