| (5) AGO2.ip | (1) AGO3.ip | (7) B-CELL | (11) BRAIN | (1) DGCR8.mut | (6) EMBRYO | (5) ESC | (1) FIBROBLAST | (1) KIDNEY | (1) LIVER | (3) LYMPH | (14) OTHER | (1) OTHER.mut | (1) PIWI.ip | (1) SKIN | (4) SPLEEN | (5) TESTES | (3) TOTAL-RNA |
| GATAGGGATATGTATGGGGAAGCCTTACTAAATTGTACCCACAGGGAAAGTCTGGCTACACTGCCTTGGCAAGCTGAAACTTTGACCTTGATTTGTTCTTAGGCGTTTGATTCCCTCCCCTACATCTAGGATAATACGGTTTTATCATGGAAGTGAGGACAGGGAGAATGTAACTAACTCTGCACTCCTCTCTCCCACAGGGGGATTTCAGAGTGCCTGCCCCGACTAACCTGCATGATCAGAGGGATCG ........................................................................................................................................................(((.(((.((((((..((((........)))))))).)).)))))).................................................... ............................................................................................................................................141........................................................200................................................ | Size | Perfect hit | Total Norm | Perfect Norm | SRR042458(GSM539850) mouse basophil cells [09-002]. (b cell) | SRR546155(SRX180174) Global profiling of miRNA and the hairpin pre. (ago2 Neuroblastoma) | SRR206942(GSM723283) other. (brain) | SRR279907(GSM689057) cell type: mouse embryonic stem cellcell line. (ESC) | mjTestesWT3() Testes Data. (testes) | SRR038742(GSM527277) small RNA-Seq. (dgcr8 brain) | SRR306537(GSM750580) 19-24nt. (ago2 brain) | SRR553583(SRX182789) source: Cerebellum. (Cerebellum) | SRR391852(GSM852147) gender: femalegenotype/variation: ADAR2-/-tis. (embryo) | SRR042447(GSM539839) mouse mature B cells (spleen) replicate 2 [09-002]. (b cell) | SRR042454(GSM539846) mouse germinal center B cells (lymph node) [09-002]. (b cell) | SRR346424(SRX098266) Global profiling of miRNA and the hairpin pre. (Neuroblastoma) | SRR042449(GSM539841) mouse B cells activated in vitro with LPS/IL4 replicate 2 [09-002]. (b cell) | Ago3IP812(Rui) Quantitative functions of Argonaute proteins . (ago3 skin) | SRR059769(GSM562831) Treg_Drosha. (spleen) | SRR279904(GSM689054) cell type: mouse embryonic stem cellcell line. (ESC) | SRR042472(GSM539864) mouse iTreg cells [09-002]. (lymph) | SRR073954(GSM629280) total RNA. (blood) | SRR346416(SRX098257) Global profiling of miRNA and the hairpin pre. (Kidney) | GSM509280(GSM509280) small RNA cloning by length. (testes) | SRR039154(GSM471931) HL1_siSrf2_smallRNAseq. (muscle) | SRR391846(GSM852141) gender: femalegenotype/variation: ADAR2-/-tis. (embryo) | GSM510452(GSM510452) newborn_rep8. (total RNA) | SRR042452(GSM539844) mouse B1 B cells [09-002]. (b cell) | SRR391848(GSM852143) gender: femalegenotype/variation: wild typeti. (embryo) | SRR042444(GSM539836) mouse pre B cells [09-002]. (b cell) | SRR042463(GSM539855) mouse natural killer cells [09-002]. (spleen) | SRR042465(GSM539857) mouse CD4+ T cells (spleen) [09-002]. (spleen) | SRR553602(SRX182808) source: Sertoli cells. (Sertoli cells) | SRR306527(GSM750570) 19-24nt. (ago2 brain) | SRR073955(GSM629281) total RNA. (blood) | SRR042450(GSM539842) mouse B cells activated in vitro with LPS/IL4 replicate 3 [09-002]. (b cell) | SRR042469(GSM539861) mouse Th2 cells [09-002]. (lymph) | GSM510455(GSM510455) newborn_rep11. (total RNA) | SRR345201(SRX097262) source: size fractionated RNA from mouse hipp. (brain) | SRR391853(GSM852148) gender: femalegenotype/variation: ADAR2-/-/AD. (embryo) | SRR391849(GSM852144) gender: femalegenotype/variation: ADAR2-/-tis. (embryo) | SRR034118(GSM466728) Mili IP_Tdrd9+/- replicate1. (mili testes) | SRR029036(GSM433288) 18dpp_hetero_tdrd6-KO. (tdrd6 testes) | SRR345198(SRX097259) source: size fractionated RNA from mouse hipp. (brain) | SRR037912(GSM510449) newborn_rep5. (total RNA) | SRR042471(GSM539863) mouse TFHS cells [09-002]. (spleen) | SRR042468(GSM539860) mouse Th1 cells [09-002]. (lymph) | SRR391851(GSM852146) gender: femalegenotype/variation: wild typeti. (embryo) | SRR206940(GSM723281) other. (brain) | SRR042462(GSM539854) mouse macrophages [09-002]. (bone marrow) | SRR042475(GSM539867) mouse embryonic fibroblast cells [09-002]. (fibroblast) | SRR346421(SRX098263) Global profiling of miRNA and the hairpin pre. (mixture) | SRR306531(GSM750574) 19-24nt. (ago2 brain) | SRR345205(SRX097266) source: size fractionated RNA from mouse hipp. (brain) | SRR116846(GSM678422) Small RNA deep sequencing from mouse epididym. (epididymis) | SRR042456(GSM539848) mouse hematopoetic progenitor cells [09-002]. (bone marrow) | GSM314557(GSM314557) ESC dgcr8 (Illumina). (ESC) | SRR042461(GSM539853) mouse dendritic cells [09-002]. (bone marrow) | GSM314552(GSM314552) ESC wild type (Illumina). (ESC) | SRR065056(SRR065056) Tissue-specific Regulation of Mouse MicroRNA . (jejunum) | SRR248526(GSM733814) cell type: Thy1- spermatogonial stem cellstra. (testes) | SRR042459(GSM539851) mouse neutrophil cells replicate 1 [09-002]. (blood) | GSM640581(GSM640581) small RNA in the liver with paternal control. (liver) | SRR306541(GSM750584) 19-24nt. (ago2 brain) | SRR039610(GSM527274) small RNA-Seq. (brain) | SRR402760(SRX117943) source: ES E14 male cells. (ESC) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| .................................................................................................................................................CATGGAAGTGAGGACAGGGAG.................................................................................... | 21 | 1 | 21.00 | 21.00 | - | 2.00 | - | 1.00 | 3.00 | - | 3.00 | 1.00 | 1.00 | - | - | 1.00 | 1.00 | - | 2.00 | - | - | - | - | - | - | - | - | - | 1.00 | 1.00 | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | 1.00 | - | - | - | - | - |
| ................................................................................................................................................TCATGGAAGTGAGGACAGGGAG.................................................................................... | 22 | 1 | 6.00 | 6.00 | 1.00 | 1.00 | - | - | - | - | - | 2.00 | - | - | - | - | - | - | - | 1.00 | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..................................................................................................................................................ATGGAAGTGAGGACAGGGAG.................................................................................... | 20 | 1 | 5.00 | 5.00 | - | 1.00 | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | 1.00 | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...............................................................................................................................................ATCATGGAAGTGAGGACAGGGAG.................................................................................... | 23 | 1 | 4.00 | 4.00 | - | - | - | 3.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .................................................................................................................................................CATGGAAGTGAGGACAGGG...................................................................................... | 19 | 1 | 3.00 | 3.00 | - | - | - | - | - | - | - | - | - | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - |
| .................................................................................................................................................CATGGAAGTGAGGACAGG....................................................................................... | 18 | 1 | 3.00 | 3.00 | 1.00 | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ................................................................................................................................................TCATGGAAGTGAGGACAGGGAGAATA................................................................................ | 26 | 3.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .................................................................................................................................................CATGGAAGTGAGGACAGGGA..................................................................................... | 20 | 1 | 3.00 | 3.00 | 2.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..................................................................................................................................................................................TCTGCACTCCTCTCTCCCACAG.................................................. | 22 | 1 | 2.00 | 2.00 | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..................................................................................................................................................ATGGAAGTGAGGACAGGGAGT................................................................................... | 21 | 1 | 2.00 | 5.00 | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..................................................................................................................................................................................TCTGCACTCCTCTCTCCCACAGT................................................. | 23 | 1 | 2.00 | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - |
| .................................................................................................................................................CATGGAAGTGAGGACAGGGAA.................................................................................... | 21 | 1 | 1.00 | 3.00 | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..................................................................TGGCAAGCTGAAACTTAAAG.................................................................................................................................................................... | 20 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..............................................................................................................TTCCCTCCCCTACATCTAGGATAATACGGTTTTATCATGGAAGTGAGGACAGGGAGAATGTAACTAACTCTGCACTCCTCTCTCCCACAGAG................................................ | 92 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .........................................................................................................................................................................GTAACTAACTCTGCACTCCTC............................................................ | 21 | 1 | 1.00 | 1.00 | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...............................................................................................................................................................................................................................GACTAACCTGCATGATCAGAGGGATCG | 27 | 1 | 1.00 | 1.00 | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .................................................................................................................................................CATGGAAGTGAGGACAGGGATA................................................................................... | 22 | 1 | 1.00 | 3.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..................................................................................................................................................ATGGAAGTGAGGACAGGGAGA................................................................................... | 21 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..............................................................................................................................................................................................................TTCAGAGTGCCTGCCCCGACTAACCT.................. | 26 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - |
| ....................................................................................................................................................GGAAGTGAGGACAGGGAGAA.................................................................................. | 20 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..................................................................................................................................................ATGGAAGTGAGGACAGGGCT.................................................................................... | 20 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .......................................................CTACACTGCCTTGGCAAGCT............................................................................................................................................................................... | 20 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...............................................................................................................................................ATCATGGAAGTGAGGACAGG....................................................................................... | 20 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...................................................................................................................................................................................................CACAGGGGGATTTCAGAGTGCCT................................ | 23 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..................................................................................................................................................ATGGAAGTGAGGACAGGGAGTAA................................................................................. | 23 | 1 | 1.00 | 5.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - |
| ..................................................................................................................................................................................TCTGCACTCCTCTCTCCCACAGA................................................. | 23 | 1 | 1.00 | 2.00 | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ....................................................................................................................................................................................TGCACTCCTCTCTCCCACAGT................................................. | 21 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ................................................................................................................................................TCATGGAAGTGAGGACAGGGA..................................................................................... | 21 | 1 | 1.00 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ........................................................................................................................................................................................................GGGGATTTCAGAGTGTT................................. | 17 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ................................................................................................................................................TCATGGAAGTGAGGACAGGGAGT................................................................................... | 23 | 1 | 1.00 | 6.00 | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .................................................................................................................................................CATGGAAGTGAGGACAGGGAAT................................................................................... | 22 | 1 | 1.00 | 3.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ....................................ACCCACAGGGAAAGTCTGGCT................................................................................................................................................................................................. | 21 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .......................................................................................................................................................................................................................................TGCATGATCAGAGGGATAAC | 20 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..............................................................................................................................................................................................................................CGACTAACCTGCATGATCAG........ | 20 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .....................................................................................................................................................................................................................................CCTGCATGATCAGAGGGATC. | 20 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .........................................................................................GATTTGTTCTTAGGCGTTT.............................................................................................................................................. | 19 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..................................................................................................................................................................................................................................TAACCTGCATGATCAGAGGGA... | 21 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ........................................................................................................................................................................................................................................GCATGATCAGAGGGATCGTA | 20 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ......................................................................AAGCTGAAACTTTGAGTGT................................................................................................................................................................. | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | |
| ..................................................................................................................................................ATGGAAGTGAGGACAGGTCT.................................................................................... | 20 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .................................................................................................................................................CATGGAAGTGAGGACAGGGAGA................................................................................... | 22 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - |
| ..................................................................................................................................................ATGGAAGTGAGGACAGGGAGC................................................................................... | 21 | 1 | 1.00 | 5.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .................................................................................................................................................CATGGAAGTGAGGACAGGGAGT................................................................................... | 22 | 1 | 1.00 | 21.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .......................................................................................................................................................................................................................................TGCATGATCAGAGGGATTA | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ................................................................................................................................................TCATGGAAGTGAGGACA......................................................................................... | 17 | 2 | 0.50 | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.50 | - | - | - |
| ...........................................................................................................................................................AGGACAGGGAGAATGTA.............................................................................. | 17 | 3 | 0.33 | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.33 | - | - |
| ..........................................................................................................................................................GAGGACAGGGAGAATGT............................................................................... | 17 | 4 | 0.25 | 0.25 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.25 | - |
| GATAGGGATATGTATGGGGAAGCCTTACTAAATTGTACCCACAGGGAAAGTCTGGCTACACTGCCTTGGCAAGCTGAAACTTTGACCTTGATTTGTTCTTAGGCGTTTGATTCCCTCCCCTACATCTAGGATAATACGGTTTTATCATGGAAGTGAGGACAGGGAGAATGTAACTAACTCTGCACTCCTCTCTCCCACAGGGGGATTTCAGAGTGCCTGCCCCGACTAACCTGCATGATCAGAGGGATCG ........................................................................................................................................................(((.(((.((((((..((((........)))))))).)).)))))).................................................... ............................................................................................................................................141........................................................200................................................ | Size | Perfect hit | Total Norm | Perfect Norm | SRR042458(GSM539850) mouse basophil cells [09-002]. (b cell) | SRR546155(SRX180174) Global profiling of miRNA and the hairpin pre. (ago2 Neuroblastoma) | SRR206942(GSM723283) other. (brain) | SRR279907(GSM689057) cell type: mouse embryonic stem cellcell line. (ESC) | mjTestesWT3() Testes Data. (testes) | SRR038742(GSM527277) small RNA-Seq. (dgcr8 brain) | SRR306537(GSM750580) 19-24nt. (ago2 brain) | SRR553583(SRX182789) source: Cerebellum. (Cerebellum) | SRR391852(GSM852147) gender: femalegenotype/variation: ADAR2-/-tis. (embryo) | SRR042447(GSM539839) mouse mature B cells (spleen) replicate 2 [09-002]. (b cell) | SRR042454(GSM539846) mouse germinal center B cells (lymph node) [09-002]. (b cell) | SRR346424(SRX098266) Global profiling of miRNA and the hairpin pre. (Neuroblastoma) | SRR042449(GSM539841) mouse B cells activated in vitro with LPS/IL4 replicate 2 [09-002]. (b cell) | Ago3IP812(Rui) Quantitative functions of Argonaute proteins . (ago3 skin) | SRR059769(GSM562831) Treg_Drosha. (spleen) | SRR279904(GSM689054) cell type: mouse embryonic stem cellcell line. (ESC) | SRR042472(GSM539864) mouse iTreg cells [09-002]. (lymph) | SRR073954(GSM629280) total RNA. (blood) | SRR346416(SRX098257) Global profiling of miRNA and the hairpin pre. (Kidney) | GSM509280(GSM509280) small RNA cloning by length. (testes) | SRR039154(GSM471931) HL1_siSrf2_smallRNAseq. (muscle) | SRR391846(GSM852141) gender: femalegenotype/variation: ADAR2-/-tis. (embryo) | GSM510452(GSM510452) newborn_rep8. (total RNA) | SRR042452(GSM539844) mouse B1 B cells [09-002]. (b cell) | SRR391848(GSM852143) gender: femalegenotype/variation: wild typeti. (embryo) | SRR042444(GSM539836) mouse pre B cells [09-002]. (b cell) | SRR042463(GSM539855) mouse natural killer cells [09-002]. (spleen) | SRR042465(GSM539857) mouse CD4+ T cells (spleen) [09-002]. (spleen) | SRR553602(SRX182808) source: Sertoli cells. (Sertoli cells) | SRR306527(GSM750570) 19-24nt. (ago2 brain) | SRR073955(GSM629281) total RNA. (blood) | SRR042450(GSM539842) mouse B cells activated in vitro with LPS/IL4 replicate 3 [09-002]. (b cell) | SRR042469(GSM539861) mouse Th2 cells [09-002]. (lymph) | GSM510455(GSM510455) newborn_rep11. (total RNA) | SRR345201(SRX097262) source: size fractionated RNA from mouse hipp. (brain) | SRR391853(GSM852148) gender: femalegenotype/variation: ADAR2-/-/AD. (embryo) | SRR391849(GSM852144) gender: femalegenotype/variation: ADAR2-/-tis. (embryo) | SRR034118(GSM466728) Mili IP_Tdrd9+/- replicate1. (mili testes) | SRR029036(GSM433288) 18dpp_hetero_tdrd6-KO. (tdrd6 testes) | SRR345198(SRX097259) source: size fractionated RNA from mouse hipp. (brain) | SRR037912(GSM510449) newborn_rep5. (total RNA) | SRR042471(GSM539863) mouse TFHS cells [09-002]. (spleen) | SRR042468(GSM539860) mouse Th1 cells [09-002]. (lymph) | SRR391851(GSM852146) gender: femalegenotype/variation: wild typeti. (embryo) | SRR206940(GSM723281) other. (brain) | SRR042462(GSM539854) mouse macrophages [09-002]. (bone marrow) | SRR042475(GSM539867) mouse embryonic fibroblast cells [09-002]. (fibroblast) | SRR346421(SRX098263) Global profiling of miRNA and the hairpin pre. (mixture) | SRR306531(GSM750574) 19-24nt. (ago2 brain) | SRR345205(SRX097266) source: size fractionated RNA from mouse hipp. (brain) | SRR116846(GSM678422) Small RNA deep sequencing from mouse epididym. (epididymis) | SRR042456(GSM539848) mouse hematopoetic progenitor cells [09-002]. (bone marrow) | GSM314557(GSM314557) ESC dgcr8 (Illumina). (ESC) | SRR042461(GSM539853) mouse dendritic cells [09-002]. (bone marrow) | GSM314552(GSM314552) ESC wild type (Illumina). (ESC) | SRR065056(SRR065056) Tissue-specific Regulation of Mouse MicroRNA . (jejunum) | SRR248526(GSM733814) cell type: Thy1- spermatogonial stem cellstra. (testes) | SRR042459(GSM539851) mouse neutrophil cells replicate 1 [09-002]. (blood) | GSM640581(GSM640581) small RNA in the liver with paternal control. (liver) | SRR306541(GSM750584) 19-24nt. (ago2 brain) | SRR039610(GSM527274) small RNA-Seq. (brain) | SRR402760(SRX117943) source: ES E14 male cells. (ESC) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ........................................................................................................................................................................................................................CTGCCCCGACTAACCTGA................ | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ......................................................................................................................................................................................CACTCCTCTCTCCCAGTCT................................................. | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..........................................................................................................................................................................................................................GCCCCGACTAACC................... | 13 | 8 | 0.12 | 0.12 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.12 |