ID: uc009cly.6
GENE: Aup1(7)
chr6:83006379-83006585+


(1)
AGO.mut 		(2)
AGO1.ip 		(12)
AGO2.ip 		(2)
AGO3.ip 		(9)
B-CELL 		(19)
BRAIN 		(2)
CELL-LINE 		(1)
DGCR8.mut 		(10)
EMBRYO 		(9)
ESC 		(5)
FIBROBLAST 		(1)
KIDNEY 		(4)
LIVER 		(1)
LYMPH 		(12)
OTHER 		(8)
OTHER.mut 		(4)
PIWI.ip 		(1)
PIWI.mut 		(5)
SKIN 		(7)
SPLEEN 		(15)
TESTES 		(2)
THYMUS

Sense strand
GTCGACAGCTAGGGGAAGAGAGTGAGGAGTTTGCGCTCCGTGTACAACAGGTGGTAGTGAACAGGGGTGTGGTGGAAGTGGGGGGGTCCCTCCCTCCTGGGGAGAAGGGGAAGAAGACCTGACGAGGCTACAGCTATAACCTTCCAATTCTCCCTAGCTGGTGGCCAAAGAATTGGGCCAGATAGGGACACGGCTCACTCCAGCAGA
................................................................................................((((((((((..(((((.((.(((....)))))...........)))))..))))))))))..................................................
............................................................................................93..............................................................157................................................
SizePerfect hitTotal NormPerfect NormSRR546155(SRX180174)
Global profiling of miRNA and the hairpin pre. (ago2 Neuroblastoma)		SRR391851(GSM852146)
gender: femalegenotype/variation: wild typeti. (embryo)		SRR391846(GSM852141)
gender: femalegenotype/variation: ADAR2-/-tis. (embryo)		SRR391853(GSM852148)
gender: femalegenotype/variation: ADAR2-/-/AD. (embryo)		SRR279904(GSM689054)
cell type: mouse embryonic stem cellcell line. (ESC)		SRR685339(GSM1079783)
"Small RNAs (15-50 nts in length) from immort. (cell line)		mjTestesKO7()
Testes Data. (Zcchc11 testes)		SRR038742(GSM527277)
small RNA-Seq. (dgcr8 brain)		SRR390299(GSM849857)
cell line: NIH-3T3cell type: fibroblastip ant. (ago2 fibroblast)		SRR040489(GSM533912)
E18.5 Ago2 catalytically inactive LIVER small RNA. (ago2 liver)		SRR059769(GSM562831)
Treg_Drosha. (spleen)		SRR391845(GSM852140)
gender: femalegenotype/variation: wild typeti. (embryo)		SRR390297(GSM849855)
cell line: NIH-3T3cell type: fibroblastip ant. (fibroblast)		SRR391852(GSM852147)
gender: femalegenotype/variation: ADAR2-/-tis. (embryo)		SRR346418(SRX098259)
Global profiling of miRNA and the hairpin pre. (Liver)		SRR073954(GSM629280)
total RNA. (blood)		SRR039185(GSM485325)
shLuc.1309;ROSA-rtTA (-dox). (fibroblast)		SRR042454(GSM539846)
mouse germinal center B cells (lymph node) [09-002]. (b cell)		SRR391848(GSM852143)
gender: femalegenotype/variation: wild typeti. (embryo)		SRR306537(GSM750580)
19-24nt. (ago2 brain)		SRR346424(SRX098266)
Global profiling of miRNA and the hairpin pre. (Neuroblastoma)		mjLiverWT2()
Liver Data. (liver)		SRR391850(GSM852145)
gender: femalegenotype/variation: ADAR2-/-/AD. (embryo)		SRR306541(GSM750584)
19-24nt. (ago2 brain)		SRR345199(SRX097260)
source: size fractionated RNA from mouse hipp. (brain)		Ago1IP517(Rui)
Quantitative functions of Argonaute proteins . (ago1 skin)		SRR553602(SRX182808)
source: Sertoli cells. (Sertoli cells)		SRR042449(GSM539841)
mouse B cells activated in vitro with LPS/IL4 replicate 2 [09-002]. (b cell)		SRR028732(GSM400969)
Mili-Tdrd1 KO associated. (mili testes)		SRR391849(GSM852144)
gender: femalegenotype/variation: ADAR2-/-tis. (embryo)		SRR034118(GSM466728)
Mili IP_Tdrd9+/- replicate1. (mili testes)		SRR402762(SRX117945)
source: ES E14 male cells. (ESC)		SRR042468(GSM539860)
mouse Th1 cells [09-002]. (lymph)		SRR279903(GSM689053)
cell type: mouse embryonic stem cellcell line. (ESC)		SRR346417(SRX098258)
Global profiling of miRNA and the hairpin pre. (Brain)		SRR038744(GSM527279)
small RNA-Seq. (brain)		SRR116846(GSM678422)
Small RNA deep sequencing from mouse epididym. (epididymis)		SRR029123(GSM416611)
NIH3T3. (cell line)		SRR306533(GSM750576)
19-24nt. (ago2 brain)		SRR402760(SRX117943)
source: ES E14 male cells. (ESC)		SRR306542(GSM750585)
19-24nt. (ago2 brain)		Ago2IP504(Rui)
Quantitative functions of Argonaute proteins . (ago2 skin)		SRR029036(GSM433288)
18dpp_hetero_tdrd6-KO. (tdrd6 testes)		SRR034119(GSM466729)
Mili IP_Tdrd9+/- replicate2. (mili testes)		SRR059766(GSM562828)
DN3_Drosha. (thymus)		SRR059771(GSM562833)
CD4_control. (spleen)		GSM314557(GSM314557)
ESC dgcr8 (Illumina). (ESC)		SRR059770(GSM562832)
Treg_Dicer. (spleen)		SRR029037(GSM433289)
18dpp_homo_tdrd6-KO. (tdrd6 testes)		SRR042455(GSM539847)
mouse plasma cells [09-002]. (blood)		SRR345196(SRX097257)
source: size fractionated RNA from mouse hipp. (brain)		SRR391847(GSM852142)
gender: femalegenotype/variation: ADAR2-/-/AD. (embryo)		SRR345197(SRX097258)
source: size fractionated RNA from mouse hipp. (brain)		Ago1IP812(Rui)
Quantitative functions of Argonaute proteins . (ago1 skin)		SRR042487(GSM539879)
mouse BclXL B activated with LPS/IL4 [BalbC] [09-002]. (spleen)		SRR042452(GSM539844)
mouse B1 B cells [09-002]. (b cell)		SRR029041(GSM433293)
6w_homo_tdrd6-KO. (tdrd6 testes)		SRR402766(SRX117949)
source: ES PGK female cells. (ESC)		SRR345198(SRX097259)
source: size fractionated RNA from mouse hipp. (brain)		SRR042471(GSM539863)
mouse TFHS cells [09-002]. (spleen)		mjTestesKO6()
Testes Data. (Zcchc11 testes)		SRR279906(GSM689056)
cell type: mouse embryonic stem cellcell line. (ESC)		SRR029042(GSM433294)
18.5dpc_hetero_tdrd1-KO. (tdrd1 testes)		SRR029038(GSM433290)
25dpp_hetero_tdrd6-KO. (tdrd6 testes)		SRR034120(GSM466730)
Mili IP_Tdrd9-/- replicate1. (mili testes)		mjTestesKO8()
Testes Data. (Zcchc11 testes)		SRR042458(GSM539850)
mouse basophil cells [09-002]. (b cell)		Ago3IP805(Rui)
Quantitative functions of Argonaute proteins . (ago3 skin)		SRR402761(SRX117944)
source: ES E14 male cells. (ESC)		SRR279907(GSM689057)
cell type: mouse embryonic stem cellcell line. (ESC)		SRR306536(GSM750579)
19-24nt. (ago2 brain)		SRR553604(SRX182810)
source: Spermatocytes. (Spermatocytes)		SRR248526(GSM733814)
cell type: Thy1- spermatogonial stem cellstra. (testes)		SRR042459(GSM539851)
mouse neutrophil cells replicate 1 [09-002]. (blood)		SRR014232(GSM319956)
16.5 dpc MILI. (mili testes)		SRR042447(GSM539839)
mouse mature B cells (spleen) replicate 2 [09-002]. (b cell)		SRR040488(GSM533911)
E18.5 wild type LIVER small RNA. (liver)		SRR042488(GSM539880)
mouse BclXL germinal center B cells [BalbC] [09-002]. (B cell)		SRR346416(SRX098257)
Global profiling of miRNA and the hairpin pre. (Kidney)		SRR206942(GSM723283)
other. (brain)		SRR039186(GSM485326)
shLuc.1309;ROSA-rtTA (+dox). (fibroblast)		SRR039154(GSM471931)
HL1_siSrf2_smallRNAseq. (muscle)		SRR042451(GSM539843)
mouse B cells activated in vitro with LPS/aIgD-Dextran [09-002]. (b cell)		SRR059772(GSM562834)
CD4_Drosha. (spleen)		SRR306534(GSM750577)
19-24nt. (ago2 brain)		SRR042463(GSM539855)
mouse natural killer cells [09-002]. (spleen)		SRR306527(GSM750570)
19-24nt. (ago2 brain)		SRR042450(GSM539842)
mouse B cells activated in vitro with LPS/IL4 replicate 3 [09-002]. (b cell)		SRR039153(GSM471930)
HL1_siSrf1_smallRNAseq. (muscle)		SRR345201(SRX097262)
source: size fractionated RNA from mouse hipp. (brain)		SRR248525(GSM733813)
cell type: Thy1- spermatogonial stem cellstra. (testes)		SRR206941(GSM723282)
other. (brain)		SRR346422(SRX098264)
Global profiling of miRNA and the hairpin pre. (Muscle)		Ago3IP812(Rui)
Quantitative functions of Argonaute proteins . (ago3 skin)		SRR042475(GSM539867)
mouse embryonic fibroblast cells [09-002]. (fibroblast)		SRR306531(GSM750574)
19-24nt. (ago2 brain)		SRR042445(GSM539837)
mouse immature B cells [09-002]. (b cell)		SRR059765(GSM562827)
DN3_control. (thymus)		SRR042484(GSM539876)
mouse salivary gland tissue [09-002]. (gland)		SRR306535(GSM750578)
19-24nt. (ago2 brain)		SRR037924(GSM510462)
e9p5_rep2. (embryo)
........................................................................................................................................TAACCTTCCAATTCTCCCTAGT.................................................22151.004.009.002.00-1.002.001.00-3.00-1.00-----1.001.00-2.003.00---2.00-2.001.00----1.00---1.001.00-2.00-2.00-1.00-----1.00------1.001.00--1.00---1.00---1.00--1.00--------1.00------1.00------1.00-1.001.00----
........................................................................................................................................TAACCTTCCAATTCTCCCTAGA.................................................22120.004.003.00----3.00--5.00---1.00---------------------1.00--2.00---1.00-----------1.00---1.00----------------------------------1.00-------1.00
......................................................................................................................................TATAACCTTCCAATTCTCCCTAGT.................................................24111.001.001.001.00--------1.00--1.00--1.00------------------1.00----------2.00---------------------------------1.00---1.00---------1.00------
.................................................................................................TGGGGAGAAGGGGAAGAAGACCTG......................................................................................24111.0011.00-1.00--2.00----2.003.00---------------------------------1.00-------------------------------1.00--------------------1.00---
.................................................................................................TGGGGAGAAGGGGAAGAAGACC........................................................................................22110.0010.00-2.002.00---------3.001.00-------------------1.00-----------------------------------1.00-------------------------------
.......................................................................................................................................................................................AGGGACACGGCTCACTCCAGC...2116.006.00-2.00-2.00---------1.00---------------1.00-----------------------------------------------------------------------
.......................................................................................................................................................................................AGGGACACGGCTCACTCCAGCA..2215.005.00--3.002.00-------------------------------------------------------------------------------------------------
.................................................................................................TGGGGAGAAGGGGAAGAAGACCT.......................................................................................2314.004.00--------------------1.00------------------------------------------------------1.00-1.00--------------------1.00--
........................................................................................................................................TAACCTTCCAATTCTCCCTAG..................................................2114.004.003.00------1.00---------------------------------------------------------------------------------------------
.........................................................................................................................................................................................GGACACGGCTCACTCCAGCA..2014.004.00------3.00----1.00-----------------------------------------------------------------------------------------
........................................................................................................................................TAACCTTCCAATTCTCCCTAGC.................................................2214.004.00---------------2.00--1.00----------------------1.00-----------------------------------------------------------
..........................................................................................................................................................................AATTGGGCCAGATAGGGACACGGCTT...........2613.001.00---------------------3.00-------------------------------------------------------------------------------
..................................GCTCCGTGTACAACAG.............................................................................................................................................................1613.003.00-----3.00-----------------------------------------------------------------------------------------------
.TCGACAGCTAGGGGAAGAGA..........................................................................................................................................................................................2013.003.00----3.00------------------------------------------------------------------------------------------------
........................................................................................................................................TAACCTTCCAATTCTCCCTAGTA................................................2312.004.001.001.00---------------------------------------------------------------------------------------------------
...............................................................................................CCTGGGGAGAAGGGGAAGAAG...........................................................................................2112.002.00-----------------------------------------------1.00---------------------------------------------------1.00-
...............................................................................................................................................................GGTGGCCAAAGAATTGGGCCAGAT........................2412.002.00----------------------1.00------1.00-----------------------------------------------------------------------
........................................................................................................................................TAACCTTCCAATTCTCCCTAGTT................................................2312.004.00------------------------------------------1.00--------------------------------------1.00-------------------
.......................................................................................................................................................................................AGGGACACGGCTCACTCCA.....1912.002.00--2.00--------------------------------------------------------------------------------------------------
..................................................................................................GGGGAGAAGGGGAAGAAGAC.........................................................................................2012.002.00---------------------------------------------2.00-------------------------------------------------------
.................................CGCTCCGTGTACAACAG.............................................................................................................................................................1712.002.00--------------------1.00----------1.00---------------------------------------------------------------------
................................................................................................CTGGGGAGAAGGGGAAGAAGACC........................................................................................2312.002.00----------------2.00------------------------------------------------------------------------------------
............................................................................................................................................................................TTGGGCCAGATAGGGACACGGCTCACT........2712.002.00---------2.00-------------------------------------------------------------------------------------------
..........................................TACAACAGGTGGTAGTGAACAGGGGT...........................................................................................................................................2612.002.00------------------------------1.00------------1.00---------------------------------------------------------
.......................................................................................................................................................................AAGAATTGGGCCAGATAGGGACACGGC.............2712.002.00----------------------------1.00-----------------------------------1.00------------------------------------
....................................................................................................................................................................................GATAGGGACACGGCTCACTCC......2112.002.00------1.00-------1.00--------------------------------------------------------------------------------------
..............................................................................................TCCTGGGGAGAAGGGGAAGAAG...........................................................................................2212.002.001.00--------------------------1.00-------------------------------------------------------------------------
............................................................................................................................................................................TTGGGCCAGATAGGGACACGGC.............2211.001.00-----------------------------------------------------------------------1.00-----------------------------
..........AGGGGAAGAGAGTGAGGAGTTTG..............................................................................................................................................................................2311.001.00---------------------------1.00-------------------------------------------------------------------------
..........AGGGGAAGAGAGTGAGGAGTT................................................................................................................................................................................2111.001.00---1.00-------------------------------------------------------------------------------------------------
...............................................................................................................................................................................GGCCAGATAGGGACACGGCTCACT........2411.001.00---------------------------------------------------1.00-------------------------------------------------
.......................GAGGAGTTTGCGCTCCGTGT....................................................................................................................................................................2011.001.00----------------------1.00------------------------------------------------------------------------------
......................................................................................................................................TATAACCTTCCAATTCTCCCTAG..................................................2311.001.001.00----------------------------------------------------------------------------------------------------
........................................................................................................................................TAACCTTCCAATTCTCCCTATT.................................................221.000.001.00----------------------------------------------------------------------------------------------------
.........TAGGGGAAGAGAGTGATG....................................................................................................................................................................................181.000.00-----------------------------------------------------------------------------------------1.00-----------
......................................................................................................................................TATAACCTTCCAATTCTCCCT....................................................2111.001.00-------1.00---------------------------------------------------------------------------------------------
..............................................................................................................AAGAAGACCTGACGAAAAT..............................................................................191.000.00--------------------------------------------------1.00--------------------------------------------------
................................................................................................................................................................................GCCAGATAGGGACACGGCT............1911.001.00-------------------------------------------------------------------------------------------1.00---------
....................................................................................................................................................................................GATAGGGACACGGCTCACTCCAG....2311.001.00----------------------------------------------------------------------------------1.00------------------
.........TAGGGGAAGAGAGTGGGTC...................................................................................................................................................................................191.000.00----------------------------------------------------------------------------------------1.00------------
....................................................................GTGGTGGAAGTGGGGGAG.........................................................................................................................181.000.00----------------------------------------------------------1.00------------------------------------------
................................................................................................CTGGGGAGAAGGGGAAGAAGAC.........................................................................................2211.001.00-------------1.00---------------------------------------------------------------------------------------
..........................................................................................................................................................................AATTGGGCCAGATAGGGACACGGCTCAC.........2811.001.00------------------------------------------------------------------------1.00----------------------------
..........................................................................................................................................................................AATTGGGCCAGATAGGGACACGGCT............2511.001.00--------------------------1.00--------------------------------------------------------------------------
.........................................GTACAACAGGTGGTAGTGAACAGGGG............................................................................................................................................2611.001.00-----------------------------------------------------------------1.00-----------------------------------
.....................................................................................................................................................................................ATAGGGACACGGCTCACTCCAGCAGA2611.001.00----------------------------------1.00------------------------------------------------------------------
........................................................................................................................................................................AGAATTGGGCCAGATAGGGACACGGCT............2711.001.00------------------------------1.00----------------------------------------------------------------------
.................................................................................................TGGGGAGAAGGGGAAGAAGAC.........................................................................................2111.001.00----------1.00------------------------------------------------------------------------------------------
........................................................................................................................................................................AGAATTGGGCCAGATAGGGACACGGT.............261.000.00-----------------1.00-----------------------------------------------------------------------------------
............................................................................................................................................................................................CACGGCTCACTCCAGCAGA1911.001.00--------------------1.00--------------------------------------------------------------------------------
.......................................................................................................................................................................AAGAATTGGGCCAGATAGGGACACG...............2511.001.00-------------------------------------------------------------------------------------1.00---------------
..............................................................................................TCCTGGGGAGAAGGGGAAGAAGACC........................................................................................2511.001.00----1.00------------------------------------------------------------------------------------------------
................................................................................................................................................................................GCCAGATAGGGACACGGCTCACTCCAGCAG.3011.001.00------------------------------------------------------------------------------1.00----------------------
.................................................................................................TGGGGAGAAGGGGAAGAAG...........................................................................................1911.001.00--------------------------------------------------------------------1.00--------------------------------
.......GCTAGGGGAAGAGAGTGAGGAG..................................................................................................................................................................................2211.001.00--------------------------------1.00--------------------------------------------------------------------
..............................................................................................TCCTGGGGAGAAGGGGAAGAAGA..........................................................................................2311.001.00---------------------------------1.00-------------------------------------------------------------------
................................GCGCTCCGTGTACAACAG.............................................................................................................................................................1811.001.00-------------------------------------------------------------1.00---------------------------------------
......................................................................................................................................TATAACCTTCCAATTCTCCCGAG..................................................231.000.001.00----------------------------------------------------------------------------------------------------
....................AGTGAGGAGTTTGCGCTCCGTGTACA.................................................................................................................................................................2611.001.00--------------------------------------------------------------------------1.00--------------------------
.......................................................................................................................................................................................AGGGACACGGCTCACTCCAGCAGA2411.001.00-----------1.00-----------------------------------------------------------------------------------------
...................................................................................................................................................................................AGATAGGGACACGGCTCACTCCAGCAG.2711.001.00--------------1.00--------------------------------------------------------------------------------------
........................................................................................................................................................................................GGGACACGGCTCACTCCAGC...2011.001.00--1.00--------------------------------------------------------------------------------------------------
..............................................................................................TCCTGGGGAGAAGGGGAAGAAGACCT.......................................................................................2611.001.00------------------------------------------------------------------1.00----------------------------------
.............................................................................................................................................................................TGGGCCAGATAGGGACAC................1811.001.00---------------------------------------------------------------------------------------1.00-------------
...........................................................................................................................................................................ATTGGGCCAGATAGGGACACGGG.............231.000.00------------------------------------------------------1.00----------------------------------------------
...................................................................................................................................................................................AGATAGGGACACGGCTCACTCCAGCAGACT301.000.00----------------------------1.00------------------------------------------------------------------------
....................................................................................................................................................................................GATAGGGACACGGCTCACTCCAGCAGA2711.001.00-----------------1.00-----------------------------------------------------------------------------------
...........................................................................................................................................................................ATTGGGCCAGATAGGGACACGGCT............2411.001.00-------------------------------------------------1.00---------------------------------------------------
............................................................................................................................................................................TTGGGCCAGATAGGGACACGGCTTA..........251.000.00--------------------------------1.00--------------------------------------------------------------------
...........................................................................................................................................................AGCTGGTGGCCAAAGAATTGGGCCAG..........................2611.001.00---1.00-------------------------------------------------------------------------------------------------
...............................................................................................CCTGGGGAGAAGGGGAAGAAGAT.........................................................................................231.000.00-----------1.00-----------------------------------------------------------------------------------------
................................GCGCTCCGTGTACAACAGCT...........................................................................................................................................................2011.001.00---1.00-------------------------------------------------------------------------------------------------
.....................................................................................................................................................................CAAAGAATTGGGCCAGATAGG.....................2111.001.00------------------------------------------------------------1.00----------------------------------------
...............................................................................................CCTGGGGAGAAGGGGAAGAAGACC........................................................................................2411.001.00-----------------------------------------------------------------------------------1.00-----------------
..................AGAGTGAGGAGTTTGTGCT..........................................................................................................................................................................191.000.00-------------------------------------------------------------------------1.00---------------------------
..................AGAGTGAGGAGTTTGATT...........................................................................................................................................................................181.000.00------------------------------------1.00----------------------------------------------------------------
......................................................................................................................................................................AAAGAATTGGGCCAGATAGGGACACGG..............2711.001.00-----------------1.00-----------------------------------------------------------------------------------
..........................................TACAACAGGTGGTAGTGAACAGGGGTT..........................................................................................................................................2711.002.00-------------------------------------------1.00---------------------------------------------------------
..............GAAGAGAGTGAGGAGCCCT..............................................................................................................................................................................191.000.00--------------------------------------------1.00--------------------------------------------------------
...............................................................................................................................................................................................GGCTCACTCCAGCAGGAAC191.000.00------------------------------------------------------------------------------------------1.00----------
.............................................................................................................................................................................TGGGCCAGATAGGGACACGGCTCAC.........2511.001.00--------------1.00--------------------------------------------------------------------------------------
..................AGAGTGAGGAGTTTGTAT...........................................................................................................................................................................181.000.00---------------1.00-------------------------------------------------------------------------------------
.....................................................................................................................................................................CAAAGAATTGGGCCAGATAGGGACACGG..............2811.001.00------1.00----------------------------------------------------------------------------------------------
.......................................................................................................................................................................................AGGGACACGGCTCAC.........1530.330.33----------------------0.33------------------------------------------------------------------------------

Antisense strand
GTCGACAGCTAGGGGAAGAGAGTGAGGAGTTTGCGCTCCGTGTACAACAGGTGGTAGTGAACAGGGGTGTGGTGGAAGTGGGGGGGTCCCTCCCTCCTGGGGAGAAGGGGAAGAAGACCTGACGAGGCTACAGCTATAACCTTCCAATTCTCCCTAGCTGGTGGCCAAAGAATTGGGCCAGATAGGGACACGGCTCACTCCAGCAGA
................................................................................................((((((((((..(((((.((.(((....)))))...........)))))..))))))))))..................................................
............................................................................................93..............................................................157................................................
SizePerfect hitTotal NormPerfect NormSRR546155(SRX180174)
Global profiling of miRNA and the hairpin pre. (ago2 Neuroblastoma)		SRR391851(GSM852146)
gender: femalegenotype/variation: wild typeti. (embryo)		SRR391846(GSM852141)
gender: femalegenotype/variation: ADAR2-/-tis. (embryo)		SRR391853(GSM852148)
gender: femalegenotype/variation: ADAR2-/-/AD. (embryo)		SRR279904(GSM689054)
cell type: mouse embryonic stem cellcell line. (ESC)		SRR685339(GSM1079783)
"Small RNAs (15-50 nts in length) from immort. (cell line)		mjTestesKO7()
Testes Data. (Zcchc11 testes)		SRR038742(GSM527277)
small RNA-Seq. (dgcr8 brain)		SRR390299(GSM849857)
cell line: NIH-3T3cell type: fibroblastip ant. (ago2 fibroblast)		SRR040489(GSM533912)
E18.5 Ago2 catalytically inactive LIVER small RNA. (ago2 liver)		SRR059769(GSM562831)
Treg_Drosha. (spleen)		SRR391845(GSM852140)
gender: femalegenotype/variation: wild typeti. (embryo)		SRR390297(GSM849855)
cell line: NIH-3T3cell type: fibroblastip ant. (fibroblast)		SRR391852(GSM852147)
gender: femalegenotype/variation: ADAR2-/-tis. (embryo)		SRR346418(SRX098259)
Global profiling of miRNA and the hairpin pre. (Liver)		SRR073954(GSM629280)
total RNA. (blood)		SRR039185(GSM485325)
shLuc.1309;ROSA-rtTA (-dox). (fibroblast)		SRR042454(GSM539846)
mouse germinal center B cells (lymph node) [09-002]. (b cell)		SRR391848(GSM852143)
gender: femalegenotype/variation: wild typeti. (embryo)		SRR306537(GSM750580)
19-24nt. (ago2 brain)		SRR346424(SRX098266)
Global profiling of miRNA and the hairpin pre. (Neuroblastoma)		mjLiverWT2()
Liver Data. (liver)		SRR391850(GSM852145)
gender: femalegenotype/variation: ADAR2-/-/AD. (embryo)		SRR306541(GSM750584)
19-24nt. (ago2 brain)		SRR345199(SRX097260)
source: size fractionated RNA from mouse hipp. (brain)		Ago1IP517(Rui)
Quantitative functions of Argonaute proteins . (ago1 skin)		SRR553602(SRX182808)
source: Sertoli cells. (Sertoli cells)		SRR042449(GSM539841)
mouse B cells activated in vitro with LPS/IL4 replicate 2 [09-002]. (b cell)		SRR028732(GSM400969)
Mili-Tdrd1 KO associated. (mili testes)		SRR391849(GSM852144)
gender: femalegenotype/variation: ADAR2-/-tis. (embryo)		SRR034118(GSM466728)
Mili IP_Tdrd9+/- replicate1. (mili testes)		SRR402762(SRX117945)
source: ES E14 male cells. (ESC)		SRR042468(GSM539860)
mouse Th1 cells [09-002]. (lymph)		SRR279903(GSM689053)
cell type: mouse embryonic stem cellcell line. (ESC)		SRR346417(SRX098258)
Global profiling of miRNA and the hairpin pre. (Brain)		SRR038744(GSM527279)
small RNA-Seq. (brain)		SRR116846(GSM678422)
Small RNA deep sequencing from mouse epididym. (epididymis)		SRR029123(GSM416611)
NIH3T3. (cell line)		SRR306533(GSM750576)
19-24nt. (ago2 brain)		SRR402760(SRX117943)
source: ES E14 male cells. (ESC)		SRR306542(GSM750585)
19-24nt. (ago2 brain)		Ago2IP504(Rui)
Quantitative functions of Argonaute proteins . (ago2 skin)		SRR029036(GSM433288)
18dpp_hetero_tdrd6-KO. (tdrd6 testes)		SRR034119(GSM466729)
Mili IP_Tdrd9+/- replicate2. (mili testes)		SRR059766(GSM562828)
DN3_Drosha. (thymus)		SRR059771(GSM562833)
CD4_control. (spleen)		GSM314557(GSM314557)
ESC dgcr8 (Illumina). (ESC)		SRR059770(GSM562832)
Treg_Dicer. (spleen)		SRR029037(GSM433289)
18dpp_homo_tdrd6-KO. (tdrd6 testes)		SRR042455(GSM539847)
mouse plasma cells [09-002]. (blood)		SRR345196(SRX097257)
source: size fractionated RNA from mouse hipp. (brain)		SRR391847(GSM852142)
gender: femalegenotype/variation: ADAR2-/-/AD. (embryo)		SRR345197(SRX097258)
source: size fractionated RNA from mouse hipp. (brain)		Ago1IP812(Rui)
Quantitative functions of Argonaute proteins . (ago1 skin)		SRR042487(GSM539879)
mouse BclXL B activated with LPS/IL4 [BalbC] [09-002]. (spleen)		SRR042452(GSM539844)
mouse B1 B cells [09-002]. (b cell)		SRR029041(GSM433293)
6w_homo_tdrd6-KO. (tdrd6 testes)		SRR402766(SRX117949)
source: ES PGK female cells. (ESC)		SRR345198(SRX097259)
source: size fractionated RNA from mouse hipp. (brain)		SRR042471(GSM539863)
mouse TFHS cells [09-002]. (spleen)		mjTestesKO6()
Testes Data. (Zcchc11 testes)		SRR279906(GSM689056)
cell type: mouse embryonic stem cellcell line. (ESC)		SRR029042(GSM433294)
18.5dpc_hetero_tdrd1-KO. (tdrd1 testes)		SRR029038(GSM433290)
25dpp_hetero_tdrd6-KO. (tdrd6 testes)		SRR034120(GSM466730)
Mili IP_Tdrd9-/- replicate1. (mili testes)		mjTestesKO8()
Testes Data. (Zcchc11 testes)		SRR042458(GSM539850)
mouse basophil cells [09-002]. (b cell)		Ago3IP805(Rui)
Quantitative functions of Argonaute proteins . (ago3 skin)		SRR402761(SRX117944)
source: ES E14 male cells. (ESC)		SRR279907(GSM689057)
cell type: mouse embryonic stem cellcell line. (ESC)		SRR306536(GSM750579)
19-24nt. (ago2 brain)		SRR553604(SRX182810)
source: Spermatocytes. (Spermatocytes)		SRR248526(GSM733814)
cell type: Thy1- spermatogonial stem cellstra. (testes)		SRR042459(GSM539851)
mouse neutrophil cells replicate 1 [09-002]. (blood)		SRR014232(GSM319956)
16.5 dpc MILI. (mili testes)		SRR042447(GSM539839)
mouse mature B cells (spleen) replicate 2 [09-002]. (b cell)		SRR040488(GSM533911)
E18.5 wild type LIVER small RNA. (liver)		SRR042488(GSM539880)
mouse BclXL germinal center B cells [BalbC] [09-002]. (B cell)		SRR346416(SRX098257)
Global profiling of miRNA and the hairpin pre. (Kidney)		SRR206942(GSM723283)
other. (brain)		SRR039186(GSM485326)
shLuc.1309;ROSA-rtTA (+dox). (fibroblast)		SRR039154(GSM471931)
HL1_siSrf2_smallRNAseq. (muscle)		SRR042451(GSM539843)
mouse B cells activated in vitro with LPS/aIgD-Dextran [09-002]. (b cell)		SRR059772(GSM562834)
CD4_Drosha. (spleen)		SRR306534(GSM750577)
19-24nt. (ago2 brain)		SRR042463(GSM539855)
mouse natural killer cells [09-002]. (spleen)		SRR306527(GSM750570)
19-24nt. (ago2 brain)		SRR042450(GSM539842)
mouse B cells activated in vitro with LPS/IL4 replicate 3 [09-002]. (b cell)		SRR039153(GSM471930)
HL1_siSrf1_smallRNAseq. (muscle)		SRR345201(SRX097262)
source: size fractionated RNA from mouse hipp. (brain)		SRR248525(GSM733813)
cell type: Thy1- spermatogonial stem cellstra. (testes)		SRR206941(GSM723282)
other. (brain)		SRR346422(SRX098264)
Global profiling of miRNA and the hairpin pre. (Muscle)		Ago3IP812(Rui)
Quantitative functions of Argonaute proteins . (ago3 skin)		SRR042475(GSM539867)
mouse embryonic fibroblast cells [09-002]. (fibroblast)		SRR306531(GSM750574)
19-24nt. (ago2 brain)		SRR042445(GSM539837)
mouse immature B cells [09-002]. (b cell)		SRR059765(GSM562827)
DN3_control. (thymus)		SRR042484(GSM539876)
mouse salivary gland tissue [09-002]. (gland)		SRR306535(GSM750578)
19-24nt. (ago2 brain)		SRR037924(GSM510462)
e9p5_rep2. (embryo)
.................................................................................................................................ACAGCTATAACCTTCCTG............................................................ 181.000.00------------------------1.00----------------------------------------------------------------------------
............................................................................................................................................................GCTGGTGGCCAAAGACTC................................. 181.000.00--------------------------------------------------------------1.00--------------------------------------
.................................................................................................................................ACAGCTATAACCTTCCTC............................................................ 181.000.00------------------------1.00----------------------------------------------------------------------------
.........................GGAGTTTGCGCTCCGTA..................................................................................................................................................................... 171.000.00----------------------------------------------------1.00------------------------------------------------
...................GAGTGAGGAGTTTGCGTG.......................................................................................................................................................................... 181.000.00-----------1.00-----------------------------------------------------------------------------------------