ID: uc008uht.4
GENE: Hectd3(5)
chr4:116669585-116669772+


(1)
AGO.mut 		(5)
AGO2.ip 		(8)
B-CELL 		(15)
BRAIN 		(2)
CELL-LINE 		(1)
DGCR8.mut 		(11)
EMBRYO 		(8)
ESC 		(4)
FIBROBLAST 		(2)
KIDNEY 		(9)
LIVER 		(2)
LYMPH 		(15)
OTHER 		(8)
OTHER.mut 		(1)
OVARY 		(1)
PIWI.ip 		(1)
PIWI.mut 		(3)
SPLEEN 		(17)
TESTES 		(1)
THYMUS 		(2)
TOTAL-RNA 		(1)
UTERUS

Sense strand
CAGTGCCAACACTGGGTACGGCTTACCATGAAGAAAGGCACAATTGTCAAGTGAGTGGGCTCTGGGCATGACAGGGTGGATGAGCCATGTGCTGCGGGTGCCTAGAGACTCATTCAGATACATACTCTGGGTCCTCAGGAAGCTGCTACTCACAGTGGATACCACAGATGACAACTTCATGCCGAAAC
...................................................((((((((((((((((((..(((.((((.....))))...)))...)))))))))).))))))))..........((((....))))..................................................
..................................................51.....................................................................................138................................................
SizePerfect hitTotal NormPerfect NormSRR546155(SRX180174)
Global profiling of miRNA and the hairpin pre. (ago2 Neuroblastoma)		SRR346421(SRX098263)
Global profiling of miRNA and the hairpin pre. (mixture)		mjTestesKO7()
Testes Data. (Zcchc11 testes)		SRR553583(SRX182789)
source: Cerebellum. (Cerebellum)		SRR346424(SRX098266)
Global profiling of miRNA and the hairpin pre. (Neuroblastoma)		SRR553602(SRX182808)
source: Sertoli cells. (Sertoli cells)		mjTestesKO6()
Testes Data. (Zcchc11 testes)		mjLiverWT1()
Liver Data. (liver)		SRR553582(SRX182788)
source: Brain. (Brain)		mjTestesKO5()
Testes Data. (Zcchc11 testes)		SRR391852(GSM852147)
gender: femalegenotype/variation: ADAR2-/-tis. (embryo)		SRR346425(SRX098267)
Global profiling of miRNA and the hairpin pre. (Neuroblastoma)		mjTestesWT4()
Testes Data. (testes)		SRR346417(SRX098258)
Global profiling of miRNA and the hairpin pre. (Brain)		mjTestesKO8()
Testes Data. (Zcchc11 testes)		SRR279904(GSM689054)
cell type: mouse embryonic stem cellcell line. (ESC)		mjLiverKO3()
Liver Data. (Zcchc11 liver)		SRR391853(GSM852148)
gender: femalegenotype/variation: ADAR2-/-/AD. (embryo)		SRR042471(GSM539863)
mouse TFHS cells [09-002]. (spleen)		SRR248526(GSM733814)
cell type: Thy1- spermatogonial stem cellstra. (testes)		mjLiverKO1()
Liver Data. (Zcchc11 liver)		SRR390299(GSM849857)
cell line: NIH-3T3cell type: fibroblastip ant. (ago2 fibroblast)		mjTestesWT2()
Testes Data. (testes)		SRR391845(GSM852140)
gender: femalegenotype/variation: wild typeti. (embryo)		SRR391846(GSM852141)
gender: femalegenotype/variation: ADAR2-/-tis. (embryo)		SRR391848(GSM852143)
gender: femalegenotype/variation: wild typeti. (embryo)		SRR391849(GSM852144)
gender: femalegenotype/variation: ADAR2-/-tis. (embryo)		SRR279906(GSM689056)
cell type: mouse embryonic stem cellcell line. (ESC)		SRR248523(GSM733811)
cell type: Thy1+ spermatogonial stem cellstra. (testes)		SRR029043(GSM433295)
18.5dpc_homo_tdrd1-KO. (tdrd1 testes)		SRR346423(SRX098265)
Global profiling of miRNA and the hairpin pre. (Brain)		SRR039154(GSM471931)
HL1_siSrf2_smallRNAseq. (muscle)		SRR685339(GSM1079783)
"Small RNAs (15-50 nts in length) from immort. (cell line)		GSM314557(GSM314557)
ESC dgcr8 (Illumina). (ESC)		SRR391847(GSM852142)
gender: femalegenotype/variation: ADAR2-/-/AD. (embryo)		SRR042454(GSM539846)
mouse germinal center B cells (lymph node) [09-002]. (b cell)		GSM509278(GSM509278)
small RNA cloning by length. (piwi testes)		SRR279903(GSM689053)
cell type: mouse embryonic stem cellcell line. (ESC)		SRR391851(GSM852146)
gender: femalegenotype/variation: wild typeti. (embryo)		SRR248527(GSM733815)
cell type: spermatogonial stem cell enriched . (testes)		SRR346418(SRX098259)
Global profiling of miRNA and the hairpin pre. (Liver)		SRR040488(GSM533911)
E18.5 wild type LIVER small RNA. (liver)		SRR279905(GSM689055)
cell type: mouse embryonic stem cellcell line. (ESC)		SRR346416(SRX098257)
Global profiling of miRNA and the hairpin pre. (Kidney)		SRR391850(GSM852145)
gender: femalegenotype/variation: ADAR2-/-/AD. (embryo)		SRR553586(SRX182792)
source: Testis. (testes)		SRR553585(SRX182791)
source: Kidney. (Kidney)		SRR248525(GSM733813)
cell type: Thy1- spermatogonial stem cellstra. (testes)		SRR346422(SRX098264)
Global profiling of miRNA and the hairpin pre. (Muscle)		SRR345199(SRX097260)
source: size fractionated RNA from mouse hipp. (brain)		GSM640582(GSM640582)
small RNA in the liver with paternal control . (liver)		SRR042470(GSM539862)
mouse Th17 cells [09-002]. (lymph)		SRR065054(SRR065054)
Tissue-specific Regulation of Mouse MicroRNA . (jejunum)		SRR037904(GSM510440)
brain_rep1. (brain)		SRR042477(GSM539869)
mouse brain tissue [09-002]. (brain)		SRR042444(GSM539836)
mouse pre B cells [09-002]. (b cell)		SRR042486(GSM539878)
mouse ovaries [09-002]. (ovary)		SRR402766(SRX117949)
source: ES PGK female cells. (ESC)		SRR042469(GSM539861)
mouse Th2 cells [09-002]. (lymph)		SRR306530(GSM750573)
19-24nt. (ago2 brain)		GSM510455(GSM510455)
newborn_rep11. (total RNA)		SRR345198(SRX097259)
source: size fractionated RNA from mouse hipp. (brain)		SRR402762(SRX117945)
source: ES E14 male cells. (ESC)		SRR553603(SRX182809)
source: Spermatids. (Spermatids)		SRR042448(GSM539840)
mouse B cells activated in vitro with LPS/IL4 replicate 1 [09-002]. (b cell)		mjTestesWT3()
Testes Data. (testes)		SRR029038(GSM433290)
25dpp_hetero_tdrd6-KO. (tdrd6 testes)		SRR038742(GSM527277)
small RNA-Seq. (dgcr8 brain)		SRR206940(GSM723281)
other. (brain)		SRR042458(GSM539850)
mouse basophil cells [09-002]. (b cell)		GSM640578(GSM640578)
small RNA in the liver with paternal control. (liver)		SRR116846(GSM678422)
Small RNA deep sequencing from mouse epididym. (epididymis)		SRR042443(GSM539835)
mouse pro B cells [09-002]. (b cell)		SRR346420(SRX098261)
Global profiling of miRNA and the hairpin pre. (Uterus)		SRR065056(SRR065056)
Tissue-specific Regulation of Mouse MicroRNA . (jejunum)		GSM314552(GSM314552)
ESC wild type (Illumina). (ESC)		SRR014232(GSM319956)
16.5 dpc MILI. (mili testes)		SRR206939(GSM723280)
other. (brain)		SRR042447(GSM539839)
mouse mature B cells (spleen) replicate 2 [09-002]. (b cell)		SRR073954(GSM629280)
total RNA. (blood)		SRR037914(GSM510451)
newborn_rep7. (total RNA)		SRR042451(GSM539843)
mouse B cells activated in vitro with LPS/aIgD-Dextran [09-002]. (b cell)		SRR039152(GSM471929)
HL1_siNon_smallRNAseq. (muscle)		SRR390300(GSM849858)
cell line: NIH-3T3cell type: fibroblastinfect. (ago2 fibroblast)		SRR042463(GSM539855)
mouse natural killer cells [09-002]. (spleen)		SRR037925(GSM510463)
e9p5_rep3. (embryo)		SRR073955(GSM629281)
total RNA. (blood)		SRR042446(GSM539838)
mouse mature B cells (spleen) replicate 1 [09-002]. (b cell)		SRR345201(SRX097262)
source: size fractionated RNA from mouse hipp. (brain)		SRR040489(GSM533912)
E18.5 Ago2 catalytically inactive LIVER small RNA. (ago2 liver)		SRR060845(GSM561991)
total RNA. (brain)		GSM519104(GSM519104)
mouse_granulocyte_nuclei_smallRNAs. (cell line)		SRR039183(GSM485323)
shLuc.1309 (-dox). (fibroblast)		SRR306540(GSM750583)
19-24nt. (ago2 brain)		SRR059766(GSM562828)
DN3_Drosha. (thymus)		SRR039185(GSM485325)
shLuc.1309;ROSA-rtTA (-dox). (fibroblast)		SRR059771(GSM562833)
CD4_control. (spleen)		SRR077864(GSM637801)
18-30 nt small RNAs. (liver)		SRR039610(GSM527274)
small RNA-Seq. (brain)		SRR037930(GSM510468)
e7p5_rep4. (embryo)		GSM509279(GSM509279)
MVH-/- E16.5 small RNA. (testes)
..................................................GTGAGTGGGCTCTGGGCATGACA...................................................................................................................23188.0088.008.00-10.004.001.003.005.008.004.002.005.001.00-1.00---2.00-1.004.003.001.00-1.001.00--1.00---3.00-----1.001.00---1.001.00-1.00-2.00----1.00-1.00-1.00---------1.001.00---1.00---1.00----1.00-1.001.00-----1.00------1.00---
..................................................GTGAGTGGGCTCTGGGCATGAC....................................................................................................................22166.0066.0012.00-5.006.004.002.00---2.001.001.006.001.003.00----1.00-----1.002.00---1.001.00-2.001.00----1.00-2.00-----1.00---1.00--1.00-1.00-1.00------------1.00----------1.00---1.00--1.00--1.00-1.00------
..................................................GTGAGTGGGCTCTGGGCATGA.....................................................................................................................21146.0046.0015.00-6.003.002.00---2.003.00---2.00-----1.00--1.00--1.001.00-1.001.001.00--------------1.00-------------1.001.00-----1.00--------1.00-----------------1.00-------
..................................................GTGAGTGGGCTCTGGGCATGACT...................................................................................................................23123.0066.002.00----4.002.00-3.00-1.001.00-2.00----------------1.001.00---------------------------------1.00----1.00--------------------1.00---1.00--1.001.00-
..................................................GTGAGTGGGCTCTGGGCATGACAGGGTGGATGAGCCATGTGCTGCGGGTGCCTAGAGACTCATTCAGATACATACTCTGGGTCCTCAG..................................................88122.0022.00-22.00---------------------------------------------------------------------------------------------------
..................................................................................................................CAGATACATACTCTGGGTCCTCAG..................................................24113.0013.00-----2.00---------5.002.00-2.00-----------------------2.00----------------------------------------------------------
..............................................................................................CGGGTGCCTAGAGACTCATTCAGT......................................................................24110.003.005.00--1.001.00-----------------------------------2.00----------------------1.00-------------------------------------
..................................................GTGAGTGGGCTCTGGGCATGACAT..................................................................................................................2418.0088.001.00----2.00--------------------------------1.00-------1.00-----1.00----------------1.00----1.00--------------------------
..................................................GTGAGTGGGCTCTGGGCAT.......................................................................................................................1917.007.003.00--2.001.00------1.00-----------------------------------------------------------------------------------------
..................................................GTGAGTGGGCTCTGGGCATGT.....................................................................................................................2116.002.001.00-------1.00-------------2.00------2.00-----------------------------------------------------------------------
..................................................GTGAGTGGGCTCTGGGCATGAAA...................................................................................................................2316.0046.001.00--1.00------------3.00---------------------------1.00--------------------------------------------------------
..............................................................................................CGGGTGCCTAGAGACTCATTCAGA......................................................................2414.004.001.00-----3.00----------------------------------------------------------------------------------------------
..................................................GTGAGTGGGCTCTGGGCATGACATAAC...............................................................................................................2714.0088.00-------4.00---------------------------------------------------------------------------------------------
.................................................................................................................TCAGATACATACTCTGGGTCCTCAG..................................................2513.003.00---------------------------3.00-------------------------------------------------------------------------
..............................................................................................CGGGTGCCTAGAGACTCATTCAG.......................................................................2313.003.00----2.00----------------------------------------1.00-------------------------------------------------------
..................................................GTGAGTGGGCTCTGGGCATGACAGT.................................................................................................................253.000.001.00-----------------1.00------------------------------------------------------------1.00---------------------
..................................................GTGAGTGGGCTCTGGGCATGACAGGGTGGATGAGCCATGTGCTGCGGGTGCCTAGAGACTCATTCAGATACATACTCTGGGTCCTCAGAAG...............................................9113.0022.00-3.00---------------------------------------------------------------------------------------------------
..................................................GTGAGTGGGCTCTGGGCATGACAA..................................................................................................................2413.0088.00------1.00------------1.00----1.00----------------------------------------------------------------------------
..................................................GTGAGTGGGCTCTGGGCATGACAGA.................................................................................................................253.000.00------------------1.00--1.00--------------------------------------------------------1.00----------------------
..................................................GTGAGTGGGCTCTGGGCATGAA....................................................................................................................2212.0046.001.00--------1.00-------------------------------------------------------------------------------------------
..................................................GTGAGTGGGCTCTGGGCATGAAT...................................................................................................................2312.0046.00----1.00------------------1.00-----------------------------------------------------------------------------
..................................................GTGAGTGGGCTCTGGGCATGACAAA.................................................................................................................2512.0088.00----1.00-1.00----------------------------------------------------------------------------------------------
..................................................GTGAGTGGGCTCTGGGCATGAT....................................................................................................................2212.0046.00---1.00------------------------1.00------------------------------------------------------------------------
........ACACTGGGTACGGCTTACCATGAATTT.........................................................................................................................................................272.000.00-----------------------------------2.00-----------------------------------------------------------------
..................................................GTGAGTGGGCTCTGGGCATGTAAT..................................................................................................................2412.002.00----2.00------------------------------------------------------------------------------------------------
..................................................................................................................CAGATACATACTCTGGGTCCTCAGTTTA..............................................2812.0013.00--------------2.00--------------------------------------------------------------------------------------
..................................................GTGAGTGGGCTCTGGGCATG......................................................................................................................2012.002.00------1.00-------1.00--------------------------------------------------------------------------------------
..................................................GTGAGTGGGCTCTGGGCATGACAGGG................................................................................................................2612.002.00------------------------------------1.00---------------------------------------------------------------1.00
........................ACCATGAAGAAAGGCACAAT................................................................................................................................................2011.001.00-----------------1.00-----------------------------------------------------------------------------------
..................................................GTGAGTGGGCTCTGGGCAA.......................................................................................................................191.000.00--1.00--------------------------------------------------------------------------------------------------
..................................................................................................................CAGATACATACTCTGGGTCCTCAGT.................................................2511.0013.00-----------------------------------------------------------------------------1.00-----------------------
.................................................................................................................TCAGATACATACTCTGGGTCCTCAGA.................................................2611.003.00--------------------------------------------------------------1.00--------------------------------------
...........................ATGAAGAAAGGCACAATTGTCAA..........................................................................................................................................2311.001.00--------------------------------------------------------------------------------1.00--------------------
..................................................GTGAGTGGGCTCTGGGCATATA....................................................................................................................2211.007.00-----------1.00-----------------------------------------------------------------------------------------
..................................................GTGAGTGGGCTCTGGGCATGACATTA................................................................................................................2611.0088.00---------------------------------1.00-------------------------------------------------------------------
..................................................GTGAGTGGGCTCTGGGCATGATT...................................................................................................................2311.0046.001.00----------------------------------------------------------------------------------------------------
................TACGGCTTACCATGAAGAA.........................................................................................................................................................1911.001.00----------------------------------------------------------------1.00------------------------------------
..................................................GTGAGTGGGCTCTGGGCATGACTT..................................................................................................................2411.0066.00---------------------------------------------------------------------------------------1.00-------------
........................ACCATGAAGAAAGGCACAATT...............................................................................................................................................2111.001.00-----------------------1.00-----------------------------------------------------------------------------
...................................................TGAGTGGGCTCTGGGCATGAC....................................................................................................................2111.001.00-------------------------------------------1.00---------------------------------------------------------
............................................................................................................................................................GGATACCACAGATGACAACTTC..........2211.001.00-----------------------1.00-----------------------------------------------------------------------------
................................GAAAGGCACAATTGTCAA..........................................................................................................................................1811.001.00-------------------------------------------------------------------------------------1.00---------------
..................................................GTGAGTGGGCTCTGGGCATTA.....................................................................................................................2111.007.00----1.00------------------------------------------------------------------------------------------------
..............................................................................................CGGGTGCCTAGAGACTCATTAG........................................................................221.000.00-------------------------------------------------------------------------1.00---------------------------
..................................................................................................................CAGATACATACTCTGGGTCCTCAGA.................................................2511.0013.00-------------------------------------1.00---------------------------------------------------------------
..................................................GTGAGTGGGCTCTGGGCATA......................................................................................................................2011.007.00----1.00------------------------------------------------------------------------------------------------
....................GCTTACCATGAAGAAAGG......................................................................................................................................................1811.001.00------------------------------------------------------------------------------------------------1.00----
........................ACCATGAAGAAAGGCACAATTGT.............................................................................................................................................2311.001.00-----------------1.00-----------------------------------------------------------------------------------
.......................TACCATGAAGAAAGGCACAATT...............................................................................................................................................2211.001.00----------------------------------1.00------------------------------------------------------------------
..................................................GTGAGTGGGCTCTGGGCATGG.....................................................................................................................2111.002.001.00----------------------------------------------------------------------------------------------------
...........................................................CTCTGGGCATGACAGACG...............................................................................................................181.000.00-------------------------------------------------------------1.00---------------------------------------
..................................................GTGAGTGGGCTCTGGGCATGACTAGT................................................................................................................2611.0066.00-----------1.00-----------------------------------------------------------------------------------------
..................................................GTGAGTGGGCTCTGGGCATT......................................................................................................................2011.007.001.00----------------------------------------------------------------------------------------------------
..................................................GTGAGTGGGCTCTGGGCATGACC...................................................................................................................2311.0066.00----1.00------------------------------------------------------------------------------------------------
...........................................................................................................................................................................CAACTTCATGCCGAAGAA181.000.00-------------------------------------------------1.00---------------------------------------------------
..................................................GTGAGTGGGCTCTGGGCATCACT...................................................................................................................2311.007.00-----1.00-----------------------------------------------------------------------------------------------
...................................................TGAGTGGGCTCTGGGCATGACA...................................................................................................................2211.001.00---1.00-------------------------------------------------------------------------------------------------
....................GCTTACCATGAAGAAAGGC.....................................................................................................................................................1911.001.00-------------------------------------1.00---------------------------------------------------------------
..................................................GTGAGTGGGCTCTGGGCATGAAC...................................................................................................................2311.0046.00-----------------------------------------------1.00-----------------------------------------------------
..................................................GTGAGTGGGCTCTGGGCATGACAGG.................................................................................................................2511.001.00------------------------------------1.00----------------------------------------------------------------
..................................................GTGAGTGGGCTCTGGGCATGAAAAT.................................................................................................................2511.0046.001.00----------------------------------------------------------------------------------------------------
..................................................GTGAGTGGGCTCTGGGCATGATA...................................................................................................................2311.0046.00--1.00--------------------------------------------------------------------------------------------------
..................................................GTGAGTGGGCTCTGGGCATGACTA..................................................................................................................2411.0066.00--------1.00--------------------------------------------------------------------------------------------

Antisense strand
CAGTGCCAACACTGGGTACGGCTTACCATGAAGAAAGGCACAATTGTCAAGTGAGTGGGCTCTGGGCATGACAGGGTGGATGAGCCATGTGCTGCGGGTGCCTAGAGACTCATTCAGATACATACTCTGGGTCCTCAGGAAGCTGCTACTCACAGTGGATACCACAGATGACAACTTCATGCCGAAAC
...................................................((((((((((((((((((..(((.((((.....))))...)))...)))))))))).))))))))..........((((....))))..................................................
..................................................51.....................................................................................138................................................
SizePerfect hitTotal NormPerfect NormSRR546155(SRX180174)
Global profiling of miRNA and the hairpin pre. (ago2 Neuroblastoma)		SRR346421(SRX098263)
Global profiling of miRNA and the hairpin pre. (mixture)		mjTestesKO7()
Testes Data. (Zcchc11 testes)		SRR553583(SRX182789)
source: Cerebellum. (Cerebellum)		SRR346424(SRX098266)
Global profiling of miRNA and the hairpin pre. (Neuroblastoma)		SRR553602(SRX182808)
source: Sertoli cells. (Sertoli cells)		mjTestesKO6()
Testes Data. (Zcchc11 testes)		mjLiverWT1()
Liver Data. (liver)		SRR553582(SRX182788)
source: Brain. (Brain)		mjTestesKO5()
Testes Data. (Zcchc11 testes)		SRR391852(GSM852147)
gender: femalegenotype/variation: ADAR2-/-tis. (embryo)		SRR346425(SRX098267)
Global profiling of miRNA and the hairpin pre. (Neuroblastoma)		mjTestesWT4()
Testes Data. (testes)		SRR346417(SRX098258)
Global profiling of miRNA and the hairpin pre. (Brain)		mjTestesKO8()
Testes Data. (Zcchc11 testes)		SRR279904(GSM689054)
cell type: mouse embryonic stem cellcell line. (ESC)		mjLiverKO3()
Liver Data. (Zcchc11 liver)		SRR391853(GSM852148)
gender: femalegenotype/variation: ADAR2-/-/AD. (embryo)		SRR042471(GSM539863)
mouse TFHS cells [09-002]. (spleen)		SRR248526(GSM733814)
cell type: Thy1- spermatogonial stem cellstra. (testes)		mjLiverKO1()
Liver Data. (Zcchc11 liver)		SRR390299(GSM849857)
cell line: NIH-3T3cell type: fibroblastip ant. (ago2 fibroblast)		mjTestesWT2()
Testes Data. (testes)		SRR391845(GSM852140)
gender: femalegenotype/variation: wild typeti. (embryo)		SRR391846(GSM852141)
gender: femalegenotype/variation: ADAR2-/-tis. (embryo)		SRR391848(GSM852143)
gender: femalegenotype/variation: wild typeti. (embryo)		SRR391849(GSM852144)
gender: femalegenotype/variation: ADAR2-/-tis. (embryo)		SRR279906(GSM689056)
cell type: mouse embryonic stem cellcell line. (ESC)		SRR248523(GSM733811)
cell type: Thy1+ spermatogonial stem cellstra. (testes)		SRR029043(GSM433295)
18.5dpc_homo_tdrd1-KO. (tdrd1 testes)		SRR346423(SRX098265)
Global profiling of miRNA and the hairpin pre. (Brain)		SRR039154(GSM471931)
HL1_siSrf2_smallRNAseq. (muscle)		SRR685339(GSM1079783)
"Small RNAs (15-50 nts in length) from immort. (cell line)		GSM314557(GSM314557)
ESC dgcr8 (Illumina). (ESC)		SRR391847(GSM852142)
gender: femalegenotype/variation: ADAR2-/-/AD. (embryo)		SRR042454(GSM539846)
mouse germinal center B cells (lymph node) [09-002]. (b cell)		GSM509278(GSM509278)
small RNA cloning by length. (piwi testes)		SRR279903(GSM689053)
cell type: mouse embryonic stem cellcell line. (ESC)		SRR391851(GSM852146)
gender: femalegenotype/variation: wild typeti. (embryo)		SRR248527(GSM733815)
cell type: spermatogonial stem cell enriched . (testes)		SRR346418(SRX098259)
Global profiling of miRNA and the hairpin pre. (Liver)		SRR040488(GSM533911)
E18.5 wild type LIVER small RNA. (liver)		SRR279905(GSM689055)
cell type: mouse embryonic stem cellcell line. (ESC)		SRR346416(SRX098257)
Global profiling of miRNA and the hairpin pre. (Kidney)		SRR391850(GSM852145)
gender: femalegenotype/variation: ADAR2-/-/AD. (embryo)		SRR553586(SRX182792)
source: Testis. (testes)		SRR553585(SRX182791)
source: Kidney. (Kidney)		SRR248525(GSM733813)
cell type: Thy1- spermatogonial stem cellstra. (testes)		SRR346422(SRX098264)
Global profiling of miRNA and the hairpin pre. (Muscle)		SRR345199(SRX097260)
source: size fractionated RNA from mouse hipp. (brain)		GSM640582(GSM640582)
small RNA in the liver with paternal control . (liver)		SRR042470(GSM539862)
mouse Th17 cells [09-002]. (lymph)		SRR065054(SRR065054)
Tissue-specific Regulation of Mouse MicroRNA . (jejunum)		SRR037904(GSM510440)
brain_rep1. (brain)		SRR042477(GSM539869)
mouse brain tissue [09-002]. (brain)		SRR042444(GSM539836)
mouse pre B cells [09-002]. (b cell)		SRR042486(GSM539878)
mouse ovaries [09-002]. (ovary)		SRR402766(SRX117949)
source: ES PGK female cells. (ESC)		SRR042469(GSM539861)
mouse Th2 cells [09-002]. (lymph)		SRR306530(GSM750573)
19-24nt. (ago2 brain)		GSM510455(GSM510455)
newborn_rep11. (total RNA)		SRR345198(SRX097259)
source: size fractionated RNA from mouse hipp. (brain)		SRR402762(SRX117945)
source: ES E14 male cells. (ESC)		SRR553603(SRX182809)
source: Spermatids. (Spermatids)		SRR042448(GSM539840)
mouse B cells activated in vitro with LPS/IL4 replicate 1 [09-002]. (b cell)		mjTestesWT3()
Testes Data. (testes)		SRR029038(GSM433290)
25dpp_hetero_tdrd6-KO. (tdrd6 testes)		SRR038742(GSM527277)
small RNA-Seq. (dgcr8 brain)		SRR206940(GSM723281)
other. (brain)		SRR042458(GSM539850)
mouse basophil cells [09-002]. (b cell)		GSM640578(GSM640578)
small RNA in the liver with paternal control. (liver)		SRR116846(GSM678422)
Small RNA deep sequencing from mouse epididym. (epididymis)		SRR042443(GSM539835)
mouse pro B cells [09-002]. (b cell)		SRR346420(SRX098261)
Global profiling of miRNA and the hairpin pre. (Uterus)		SRR065056(SRR065056)
Tissue-specific Regulation of Mouse MicroRNA . (jejunum)		GSM314552(GSM314552)
ESC wild type (Illumina). (ESC)		SRR014232(GSM319956)
16.5 dpc MILI. (mili testes)		SRR206939(GSM723280)
other. (brain)		SRR042447(GSM539839)
mouse mature B cells (spleen) replicate 2 [09-002]. (b cell)		SRR073954(GSM629280)
total RNA. (blood)		SRR037914(GSM510451)
newborn_rep7. (total RNA)		SRR042451(GSM539843)
mouse B cells activated in vitro with LPS/aIgD-Dextran [09-002]. (b cell)		SRR039152(GSM471929)
HL1_siNon_smallRNAseq. (muscle)		SRR390300(GSM849858)
cell line: NIH-3T3cell type: fibroblastinfect. (ago2 fibroblast)		SRR042463(GSM539855)
mouse natural killer cells [09-002]. (spleen)		SRR037925(GSM510463)
e9p5_rep3. (embryo)		SRR073955(GSM629281)
total RNA. (blood)		SRR042446(GSM539838)
mouse mature B cells (spleen) replicate 1 [09-002]. (b cell)		SRR345201(SRX097262)
source: size fractionated RNA from mouse hipp. (brain)		SRR040489(GSM533912)
E18.5 Ago2 catalytically inactive LIVER small RNA. (ago2 liver)		SRR060845(GSM561991)
total RNA. (brain)		GSM519104(GSM519104)
mouse_granulocyte_nuclei_smallRNAs. (cell line)		SRR039183(GSM485323)
shLuc.1309 (-dox). (fibroblast)		SRR306540(GSM750583)
19-24nt. (ago2 brain)		SRR059766(GSM562828)
DN3_Drosha. (thymus)		SRR039185(GSM485325)
shLuc.1309;ROSA-rtTA (-dox). (fibroblast)		SRR059771(GSM562833)
CD4_control. (spleen)		SRR077864(GSM637801)
18-30 nt small RNAs. (liver)		SRR039610(GSM527274)
small RNA-Seq. (brain)		SRR037930(GSM510468)
e7p5_rep4. (embryo)		GSM509279(GSM509279)
MVH-/- E16.5 small RNA. (testes)
......................................................................................................................................................................GATGACAACTTCATGCGCT... 191.000.00------------------------1.00----------------------------------------------------------------------------
.........................................................................................................................................................................GACAACTTCATGCCGAATAGT 211.000.00----------------------------------------------------------------------------------------1.00------------
............................................................................................TGCGGGTGCCTAGAGAT............................................................................... 171.000.00--------------------------------------------------1.00--------------------------------------------------
..........................................................................................................GACTCATTCAGATACGGC................................................................ 181.000.00-------------------------------1.00---------------------------------------------------------------------
...............GTACGGCTTACCA................................................................................................................................................................ 1340.250.25-------------------------------------------------0.25---------------------------------------------------