ID: uc008tyf.3
GENE: Usp24(3)
chr4:106019684-106019933+


(1)
AGO.mut 		(2)
AGO1.ip 		(20)
AGO2.ip 		(7)
B-CELL 		(43)
BRAIN 		(10)
CELL-LINE 		(3)
DCR.mut 		(2)
DGCR8.mut 		(20)
EMBRYO 		(10)
ESC 		(8)
FIBROBLAST 		(4)
HEART 		(2)
KIDNEY 		(8)
LIVER 		(2)
LUNG 		(4)
LYMPH 		(18)
OTHER 		(9)
OTHER.mut 		(1)
PANCREAS 		(4)
SKIN 		(7)
SPLEEN 		(23)
TESTES 		(2)
THYMUS 		(6)
TOTAL-RNA

Sense strand
TCCCATAGTGTGGACACTCGCAGGGCAGAGGAATATCATGCCAGCCCTTGGCTCCTTCACTAGCTGAGACCTGAGCTTGGCCAGTGTGCTGCAACAACTCTGCTAGTGGAGAGACCAAAGGCTGGATTTTTACCTTCTTTTCTTATGCTAATATGTTGCTATAAAAGTAGGTGATGTTTCTCTGTTCTCTTTGAATATAGGCTTTCAATCCTGATAATGAATACCACTTTAAAAACAGAATGAAAGTGTC
...................................................((.((((((((((.(((..(((.((...))))).((......))..))).)))))))))))).........................................................................................................................................
..................................................51.................................................................118..................................................................................................................................
SizePerfect hitTotal NormPerfect NormSRR546155(SRX180174)
Global profiling of miRNA and the hairpin pre. (ago2 Neuroblastoma)		SRR346424(SRX098266)
Global profiling of miRNA and the hairpin pre. (Neuroblastoma)		SRR390297(GSM849855)
cell line: NIH-3T3cell type: fibroblastip ant. (fibroblast)		SRR391853(GSM852148)
gender: femalegenotype/variation: ADAR2-/-/AD. (embryo)		SRR391852(GSM852147)
gender: femalegenotype/variation: ADAR2-/-tis. (embryo)		SRR402762(SRX117945)
source: ES E14 male cells. (ESC)		SRR390300(GSM849858)
cell line: NIH-3T3cell type: fibroblastinfect. (ago2 fibroblast)		SRR039185(GSM485325)
shLuc.1309;ROSA-rtTA (-dox). (fibroblast)		SRR553602(SRX182808)
source: Sertoli cells. (Sertoli cells)		SRR039186(GSM485326)
shLuc.1309;ROSA-rtTA (+dox). (fibroblast)		SRR042458(GSM539850)
mouse basophil cells [09-002]. (b cell)		SRR391851(GSM852146)
gender: femalegenotype/variation: wild typeti. (embryo)		SRR390299(GSM849857)
cell line: NIH-3T3cell type: fibroblastip ant. (ago2 fibroblast)		SRR306531(GSM750574)
19-24nt. (ago2 brain)		SRR042469(GSM539861)
mouse Th2 cells [09-002]. (lymph)		SRR039184(GSM485324)
shLuc.1309 (+dox). (fibroblast)		SRR346425(SRX098267)
Global profiling of miRNA and the hairpin pre. (Neuroblastoma)		SRR402766(SRX117949)
source: ES PGK female cells. (ESC)		SRR039183(GSM485323)
shLuc.1309 (-dox). (fibroblast)		SRR391848(GSM852143)
gender: femalegenotype/variation: wild typeti. (embryo)		SRR042471(GSM539863)
mouse TFHS cells [09-002]. (spleen)		SRR346417(SRX098258)
Global profiling of miRNA and the hairpin pre. (Brain)		SRR279907(GSM689057)
cell type: mouse embryonic stem cellcell line. (ESC)		SRR248526(GSM733814)
cell type: Thy1- spermatogonial stem cellstra. (testes)		SRR391845(GSM852140)
gender: femalegenotype/variation: wild typeti. (embryo)		SRR279904(GSM689054)
cell type: mouse embryonic stem cellcell line. (ESC)		SRR279903(GSM689053)
cell type: mouse embryonic stem cellcell line. (ESC)		mjTestesWT1()
Testes Data. (testes)		SRR391849(GSM852144)
gender: femalegenotype/variation: ADAR2-/-tis. (embryo)		SRR042468(GSM539860)
mouse Th1 cells [09-002]. (lymph)		SRR391847(GSM852142)
gender: femalegenotype/variation: ADAR2-/-/AD. (embryo)		SRR391846(GSM852141)
gender: femalegenotype/variation: ADAR2-/-tis. (embryo)		SRR553582(SRX182788)
source: Brain. (Brain)		mjTestesWT3()
Testes Data. (testes)		SRR037925(GSM510463)
e9p5_rep3. (embryo)		SRR038741(GSM527276)
small RNA-Seq. (brain)		GSM416732(GSM416732)
MEF. (cell line)		SRR073954(GSM629280)
total RNA. (blood)		SRR306530(GSM750573)
19-24nt. (ago2 brain)		SRR038742(GSM527277)
small RNA-Seq. (dgcr8 brain)		SRR037920(GSM510458)
e12p5_rep2. (embryo)		SRR345202(SRX097263)
source: size fractionated RNA from mouse hipp. (brain)		SRR345207(SRX097268)
source: size fractionated RNA from mouse hipp. (brain)		SRR346423(SRX098265)
Global profiling of miRNA and the hairpin pre. (Brain)		SRR346416(SRX098257)
Global profiling of miRNA and the hairpin pre. (Kidney)		SRR402760(SRX117943)
source: ES E14 male cells. (ESC)		SRR042450(GSM539842)
mouse B cells activated in vitro with LPS/IL4 replicate 3 [09-002]. (b cell)		GSM510444(GSM510444)
brain_rep5. (brain)		SRR042487(GSM539879)
mouse BclXL B activated with LPS/IL4 [BalbC] [09-002]. (spleen)		SRR037928(GSM510466)
e7p5_rep2. (embryo)		mjTestesKO8()
Testes Data. (Zcchc11 testes)		SRR402761(SRX117944)
source: ES E14 male cells. (ESC)		SRR279905(GSM689055)
cell type: mouse embryonic stem cellcell line. (ESC)		SRR553585(SRX182791)
source: Kidney. (Kidney)		SRR306535(GSM750578)
19-24nt. (ago2 brain)		SRR306541(GSM750584)
19-24nt. (ago2 brain)		SRR394083(GSM855969)
"background strain: C57BL6/SV129cell type: KR. (cell line)		SRR206940(GSM723281)
other. (brain)		SRR042488(GSM539880)
mouse BclXL germinal center B cells [BalbC] [09-002]. (B cell)		SRR346422(SRX098264)
Global profiling of miRNA and the hairpin pre. (Muscle)		SRR306529(GSM750572)
19-24nt. (ago2 brain)		SRR553583(SRX182789)
source: Cerebellum. (Cerebellum)		SRR345197(SRX097258)
source: size fractionated RNA from mouse hipp. (brain)		mjTestesWT4()
Testes Data. (testes)		SRR038744(GSM527279)
small RNA-Seq. (brain)		SRR042459(GSM539851)
mouse neutrophil cells replicate 1 [09-002]. (blood)		SRR040488(GSM533911)
E18.5 wild type LIVER small RNA. (liver)		SRR042463(GSM539855)
mouse natural killer cells [09-002]. (spleen)		GSM510454(GSM510454)
newborn_rep10. (total RNA)		SRR345201(SRX097262)
source: size fractionated RNA from mouse hipp. (brain)		SRR394084(GSM855970)
"background strain: C57BL6/SV129cell type: KR. (dicer cell line)		SRR039610(GSM527274)
small RNA-Seq. (brain)		SRR042474(GSM539866)
mouse embryonic stem cells [09-002]. (ESC)		GSM510452(GSM510452)
newborn_rep8. (total RNA)		SRR306539(GSM750582)
19-24nt. (ago2 brain)		SRR042448(GSM539840)
mouse B cells activated in vitro with LPS/IL4 replicate 1 [09-002]. (b cell)		SRR039154(GSM471931)
HL1_siSrf2_smallRNAseq. (muscle)		SRR685339(GSM1079783)
"Small RNAs (15-50 nts in length) from immort. (cell line)		SRR306540(GSM750583)
19-24nt. (ago2 brain)		SRR037929(GSM510467)
e7p5_rep3. (embryo)		SRR042449(GSM539841)
mouse B cells activated in vitro with LPS/IL4 replicate 2 [09-002]. (b cell)		SRR306532(GSM750575)
19-24nt. (ago2 brain)		SRR039152(GSM471929)
HL1_siNon_smallRNAseq. (muscle)		GSM510456(GSM510456)
newborn_rep12. (total RNA)		SRR345204(SRX097265)
source: size fractionated RNA from mouse hipp. (brain)		SRR042472(GSM539864)
mouse iTreg cells [09-002]. (lymph)		SRR029037(GSM433289)
18dpp_homo_tdrd6-KO. (tdrd6 testes)		mjTestesKO7()
Testes Data. (Zcchc11 testes)		SRR037927(GSM510465)
e7p5_rep1. (embryo)		SRR042465(GSM539857)
mouse CD4+ T cells (spleen) [09-002]. (spleen)		SRR248527(GSM733815)
cell type: spermatogonial stem cell enriched . (testes)		SRR306537(GSM750580)
19-24nt. (ago2 brain)		SRR023850(GSM307159)
ZHBT-c40hsmallrna_rep1. (cell line)		SRR037922(GSM510460)
e12p5_rep4. (embryo)		SRR345205(SRX097266)
source: size fractionated RNA from mouse hipp. (brain)		SRR029043(GSM433295)
18.5dpc_homo_tdrd1-KO. (tdrd1 testes)		SRR037921(GSM510459)
e12p5_rep3. (embryo)		SRR042447(GSM539839)
mouse mature B cells (spleen) replicate 2 [09-002]. (b cell)		SRR553584(SRX182790)
source: Heart. (Heart)		mjLiverWT3()
Liver Data. (liver)		SRR306534(GSM750577)
19-24nt. (ago2 brain)		Ago2IP504(Rui)
Quantitative functions of Argonaute proteins . (ago2 skin)		SRR248525(GSM733813)
cell type: Thy1- spermatogonial stem cellstra. (testes)		SRR023851(GSM307160)
ZHBT-c412hsmallrna_rep1. (cell line)		SRR059765(GSM562827)
DN3_control. (thymus)		Ago1IP812(Rui)
Quantitative functions of Argonaute proteins . (ago1 skin)		SRR042473(GSM539865)
mouse nTreg cells [09-002]. (lymph)		SRR345203(SRX097264)
source: size fractionated RNA from mouse hipp. (brain)		SRR069809(GSM610965)
small RNA sequencing; sample 1. (testes)		SRR042466(GSM539858)
mouse CD8+ T cells (spleen) [09-002]. (spleen)		SRR306536(GSM750579)
19-24nt. (ago2 brain)		SRR065056(SRR065056)
Tissue-specific Regulation of Mouse MicroRNA . (jejunum)		SRR037919(GSM510457)
e12p5_rep1. (embryo)		SRR014231(GSM319955)
16.5 dpc total. (testes)		SRR685340(GSM1079784)
"Small RNAs (15-50 nts in length) from immort. (dicer cell line)		SRR037906(GSM510442)
brain_rep3. (brain)		SRR037924(GSM510462)
e9p5_rep2. (embryo)		SRR306538(GSM750581)
19-24nt. (ago2 brain)		SRR037905(GSM510441)
brain_rep2. (brain)		SRR042455(GSM539847)
mouse plasma cells [09-002]. (blood)		SRR363959(GSM822761)
AdultSmall RNA Miwi IPread_length: 36. (testes)		GSM510450(GSM510450)
newborn_rep6. (total RNA)		SRR065054(SRR065054)
Tissue-specific Regulation of Mouse MicroRNA . (jejunum)		SRR042467(GSM539859)
mouse T cells activated in vitro with Concanavalin A [09-002]. (spleen)		SRR042478(GSM539870)
mouse lung tissue [09-002]. (lung)		Ago1IP517(Rui)
Quantitative functions of Argonaute proteins . (ago1 skin)		GSM361407(GSM361407)
CGNP_P6_Ptc+-_Ink4c--_rep5. (brain)		GSM640579(GSM640579)
small RNA in the liver with paternal Low pro. (liver)		SRR042456(GSM539848)
mouse hematopoetic progenitor cells [09-002]. (bone marrow)		SRR038745(GSM527280)
small RNA-Seq. (dgcr8 brain)		SRR029123(GSM416611)
NIH3T3. (cell line)		GSM640580(GSM640580)
small RNA in the liver with paternal Low pro. (liver)		SRR553604(SRX182810)
source: Spermatocytes. (Spermatocytes)		SRR065058(SRR065058)
Tissue-specific Regulation of Mouse MicroRNA . (pancreas)		SRR029040(GSM433292)
6w_hetero_tdrd6-KO. (tdrd6 testes)		SRR306542(GSM750585)
19-24nt. (ago2 brain)		SRR306527(GSM750570)
19-24nt. (ago2 brain)		SRR553586(SRX182792)
source: Testis. (testes)		SRR040489(GSM533912)
E18.5 Ago2 catalytically inactive LIVER small RNA. (ago2 liver)		SRR029036(GSM433288)
18dpp_hetero_tdrd6-KO. (tdrd6 testes)		SRR042475(GSM539867)
mouse embryonic fibroblast cells [09-002]. (fibroblast)		GSM519104(GSM519104)
mouse_granulocyte_nuclei_smallRNAs. (cell line)		SRR346419(SRX098260)
Global profiling of miRNA and the hairpin pre. (Lung)		mjTestesKO5()
Testes Data. (Zcchc11 testes)		SRR306544(GSM750587)
19-24nt. (ago2 brain)		SRR042484(GSM539876)
mouse salivary gland tissue [09-002]. (gland)		SRR037930(GSM510468)
e7p5_rep4. (embryo)		GSM361394(GSM361394)
CGNP_P6_wt_rep1. (brain)		SRR248524(GSM733812)
cell type: Thy1+ spermatogonial stem cellstra. (testes)		SRR345199(SRX097260)
source: size fractionated RNA from mouse hipp. (brain)		SRR095853(SRX039174)
"sequencing of miRNA from wild type and disea. (heart)		SRR037923(GSM510461)
e9p5_rep1. (embryo)		GSM510455(GSM510455)
newborn_rep11. (total RNA)		SRR037900(GSM510436)
testes_rep1. (testes)		SRR037912(GSM510449)
newborn_rep5. (total RNA)		SRR095855BC2(SRX039178)
sequencing of miRNA from wild type and diseas. (heart)		SRR023852(GSM307161)
ZHBT-c424hsmallrna_rep1. (cell line)		SRR346414(SRX098255)
Global profiling of miRNA and the hairpin pre. (Spleen)		SRR363958(GSM822760)
Adult-WTSmall RNA Miwi IP. (testes)		SRR029039(GSM433291)
25dpp_homo_tdrd6-KO. (tdrd6 testes)		GSM640578(GSM640578)
small RNA in the liver with paternal control. (liver)		SRR042464(GSM539856)
mouse CD4+CD8+ T cells (thymus) [09-002]. (thymus)		GSM361399(GSM361399)
CGNP_P6_p53--_Ink4c--_rep2. (brain)		SRR345206(SRX097267)
source: size fractionated RNA from mouse hipp. (brain)		SRR346418(SRX098259)
Global profiling of miRNA and the hairpin pre. (Liver)		GSM314552(GSM314552)
ESC wild type (Illumina). (ESC)		SRR095855BC5(SRX039178)
sequencing of miRNA from wild type and diseas. (heart)		SRR042451(GSM539843)
mouse B cells activated in vitro with LPS/aIgD-Dextran [09-002]. (b cell)		SRR206942(GSM723283)
other. (brain)		GSM475281(GSM475281)
total RNA. (testes)		SRR391850(GSM852145)
gender: femalegenotype/variation: ADAR2-/-/AD. (embryo)		mjLiverKO1()
Liver Data. (Zcchc11 liver)		SRR346415(SRX098256)
source: Testis. (Testes)		SRR206941(GSM723282)
other. (brain)		SRR038740(GSM527275)
small RNA-Seq. (dicer brain)		SRR346421(SRX098263)
Global profiling of miRNA and the hairpin pre. (mixture)		Ago2IP517(Rui)
Quantitative functions of Argonaute proteins . (ago2 skin)		GSM361415(GSM361415)
WholeCerebellum_P6_p53--_Ink4c--_rep4. (brain)		SRR042460(GSM539852)
mouse neutrophil cells replicate 2 [09-002]. (blood)
............................................................................................AACAACTCTGCTAGTGGAGAGA........................................................................................................................................221157.00157.0016.0010.00--1.004.00-12.006.0010.00-2.00-2.00-6.002.006.008.00--1.00-2.00-3.001.00-----5.00-2.002.00-2.00-2.002.001.002.002.004.003.00-1.00--2.002.00-2.001.00--1.00---------1.001.00--1.00--1.00---1.003.00---1.00--1.001.00-------2.00--2.00-----1.00-----1.00-2.00--1.001.00-----------------1.00-----1.00---1.00------1.001.00----1.00---------------1.001.00----
....................................................TCCTTCACTAGCTGAGACCTGA................................................................................................................................................................................221109.00109.0025.006.00-1.005.001.001.001.001.00-1.00--2.00--3.001.00-3.00-3.00-1.00-----------2.00--5.003.00-2.001.00--2.00---1.00----1.00--1.00-1.00-2.002.00-2.00----2.00-1.001.00--------2.002.00-3.00---1.00-----1.00-1.00-----2.00---1.001.00-------1.00---------1.00--1.00--1.00----------1.001.00-----1.00---1.00-----------1.00--1.00-1.00--------
.....................................................CCTTCACTAGCTGAGACCTGAGC..............................................................................................................................................................................23184.0084.004.001.0022.001.003.002.00--1.001.00-4.004.003.00---2.00----8.001.002.001.00-6.00--2.002.00-7.00---1.00---------------------------------------1.00---------1.00--------1.00---------------------------------1.00-----------------------1.00-----1.00------------------
....................................................TCCTTCACTAGCTGAGACCTGAGC..............................................................................................................................................................................24161.0061.0010.00-2.00-1.002.007.00----3.007.00----1.00------1.004.004.00-1.00--2.00---1.00----1.00----------------1.00-2.00---------------1.001.002.00--------------1.00-1.00------1.00-2.00---------1.00--------------------------------1.00--------------------------------
.............................................................................................ACAACTCTGCTAGTGGAGAGA........................................................................................................................................21160.0060.0013.004.00-2.00-8.00-2.003.002.00--1.002.00-1.00-1.00---2.00-2.00-------------------1.00------3.001.00-1.00-2.00----1.00---1.00--------1.002.00------1.00-----------------------1.00------------1.00--------------------1.00---------------------------------------
.............................................................................................ACAACTCTGCTAGTGGAGAGAC.......................................................................................................................................22160.0060.0026.007.00-5.002.00--1.001.00-------2.00-1.004.00-1.00-1.00----3.00-------------1.00----------1.00------1.00--------------------------------------------------------1.00-----------1.00--1.00----------------------------------------------
....................................................TCCTTCACTAGCTGAGACCT..................................................................................................................................................................................20153.0053.00-----1.00----12.00---11.00-----9.00--------7.00----------------3.00-2.00---------1.00------2.00--------------2.00----1.00-----------1.00-----------1.00---------------------------------------------------------------------
....................................................TCCTTCACTAGCTGAGACCTGAG...............................................................................................................................................................................23136.0036.003.00---1.001.007.00-1.00-1.00-3.001.001.00--2.00-3.00-1.002.00--1.001.00---1.00-----1.00----------1.001.00-----------------------------------------1.00---------1.00---1.00--------------------------------------------------------------------------
............................................................................................AACAACTCTGCTAGTGGAGAGT........................................................................................................................................22135.0031.005.006.00-----2.00-3.00---2.00-2.002.00---------1.00-----1.00-1.00--------1.001.00------------------4.001.00-------------1.00------------1.00----------------------------------------------------------------1.00----------------------
............................................................................................AACAACTCTGCTAGTGGAGAG.........................................................................................................................................21131.0031.002.001.00-1.00---2.00-3.00-----4.00-----1.00-----4.00------2.00---1.001.00---1.00------------------------1.00----2.00---------2.00--------------------------1.00-----1.00----1.00---------------------------------------------------------
.............................................................................................ACAACTCTGCTAGTGGAGAGACT......................................................................................................................................23125.0060.002.00--4.004.00------5.00----1.00--1.00----2.00---2.00--1.00---1.00---------------------------------------------------------------------------1.00------------------------------------------------------1.00------------
.....................................................CCTTCACTAGCTGAGACCT..................................................................................................................................................................................19125.0025.00----------3.00---2.00-----3.00--------1.00----------------1.00-2.00---------1.00------1.00------2.00------------1.00---2.00-------1.00--------1.00--1.00---------1.00-------------------------1.00--------------------------------1.00
.....................................................CCTTCACTAGCTGAGACCTGAG...............................................................................................................................................................................22118.0018.00-----2.00----1.00-------1.00---2.00-------1.00-----1.00----2.00-------2.00--------1.00-----------------------------1.00-------------------1.00-------------1.00-------------------------1.00--------------------1.00---------
............................................................................................AACAACTCTGCTAGTGGAGA..........................................................................................................................................20116.0016.001.004.00------1.00------------1.00-1.00--------1.00----------------1.00----------1.00-----1.00-1.00---------------------1.00--------1.00---------------------------1.00---------------------------------------------------
............................................................................................AACAACTCTGCTAGTGGAGAGAC.......................................................................................................................................23115.0015.006.001.00-1.001.00---1.00-------1.00-----------1.00------1.00----1.00----------------------------------------------------------------------------------------------------1.00-------------------------------------
..............................................................................................CAACTCTGCTAGTGGAGAGAC.......................................................................................................................................21115.0015.008.001.00-1.00----1.00-------------------1.00----------------------1.00-------1.00---------------------------------------------------------------1.00-------------------------------------------------------
.............................................................................................ACAACTCTGCTAGTGGAGAGT........................................................................................................................................21114.003.006.002.00----------------1.00--1.00--------------------------------2.00-----------------------1.00------------1.00---------------------------------------------------------------------------------------
....................................................TCCTTCACTAGCTGAGACCTGAGA..............................................................................................................................................................................24112.0036.001.00--1.001.00-----1.00------------------1.00-------------------1.00------4.00----------1.00----------------------------------------------------------------------1.00----------------------------------------
....................................................TCCTTCACTAGCTGAGACCTG.................................................................................................................................................................................21111.0011.001.00-----------------------------------------1.00---1.001.00---1.00---1.00-1.00----------------------1.00-1.00------------------1.00---------------------------------------------------------------------1.00-------
.............................................................................................ACAACTCTGCTAGTGGAGAGACA......................................................................................................................................23111.0060.00---4.001.00------1.00-------1.00--------------------2.00-------------------------------1.00--------------------1.00-------------------------------------------------------------------------------------
....................................................TCCTTCACTAGCTGAGACCTGAGT..............................................................................................................................................................................24111.0036.002.00-------2.00---1.00-1.00-----------1.00---1.00-----3.00----------------------------------------------------------------------------------------------------------------------------------------------
.....................................................CCTTCACTAGCTGAGACCTGAGCT.............................................................................................................................................................................24110.0010.001.00--1.001.00-7.00----------------------------------------------------------------------------------------------------------------------------------------------------------------------------
....................................................TCCTTCACTAGCTGAGACCTGAGCT.............................................................................................................................................................................2519.009.001.00---2.00------1.00------------------------------------------1.00---------------------1.00----------------------1.00--------------2.00----------------------------------------------------------------
............................................................................................AACAACTCTGCTAGTGGA............................................................................................................................................1818.008.00----------------2.00-1.00----1.00--------------------------------------2.00------2.00-------------------------------------------------------------------------------------------------------------
............................................................................................AACAACTCTGCTAGTGGAGAGC........................................................................................................................................2218.0031.005.00-------1.00-------------------------1.00--------------------1.00---------------------------------------------------------------------------------------------------------------------------
.....................................................CCTTCACTAGCTGAGACCTGA................................................................................................................................................................................2118.008.002.00---2.00------------------1.00---------------------------------------------------1.00-----------------------------------1.00-----------------------1.00-------------------------------------------
.....................................................CCTTCACTAGCTGAGACCTGAGT..............................................................................................................................................................................2317.0018.001.00----1.00------2.00---------------------------------------------1.00-----------------1.00---------------------------------------------------------------------------------------------------1.00--
............................................................................................AACAACTCTGCTAGTGGAG...........................................................................................................................................1917.007.001.001.00---1.00-1.00---------------1.00-----------------------------1.00-----------------1.00-----------------------------------------------------------------------------------------------------------
............................................................................................AACAACTCTGCTAGTGGAGAGACA......................................................................................................................................2415.0015.001.00--3.00----1.00--------------------------------------------------------------------------------------------------------------------------------------------------------------------------
.........................................................................................TGCAACAACTCTGCTAGTGGAGAGA........................................................................................................................................2515.005.00--4.00----------------------------------------------------------1.00---------------------------------------------------------------------------------------------------------------------
..............................................................................................CAACTCTGCTAGTGGAGAGACT......................................................................................................................................2215.0015.001.00--1.00-------1.00------------1.00-----1.00----------------------------------------------------------------------------------------------------------------------------------------------------
............................................................................................AACAACTCTGCTAGTGGAGAGACT......................................................................................................................................2414.0015.002.00--1.00--------------------1.00----------------------------------------------------------------------------------------------------------------------------------------------------------
..............................................................................................CAACTCTGCTAGTGGAGACC........................................................................................................................................204.000.004.00----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
....................................................TCCTTCACTAGCTGAGACCTGAGCTTGT..........................................................................................................................................................................2814.001.00----------------------------------------------------------------------4.00------------------------------------------------------------------------------------------------------------
..................................................................................................................................................................................TCTCTGTTCTCTTTGAATATAG..................................................2213.003.00--------------------------1.00-------------------------2.00------------------------------------------------------------------------------------------------------------------------------
....................................................TCCTTCACTAGCTGAGACCTGAAT..............................................................................................................................................................................2413.00109.003.00----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
..............................................................................................CAACTCTGCTAGTGGAGAGACC......................................................................................................................................2213.003.003.00----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
.............................................................................................ACAACTCTGCTAGTGGAGAG.........................................................................................................................................2013.003.00-1.00--------------1.00-----------------------------------------------------------------------------------------------------------------------1.00------------------------------------------
....................................................TCCTTCACTAGCTGAGACCTGAGCTT............................................................................................................................................................................2613.003.00-----1.00------------------------------------------------------------1.00----------------------------------------------1.00-----------------------------------------------------------------
....................................................TCCTTCACTAGCTGAGACCTGAT...............................................................................................................................................................................2313.00109.00------------------------1.00-----------------------------------------2.00----------------------------------------------------------------------------------------------------------------
.............................................................................................ACAACTCTGCTAGTGGAGAGACC......................................................................................................................................2313.003.003.00----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
..............................................................................................................................................................CTATAAAAGTAGGTGATGT.........................................................................1913.003.00----------------------------------------------------3.00------------------------------------------------------------------------------------------------------------------------------
.....................................................CCTTCACTAGCTGAGACCTGAGTT.............................................................................................................................................................................2413.0018.00----1.00-------------------------2.00----------------------------------------------------------------------------------------------------------------------------------------------------
.....................................................CCTTCACTAGCTGAGACCTGAGA..............................................................................................................................................................................2312.0018.00-----1.00---------------------------------------------------------------------------------------1.00-------------------------------------------------------------------------------------
.........................................................................................................................................................................GGTGATGTTTCTCTGTTCTCTTTGAATATA...................................................3012.002.00--------2.00--------------------------------------------------------------------------------------------------------------------------------------------------------------------------
....................................................TCCTTCACTAGCTGAGACCTGT................................................................................................................................................................................2212.0011.00-------------2.00---------------------------------------------------------------------------------------------------------------------------------------------------------------------
.............................................................................................ACAACTCTGCTAGTGGA............................................................................................................................................1712.002.00-------------2.00---------------------------------------------------------------------------------------------------------------------------------------------------------------------
..............................................................................................CAACTCTGCTAGTGGAGAGACA......................................................................................................................................2212.0015.00-----------1.00-------------------1.00---------------------------------------------------------------------------------------------------------------------------------------------------
............................................................................................AACAACTCTGCTAGTGGAGAGG........................................................................................................................................2212.0031.001.001.00---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
...........................................................................................CAACAACTCTGCTAGTGGAGAGA........................................................................................................................................2312.002.00-----------------------------------------------------------------------1.00------------------------------------------------------------------------------1.00----------------------------
.........................................................................................TGCAACAACTCTGCTAGTGGAG...........................................................................................................................................2212.002.00-1.00------------------------------------------------------------------1.00--------------------------------------------------------------------------------------------------------------
......................................................CTTCACTAGCTGAGACCTGAG...............................................................................................................................................................................2112.002.00-----------------------------------------------1.00-------------------1.00---------------------------------------------------------------------------------------------------------------
....................................................TCCTTCACTAGCTGAGACCTGAAA..............................................................................................................................................................................2412.00109.00-----------------------------------------------1.00-------------------1.00---------------------------------------------------------------------------------------------------------------
....................................................TCCTTCACTAGCTGAGAC....................................................................................................................................................................................1812.002.00----------1.00------------------------------------------------------1.00-----------------------------------------------------------------------------------------------------------------
.............................................................................................ACAACTCTGCTAGTGGAGAGACG......................................................................................................................................2312.0060.00-1.00--------------------------1.00------------------------------------------------------------------------------------------------------------------------------------------------------
.............................................................................................ACAACTCTGCTAGTGGAGAGC........................................................................................................................................2112.003.002.00----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
.........................................................................................................................................................................................................................TGAATACCACTTTAAAAACAGAATG........2512.002.00--------------------------------------------------------------------------------------------------------------------------------------------------------------------1.00-------1.00------
.............................................................................................ACAACTCTGCTAGTGGAGA..........................................................................................................................................1912.002.00---------2.00-------------------------------------------------------------------------------------------------------------------------------------------------------------------------
....................................................TCCTTCACTAGCTGAGACCTGAGCTTGGCCA.......................................................................................................................................................................3112.002.00------------------------------------------------------------------------------------------------------------------------1.00-------------------------------------1.00--------------------
.....................................................CCTTCACTAGCTGAGACCTGAGCTA............................................................................................................................................................................2512.0010.00------2.00----------------------------------------------------------------------------------------------------------------------------------------------------------------------------
.......................................................................................................................................................................................................................AATGAATACCACTTTAAAAACAGAAT.........2611.001.00-----------1.00-----------------------------------------------------------------------------------------------------------------------------------------------------------------------
....................................................TCCTTCACTAGCTGAGA.....................................................................................................................................................................................1711.001.00------------------------------------1.00----------------------------------------------------------------------------------------------------------------------------------------------
.......................................................................................................................................................................................................GGCTTTCAATCCTGATAATGAA.............................2211.001.00----1.00------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
....................................................TCCTTCACTAGCTGAGACCTGAGCTTG...........................................................................................................................................................................2711.001.00---------------------------------------------------------------------------------------------------------------------------------------------------------------1.00-------------------
.....................................................CCTTCACTAGCTGAGACCTGAGCAA............................................................................................................................................................................2511.0084.00-----------------------------------------------------------------------------------------------------------------------------------------------------------------------1.00-----------
.............................................................................................ACAACTCTGCTAGTGGAGAGACGT.....................................................................................................................................2411.0060.00-1.00---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
.....................................................CCTTCACTAGCTGAGACCTGAGTCA............................................................................................................................................................................2511.0018.00-------------------------------------1.00---------------------------------------------------------------------------------------------------------------------------------------------
.........................................................................................TGCAACAACTCTGCTAGTGGA............................................................................................................................................2111.001.001.00----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
....................................................TCCTTCACTAGCTGAGACCTGAGTA.............................................................................................................................................................................2511.0036.00-------------------------------------1.00---------------------------------------------------------------------------------------------------------------------------------------------
....................................................TCCTTCACTAGCTGAGACCTGAGCA.............................................................................................................................................................................2511.0061.00------------1.00----------------------------------------------------------------------------------------------------------------------------------------------------------------------
............................................................................TTGGCCAGTGTGCTGCAACAACTCTGCTAG................................................................................................................................................3011.001.00-----------------------------------------------------------------------------------------------------------------------------------------------------------1.00-----------------------
............................................................................................AACAACTCTGCTAGTGGAGACC........................................................................................................................................2211.0016.001.00----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
.........................................................................................TGCAACAACTCTGCTAGTGGAGACC........................................................................................................................................2511.001.001.00----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
.........................................................................................TGCAACAACTCTGCTAGTGGAGAG.........................................................................................................................................2411.001.001.00----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
....................................................TCCTTCACTAGCTGAGACCTGAGCTA............................................................................................................................................................................2611.009.00------------------------1.00----------------------------------------------------------------------------------------------------------------------------------------------------------
............................................................................................AACAACTCTGCTAGTGGAGAGATTTA....................................................................................................................................2611.00157.00---------------1.00-------------------------------------------------------------------------------------------------------------------------------------------------------------------
....................................................TCCTTCACTAGCTGAGACC...................................................................................................................................................................................1911.001.00-------------------------------------------------------------------------------------------------------------------------------------------------------------------1.00---------------
....................................................TCCTTCACTAGCTGAGACCTGAGCTTGGC.........................................................................................................................................................................2911.001.00-----------------------------------------------------------------------------------------------------------------------------------------1.00-----------------------------------------
............................................................................................AACAACTCTGCTAGTGGAGAGAT.......................................................................................................................................2311.00157.00-------1.00---------------------------------------------------------------------------------------------------------------------------------------------------------------------------
.............................................................................................ACAACTCTGCTAGTGGAGACC........................................................................................................................................2111.002.001.00----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
...................................................CTCCTTCACTAGCTGAGACCTGA................................................................................................................................................................................2311.001.00----------------------------------------------------------------------------------------------------------------------------1.00------------------------------------------------------
.........................................................................................TGCAACAACTCTGCTAGTGGAGAGC........................................................................................................................................2511.001.001.00----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
............................................................................................AACAACTCTGCTAGTGGAGCGA........................................................................................................................................2211.007.00----------------------------------1.00------------------------------------------------------------------------------------------------------------------------------------------------
......................................................................................................................................................................................................................................AAAAACAGAATGAAAGTGT.1911.001.00-------------------------------1.00---------------------------------------------------------------------------------------------------------------------------------------------------
.........................................................................................TGCAACAACTCTGCTAGTGGAGAGT........................................................................................................................................2511.001.001.00----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
............................................................................................AACAACTCTGCTAGTGGAGACCAT......................................................................................................................................2411.0016.00-1.00---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
..............................................................................................CAACTCTGCTAGTGGAGAGACGA.....................................................................................................................................2311.0015.00--------------------------------1.00--------------------------------------------------------------------------------------------------------------------------------------------------
............................................................................................AACAACTCTGCTAGTGGAAAGA........................................................................................................................................2211.008.001.00----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
...................................................................................................................CAAAGGCTGGATTTTTACCTTCTTT..............................................................................................................2511.001.00-------------------------------------1.00---------------------------------------------------------------------------------------------------------------------------------------------
..............................................................................................CAACTCTGCTAGTGGAGAGA........................................................................................................................................2011.001.00---------1.00-------------------------------------------------------------------------------------------------------------------------------------------------------------------------
............................................................................................AACAACTCTGCTAGTGGG............................................................................................................................................181.000.00-------------------------------1.00---------------------------------------------------------------------------------------------------------------------------------------------------
................................................................................................ACTCTGCTAGTGGAGAGA........................................................................................................................................1811.001.00------------------------------------------------------------1.00----------------------------------------------------------------------------------------------------------------------
............................................................................................AACAACTCTGCTAGTGGAGAGAAA......................................................................................................................................2411.00157.00-----------------------------------------------------------------------------------------------------------1.00-----------------------------------------------------------------------
.....................................................CCTTCACTAGCTGAGACCTGAGCAGA...........................................................................................................................................................................2611.0084.00-----------1.00-----------------------------------------------------------------------------------------------------------------------------------------------------------------------
....................................................TCCTTCACTAGCTGATA.....................................................................................................................................................................................171.000.00------------------------------------1.00----------------------------------------------------------------------------------------------------------------------------------------------
....................................................TCCTTCACTAGCTGAGACCTGCG...............................................................................................................................................................................2311.0011.00---------------------------------------------------------------------------------------------------------1.00-------------------------------------------------------------------------
....................................................TCCTTCACTAGCTGAGACCTGAGCTTGGCC........................................................................................................................................................................3011.001.00--------------------------------------------------------------------------------------1.00--------------------------------------------------------------------------------------------
.....................................................CCTTCACTAGCTGAGACTT..................................................................................................................................................................................191.000.00----------1.00------------------------------------------------------------------------------------------------------------------------------------------------------------------------
....................................................TCCTTCACTAGCTGAGACCTGAAG..............................................................................................................................................................................2411.00109.00---------------------------------------------------------------------------1.00-------------------------------------------------------------------------------------------------------
......................................................CTTCACTAGCTGAGACCTGAGT..............................................................................................................................................................................2211.002.00----------------------------------------------------------------------------------------------------1.00------------------------------------------------------------------------------
............................................................................................AACAACTCTGCTAGTGGAGTGT........................................................................................................................................2211.007.00-1.00---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
....................................................TCCTTCACTAGCTGAGACCTGCGT..............................................................................................................................................................................2411.0011.00--------------------------------------------------------------------------------------------1.00--------------------------------------------------------------------------------------
...............................................................................................................................................................................................................ATCCTGATAATGAATACCACTTTAA..................2511.001.00-------------------------------------------------------------------------------------------------------------------------------------1.00---------------------------------------------
.....................................................CCTTCACTAGCTGAGACC...................................................................................................................................................................................1811.001.00--------------1.00--------------------------------------------------------------------------------------------------------------------------------------------------------------------
.........................................................................................TGCAACAACTCTGCTAGTGGAGA..........................................................................................................................................2311.001.001.00----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
............................................................................................AACAACTCTGCTAGTGGAGAA.........................................................................................................................................2111.0016.00-------1.00---------------------------------------------------------------------------------------------------------------------------------------------------------------------------
.............................................................................................ACAACTCTGCTAGTGGAGAGCC.......................................................................................................................................2211.003.00---------------------------------------------------------------------------------------------------------------------1.00-------------------------------------------------------------
.....................................................CCTTCACTAGCTGAGACCTGAGCA.............................................................................................................................................................................2411.0084.001.00----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
....................................................TCCTTCACTAGCTGAGACGTGA................................................................................................................................................................................2211.002.001.00----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
.........................................................................................................................................................................................TCTCTTTGAATATAGCAT...............................................181.000.00---1.00-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
....................................................TCCTTCACTAGCTGAGACCTGAGCGTAG..........................................................................................................................................................................2811.0061.00------------------------1.00----------------------------------------------------------------------------------------------------------------------------------------------------------
.............................................................................................ACAACTCTGCTAGTGGAGACCAT......................................................................................................................................2311.002.001.00----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
...........................................................................................CAACAACTCTGCTAGTGGAGAG.........................................................................................................................................2211.001.00---------------------1.00-------------------------------------------------------------------------------------------------------------------------------------------------------------
......................................................................................................................................................................GTAGGTGATGTTTCTCTGTTCTC.............................................................2311.001.00--------------------------1.00--------------------------------------------------------------------------------------------------------------------------------------------------------
............................................................................................AACAACTCTGCTAGTGGAGACA........................................................................................................................................2211.0016.001.00----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
.............................................................................................................................................................................................................CAATCCTGATAATGAATACCACTTT....................2511.001.00------------------------------------------------------------------------------------------------------------1.00----------------------------------------------------------------------
............................................................................................AACAACTCTGCTAGTGGAGAGACG......................................................................................................................................2411.0015.00-----------1.00-----------------------------------------------------------------------------------------------------------------------------------------------------------------------
.....................................................CCTTCACTAGCTGAGAGCT..................................................................................................................................................................................191.000.00-----------------------------------------------------------------------------------------------------------------------------------------------------------------1.00-----------------
....................................................TCCTTCACTAGCTGAGACCTGAGCTTGGCCAGTGTGCTGCAACAACTCTGCTAGTGGAGAGA........................................................................................................................................6211.001.00-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------1.00---
.............................................................................................ACAACTCTGCTAGTGGAG...........................................................................................................................................1811.001.00------1.00----------------------------------------------------------------------------------------------------------------------------------------------------------------------------
..............................................................................................CAACTCTGCTAGTGGAGACCAT......................................................................................................................................221.000.00-------------------------------------------------------------1.00---------------------------------------------------------------------------------------------------------------------
.....TAGTGTGGACACTCGCAGGGCAGAGGAATA.......................................................................................................................................................................................................................3011.001.00--------1.00--------------------------------------------------------------------------------------------------------------------------------------------------------------------------
.............................................................................................ACAACTCTGCTAGTGGAGGGA........................................................................................................................................2111.001.001.00----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
.........................................................................................TGCAACAACTCTGCTAGTGGAGCGA........................................................................................................................................2511.002.00--1.00--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
................................................................................................ACTCTGCTAGTGGAGAG.........................................................................................................................................1740.250.25-------------0.25---------------------------------------------------------------------------------------------------------------------------------------------------------------------
...........................................................CTAGCTGAGACCTGA................................................................................................................................................................................1590.110.11-----------------------0.11-----------------------------------------------------------------------------------------------------------------------------------------------------------

Antisense strand
TCCCATAGTGTGGACACTCGCAGGGCAGAGGAATATCATGCCAGCCCTTGGCTCCTTCACTAGCTGAGACCTGAGCTTGGCCAGTGTGCTGCAACAACTCTGCTAGTGGAGAGACCAAAGGCTGGATTTTTACCTTCTTTTCTTATGCTAATATGTTGCTATAAAAGTAGGTGATGTTTCTCTGTTCTCTTTGAATATAGGCTTTCAATCCTGATAATGAATACCACTTTAAAAACAGAATGAAAGTGTC
...................................................((.((((((((((.(((..(((.((...))))).((......))..))).)))))))))))).........................................................................................................................................
..................................................51.................................................................118..................................................................................................................................
SizePerfect hitTotal NormPerfect NormSRR546155(SRX180174)
Global profiling of miRNA and the hairpin pre. (ago2 Neuroblastoma)		SRR346424(SRX098266)
Global profiling of miRNA and the hairpin pre. (Neuroblastoma)		SRR390297(GSM849855)
cell line: NIH-3T3cell type: fibroblastip ant. (fibroblast)		SRR391853(GSM852148)
gender: femalegenotype/variation: ADAR2-/-/AD. (embryo)		SRR391852(GSM852147)
gender: femalegenotype/variation: ADAR2-/-tis. (embryo)		SRR402762(SRX117945)
source: ES E14 male cells. (ESC)		SRR390300(GSM849858)
cell line: NIH-3T3cell type: fibroblastinfect. (ago2 fibroblast)		SRR039185(GSM485325)
shLuc.1309;ROSA-rtTA (-dox). (fibroblast)		SRR553602(SRX182808)
source: Sertoli cells. (Sertoli cells)		SRR039186(GSM485326)
shLuc.1309;ROSA-rtTA (+dox). (fibroblast)		SRR042458(GSM539850)
mouse basophil cells [09-002]. (b cell)		SRR391851(GSM852146)
gender: femalegenotype/variation: wild typeti. (embryo)		SRR390299(GSM849857)
cell line: NIH-3T3cell type: fibroblastip ant. (ago2 fibroblast)		SRR306531(GSM750574)
19-24nt. (ago2 brain)		SRR042469(GSM539861)
mouse Th2 cells [09-002]. (lymph)		SRR039184(GSM485324)
shLuc.1309 (+dox). (fibroblast)		SRR346425(SRX098267)
Global profiling of miRNA and the hairpin pre. (Neuroblastoma)		SRR402766(SRX117949)
source: ES PGK female cells. (ESC)		SRR039183(GSM485323)
shLuc.1309 (-dox). (fibroblast)		SRR391848(GSM852143)
gender: femalegenotype/variation: wild typeti. (embryo)		SRR042471(GSM539863)
mouse TFHS cells [09-002]. (spleen)		SRR346417(SRX098258)
Global profiling of miRNA and the hairpin pre. (Brain)		SRR279907(GSM689057)
cell type: mouse embryonic stem cellcell line. (ESC)		SRR248526(GSM733814)
cell type: Thy1- spermatogonial stem cellstra. (testes)		SRR391845(GSM852140)
gender: femalegenotype/variation: wild typeti. (embryo)		SRR279904(GSM689054)
cell type: mouse embryonic stem cellcell line. (ESC)		SRR279903(GSM689053)
cell type: mouse embryonic stem cellcell line. (ESC)		mjTestesWT1()
Testes Data. (testes)		SRR391849(GSM852144)
gender: femalegenotype/variation: ADAR2-/-tis. (embryo)		SRR042468(GSM539860)
mouse Th1 cells [09-002]. (lymph)		SRR391847(GSM852142)
gender: femalegenotype/variation: ADAR2-/-/AD. (embryo)		SRR391846(GSM852141)
gender: femalegenotype/variation: ADAR2-/-tis. (embryo)		SRR553582(SRX182788)
source: Brain. (Brain)		mjTestesWT3()
Testes Data. (testes)		SRR037925(GSM510463)
e9p5_rep3. (embryo)		SRR038741(GSM527276)
small RNA-Seq. (brain)		GSM416732(GSM416732)
MEF. (cell line)		SRR073954(GSM629280)
total RNA. (blood)		SRR306530(GSM750573)
19-24nt. (ago2 brain)		SRR038742(GSM527277)
small RNA-Seq. (dgcr8 brain)		SRR037920(GSM510458)
e12p5_rep2. (embryo)		SRR345202(SRX097263)
source: size fractionated RNA from mouse hipp. (brain)		SRR345207(SRX097268)
source: size fractionated RNA from mouse hipp. (brain)		SRR346423(SRX098265)
Global profiling of miRNA and the hairpin pre. (Brain)		SRR346416(SRX098257)
Global profiling of miRNA and the hairpin pre. (Kidney)		SRR402760(SRX117943)
source: ES E14 male cells. (ESC)		SRR042450(GSM539842)
mouse B cells activated in vitro with LPS/IL4 replicate 3 [09-002]. (b cell)		GSM510444(GSM510444)
brain_rep5. (brain)		SRR042487(GSM539879)
mouse BclXL B activated with LPS/IL4 [BalbC] [09-002]. (spleen)		SRR037928(GSM510466)
e7p5_rep2. (embryo)		mjTestesKO8()
Testes Data. (Zcchc11 testes)		SRR402761(SRX117944)
source: ES E14 male cells. (ESC)		SRR279905(GSM689055)
cell type: mouse embryonic stem cellcell line. (ESC)		SRR553585(SRX182791)
source: Kidney. (Kidney)		SRR306535(GSM750578)
19-24nt. (ago2 brain)		SRR306541(GSM750584)
19-24nt. (ago2 brain)		SRR394083(GSM855969)
"background strain: C57BL6/SV129cell type: KR. (cell line)		SRR206940(GSM723281)
other. (brain)		SRR042488(GSM539880)
mouse BclXL germinal center B cells [BalbC] [09-002]. (B cell)		SRR346422(SRX098264)
Global profiling of miRNA and the hairpin pre. (Muscle)		SRR306529(GSM750572)
19-24nt. (ago2 brain)		SRR553583(SRX182789)
source: Cerebellum. (Cerebellum)		SRR345197(SRX097258)
source: size fractionated RNA from mouse hipp. (brain)		mjTestesWT4()
Testes Data. (testes)		SRR038744(GSM527279)
small RNA-Seq. (brain)		SRR042459(GSM539851)
mouse neutrophil cells replicate 1 [09-002]. (blood)		SRR040488(GSM533911)
E18.5 wild type LIVER small RNA. (liver)		SRR042463(GSM539855)
mouse natural killer cells [09-002]. (spleen)		GSM510454(GSM510454)
newborn_rep10. (total RNA)		SRR345201(SRX097262)
source: size fractionated RNA from mouse hipp. (brain)		SRR394084(GSM855970)
"background strain: C57BL6/SV129cell type: KR. (dicer cell line)		SRR039610(GSM527274)
small RNA-Seq. (brain)		SRR042474(GSM539866)
mouse embryonic stem cells [09-002]. (ESC)		GSM510452(GSM510452)
newborn_rep8. (total RNA)		SRR306539(GSM750582)
19-24nt. (ago2 brain)		SRR042448(GSM539840)
mouse B cells activated in vitro with LPS/IL4 replicate 1 [09-002]. (b cell)		SRR039154(GSM471931)
HL1_siSrf2_smallRNAseq. (muscle)		SRR685339(GSM1079783)
"Small RNAs (15-50 nts in length) from immort. (cell line)		SRR306540(GSM750583)
19-24nt. (ago2 brain)		SRR037929(GSM510467)
e7p5_rep3. (embryo)		SRR042449(GSM539841)
mouse B cells activated in vitro with LPS/IL4 replicate 2 [09-002]. (b cell)		SRR306532(GSM750575)
19-24nt. (ago2 brain)		SRR039152(GSM471929)
HL1_siNon_smallRNAseq. (muscle)		GSM510456(GSM510456)
newborn_rep12. (total RNA)		SRR345204(SRX097265)
source: size fractionated RNA from mouse hipp. (brain)		SRR042472(GSM539864)
mouse iTreg cells [09-002]. (lymph)		SRR029037(GSM433289)
18dpp_homo_tdrd6-KO. (tdrd6 testes)		mjTestesKO7()
Testes Data. (Zcchc11 testes)		SRR037927(GSM510465)
e7p5_rep1. (embryo)		SRR042465(GSM539857)
mouse CD4+ T cells (spleen) [09-002]. (spleen)		SRR248527(GSM733815)
cell type: spermatogonial stem cell enriched . (testes)		SRR306537(GSM750580)
19-24nt. (ago2 brain)		SRR023850(GSM307159)
ZHBT-c40hsmallrna_rep1. (cell line)		SRR037922(GSM510460)
e12p5_rep4. (embryo)		SRR345205(SRX097266)
source: size fractionated RNA from mouse hipp. (brain)		SRR029043(GSM433295)
18.5dpc_homo_tdrd1-KO. (tdrd1 testes)		SRR037921(GSM510459)
e12p5_rep3. (embryo)		SRR042447(GSM539839)
mouse mature B cells (spleen) replicate 2 [09-002]. (b cell)		SRR553584(SRX182790)
source: Heart. (Heart)		mjLiverWT3()
Liver Data. (liver)		SRR306534(GSM750577)
19-24nt. (ago2 brain)		Ago2IP504(Rui)
Quantitative functions of Argonaute proteins . (ago2 skin)		SRR248525(GSM733813)
cell type: Thy1- spermatogonial stem cellstra. (testes)		SRR023851(GSM307160)
ZHBT-c412hsmallrna_rep1. (cell line)		SRR059765(GSM562827)
DN3_control. (thymus)		Ago1IP812(Rui)
Quantitative functions of Argonaute proteins . (ago1 skin)		SRR042473(GSM539865)
mouse nTreg cells [09-002]. (lymph)		SRR345203(SRX097264)
source: size fractionated RNA from mouse hipp. (brain)		SRR069809(GSM610965)
small RNA sequencing; sample 1. (testes)		SRR042466(GSM539858)
mouse CD8+ T cells (spleen) [09-002]. (spleen)		SRR306536(GSM750579)
19-24nt. (ago2 brain)		SRR065056(SRR065056)
Tissue-specific Regulation of Mouse MicroRNA . (jejunum)		SRR037919(GSM510457)
e12p5_rep1. (embryo)		SRR014231(GSM319955)
16.5 dpc total. (testes)		SRR685340(GSM1079784)
"Small RNAs (15-50 nts in length) from immort. (dicer cell line)		SRR037906(GSM510442)
brain_rep3. (brain)		SRR037924(GSM510462)
e9p5_rep2. (embryo)		SRR306538(GSM750581)
19-24nt. (ago2 brain)		SRR037905(GSM510441)
brain_rep2. (brain)		SRR042455(GSM539847)
mouse plasma cells [09-002]. (blood)		SRR363959(GSM822761)
AdultSmall RNA Miwi IPread_length: 36. (testes)		GSM510450(GSM510450)
newborn_rep6. (total RNA)		SRR065054(SRR065054)
Tissue-specific Regulation of Mouse MicroRNA . (jejunum)		SRR042467(GSM539859)
mouse T cells activated in vitro with Concanavalin A [09-002]. (spleen)		SRR042478(GSM539870)
mouse lung tissue [09-002]. (lung)		Ago1IP517(Rui)
Quantitative functions of Argonaute proteins . (ago1 skin)		GSM361407(GSM361407)
CGNP_P6_Ptc+-_Ink4c--_rep5. (brain)		GSM640579(GSM640579)
small RNA in the liver with paternal Low pro. (liver)		SRR042456(GSM539848)
mouse hematopoetic progenitor cells [09-002]. (bone marrow)		SRR038745(GSM527280)
small RNA-Seq. (dgcr8 brain)		SRR029123(GSM416611)
NIH3T3. (cell line)		GSM640580(GSM640580)
small RNA in the liver with paternal Low pro. (liver)		SRR553604(SRX182810)
source: Spermatocytes. (Spermatocytes)		SRR065058(SRR065058)
Tissue-specific Regulation of Mouse MicroRNA . (pancreas)		SRR029040(GSM433292)
6w_hetero_tdrd6-KO. (tdrd6 testes)		SRR306542(GSM750585)
19-24nt. (ago2 brain)		SRR306527(GSM750570)
19-24nt. (ago2 brain)		SRR553586(SRX182792)
source: Testis. (testes)		SRR040489(GSM533912)
E18.5 Ago2 catalytically inactive LIVER small RNA. (ago2 liver)		SRR029036(GSM433288)
18dpp_hetero_tdrd6-KO. (tdrd6 testes)		SRR042475(GSM539867)
mouse embryonic fibroblast cells [09-002]. (fibroblast)		GSM519104(GSM519104)
mouse_granulocyte_nuclei_smallRNAs. (cell line)		SRR346419(SRX098260)
Global profiling of miRNA and the hairpin pre. (Lung)		mjTestesKO5()
Testes Data. (Zcchc11 testes)		SRR306544(GSM750587)
19-24nt. (ago2 brain)		SRR042484(GSM539876)
mouse salivary gland tissue [09-002]. (gland)		SRR037930(GSM510468)
e7p5_rep4. (embryo)		GSM361394(GSM361394)
CGNP_P6_wt_rep1. (brain)		SRR248524(GSM733812)
cell type: Thy1+ spermatogonial stem cellstra. (testes)		SRR345199(SRX097260)
source: size fractionated RNA from mouse hipp. (brain)		SRR095853(SRX039174)
"sequencing of miRNA from wild type and disea. (heart)		SRR037923(GSM510461)
e9p5_rep1. (embryo)		GSM510455(GSM510455)
newborn_rep11. (total RNA)		SRR037900(GSM510436)
testes_rep1. (testes)		SRR037912(GSM510449)
newborn_rep5. (total RNA)		SRR095855BC2(SRX039178)
sequencing of miRNA from wild type and diseas. (heart)		SRR023852(GSM307161)
ZHBT-c424hsmallrna_rep1. (cell line)		SRR346414(SRX098255)
Global profiling of miRNA and the hairpin pre. (Spleen)		SRR363958(GSM822760)
Adult-WTSmall RNA Miwi IP. (testes)		SRR029039(GSM433291)
25dpp_homo_tdrd6-KO. (tdrd6 testes)		GSM640578(GSM640578)
small RNA in the liver with paternal control. (liver)		SRR042464(GSM539856)
mouse CD4+CD8+ T cells (thymus) [09-002]. (thymus)		GSM361399(GSM361399)
CGNP_P6_p53--_Ink4c--_rep2. (brain)		SRR345206(SRX097267)
source: size fractionated RNA from mouse hipp. (brain)		SRR346418(SRX098259)
Global profiling of miRNA and the hairpin pre. (Liver)		GSM314552(GSM314552)
ESC wild type (Illumina). (ESC)		SRR095855BC5(SRX039178)
sequencing of miRNA from wild type and diseas. (heart)		SRR042451(GSM539843)
mouse B cells activated in vitro with LPS/aIgD-Dextran [09-002]. (b cell)		SRR206942(GSM723283)
other. (brain)		GSM475281(GSM475281)
total RNA. (testes)		SRR391850(GSM852145)
gender: femalegenotype/variation: ADAR2-/-/AD. (embryo)		mjLiverKO1()
Liver Data. (Zcchc11 liver)		SRR346415(SRX098256)
source: Testis. (Testes)		SRR206941(GSM723282)
other. (brain)		SRR038740(GSM527275)
small RNA-Seq. (dicer brain)		SRR346421(SRX098263)
Global profiling of miRNA and the hairpin pre. (mixture)		Ago2IP517(Rui)
Quantitative functions of Argonaute proteins . (ago2 skin)		GSM361415(GSM361415)
WholeCerebellum_P6_p53--_Ink4c--_rep4. (brain)		SRR042460(GSM539852)
mouse neutrophil cells replicate 2 [09-002]. (blood)
.............................................................................................ACAACTCTGCTAGTGGAGAGA........................................................................................................................................ 2112.002.00------------------------------------------------------------------------------------------------------------------------------1.00--------------------------------------------------1.00-
............................................................................................AACAACTCTGCTAGTGGAGAGAC....................................................................................................................................... 2312.002.00---------------------------------------------------------------------------------------------------------------------------------------------------1.00--------------1.00----------------
.................................................................................................................................................................................TTCTCTGTTCTCTTTGCC....................................................... 181.000.00-------------------------1.00---------------------------------------------------------------------------------------------------------------------------------------------------------