ID: uc008mja.5
GENE: Vps16(6)
chr2:130264371-130264568+


(13)
AGO2.ip 		(1)
AGO3.ip 		(13)
B-CELL 		(26)
BRAIN 		(3)
CELL-LINE 		(2)
DCR.mut 		(1)
DGCR8.mut 		(9)
EMBRYO 		(7)
ESC 		(5)
FIBROBLAST 		(1)
HEART 		(2)
KIDNEY 		(4)
LIVER 		(2)
LUNG 		(5)
LYMPH 		(22)
OTHER 		(7)
OTHER.mut 		(1)
OVARY 		(1)
PIWI.ip 		(3)
PIWI.mut 		(3)
SKIN 		(8)
SPLEEN 		(23)
TESTES 		(1)
THYMUS 		(3)
TOTAL-RNA 		(3)
UTERUS

Sense strand
CTGTAGGACCCGATCTTTACCTTCTGGATCATGCTACCTGCTCTGCAGTGGTGAGAACCTAAGTGGGAATGAAATGGAAGGGCTGGTCAACAAGTAGGAAGGCATTGAGAAGTCAGTTTATCTGGTTTCCTCCTTGGTCCTGCCCCAGACACCTGCTGGCTTAGCCCCAGGAGTGAGCAGCTTCCTACAGATGGCTGT
...............................................................................((((.((....((((.((((((.((...(((......)))...)).)))))).))))..)).)))).....................................................
........................................................................73.........................................................................148................................................
SizePerfect hitTotal NormPerfect NormSRR546155(SRX180174)
Global profiling of miRNA and the hairpin pre. (ago2 Neuroblastoma)		SRR553602(SRX182808)
source: Sertoli cells. (Sertoli cells)		SRR553583(SRX182789)
source: Cerebellum. (Cerebellum)		SRR553582(SRX182788)
source: Brain. (Brain)		SRR346425(SRX098267)
Global profiling of miRNA and the hairpin pre. (Neuroblastoma)		SRR042469(GSM539861)
mouse Th2 cells [09-002]. (lymph)		SRR346424(SRX098266)
Global profiling of miRNA and the hairpin pre. (Neuroblastoma)		mjTestesWT4()
Testes Data. (testes)		SRR402760(SRX117943)
source: ES E14 male cells. (ESC)		SRR042470(GSM539862)
mouse Th17 cells [09-002]. (lymph)		SRR042447(GSM539839)
mouse mature B cells (spleen) replicate 2 [09-002]. (b cell)		SRR042471(GSM539863)
mouse TFHS cells [09-002]. (spleen)		SRR346423(SRX098265)
Global profiling of miRNA and the hairpin pre. (Brain)		SRR402762(SRX117945)
source: ES E14 male cells. (ESC)		mjTestesWT3()
Testes Data. (testes)		SRR345207(SRX097268)
source: size fractionated RNA from mouse hipp. (brain)		SRR042468(GSM539860)
mouse Th1 cells [09-002]. (lymph)		mjTestesWT1()
Testes Data. (testes)		SRR042446(GSM539838)
mouse mature B cells (spleen) replicate 1 [09-002]. (b cell)		SRR042458(GSM539850)
mouse basophil cells [09-002]. (b cell)		SRR042454(GSM539846)
mouse germinal center B cells (lymph node) [09-002]. (b cell)		SRR346421(SRX098263)
Global profiling of miRNA and the hairpin pre. (mixture)		SRR042472(GSM539864)
mouse iTreg cells [09-002]. (lymph)		mjLiverWT3()
Liver Data. (liver)		SRR042450(GSM539842)
mouse B cells activated in vitro with LPS/IL4 replicate 3 [09-002]. (b cell)		SRR346417(SRX098258)
Global profiling of miRNA and the hairpin pre. (Brain)		SRR279907(GSM689057)
cell type: mouse embryonic stem cellcell line. (ESC)		SRR042459(GSM539851)
mouse neutrophil cells replicate 1 [09-002]. (blood)		SRR394084(GSM855970)
"background strain: C57BL6/SV129cell type: KR. (dicer cell line)		SRR248523(GSM733811)
cell type: Thy1+ spermatogonial stem cellstra. (testes)		SRR042456(GSM539848)
mouse hematopoetic progenitor cells [09-002]. (bone marrow)		SRR248526(GSM733814)
cell type: Thy1- spermatogonial stem cellstra. (testes)		SRR039154(GSM471931)
HL1_siSrf2_smallRNAseq. (muscle)		SRR248524(GSM733812)
cell type: Thy1+ spermatogonial stem cellstra. (testes)		SRR042443(GSM539835)
mouse pro B cells [09-002]. (b cell)		SRR390300(GSM849858)
cell line: NIH-3T3cell type: fibroblastinfect. (ago2 fibroblast)		SRR391847(GSM852142)
gender: femalegenotype/variation: ADAR2-/-/AD. (embryo)		SRR042477(GSM539869)
mouse brain tissue [09-002]. (brain)		SRR042448(GSM539840)
mouse B cells activated in vitro with LPS/IL4 replicate 1 [09-002]. (b cell)		SRR345205(SRX097266)
source: size fractionated RNA from mouse hipp. (brain)		SRR248525(GSM733813)
cell type: Thy1- spermatogonial stem cellstra. (testes)		SRR059769(GSM562831)
Treg_Drosha. (spleen)		GSM510444(GSM510444)
brain_rep5. (brain)		SRR042449(GSM539841)
mouse B cells activated in vitro with LPS/IL4 replicate 2 [09-002]. (b cell)		SRR391851(GSM852146)
gender: femalegenotype/variation: wild typeti. (embryo)		mjTestesKO8()
Testes Data. (Zcchc11 testes)		SRR042457(GSM539849)
mouse mast cells [09-002]. (bone marrow)		SRR042451(GSM539843)
mouse B cells activated in vitro with LPS/aIgD-Dextran [09-002]. (b cell)		SRR345204(SRX097265)
source: size fractionated RNA from mouse hipp. (brain)		SRR042467(GSM539859)
mouse T cells activated in vitro with Concanavalin A [09-002]. (spleen)		SRR042478(GSM539870)
mouse lung tissue [09-002]. (lung)		SRR042444(GSM539836)
mouse pre B cells [09-002]. (b cell)		SRR042453(GSM539845)
mouse marginal zone B cells (spleen) [09-002]. (b cell)		SRR248527(GSM733815)
cell type: spermatogonial stem cell enriched . (testes)		SRR279904(GSM689054)
cell type: mouse embryonic stem cellcell line. (ESC)		SRR042488(GSM539880)
mouse BclXL germinal center B cells [BalbC] [09-002]. (B cell)		SRR390299(GSM849857)
cell line: NIH-3T3cell type: fibroblastip ant. (ago2 fibroblast)		SRR391846(GSM852141)
gender: femalegenotype/variation: ADAR2-/-tis. (embryo)		SRR391848(GSM852143)
gender: femalegenotype/variation: wild typeti. (embryo)		SRR391853(GSM852148)
gender: femalegenotype/variation: ADAR2-/-/AD. (embryo)		SRR346414(SRX098255)
Global profiling of miRNA and the hairpin pre. (Spleen)		SRR032477(GSM485235)
sRNA_activation_deep_sequencing. (uterus)		SRR029037(GSM433289)
18dpp_homo_tdrd6-KO. (tdrd6 testes)		SRR345196(SRX097257)
source: size fractionated RNA from mouse hipp. (brain)		SRR402766(SRX117949)
source: ES PGK female cells. (ESC)		SRR345202(SRX097263)
source: size fractionated RNA from mouse hipp. (brain)		SRR028732(GSM400969)
Mili-Tdrd1 KO associated. (mili testes)		SRR279906(GSM689056)
cell type: mouse embryonic stem cellcell line. (ESC)		GSM475280(GSM475280)
Mili-IP. (mili testes)		Ago3IP805(Rui)
Quantitative functions of Argonaute proteins . (ago3 skin)		SRR553586(SRX182792)
source: Testis. (testes)		SRR042475(GSM539867)
mouse embryonic fibroblast cells [09-002]. (fibroblast)		SRR306540(GSM750583)
19-24nt. (ago2 brain)		SRR042487(GSM539879)
mouse BclXL B activated with LPS/IL4 [BalbC] [09-002]. (spleen)		SRR042473(GSM539865)
mouse nTreg cells [09-002]. (lymph)		SRR345203(SRX097264)
source: size fractionated RNA from mouse hipp. (brain)		SRR038742(GSM527277)
small RNA-Seq. (dgcr8 brain)		SRR042483(GSM539875)
mouse muscle tissue [09-002]. (muscle)		SRR069809(GSM610965)
small RNA sequencing; sample 1. (testes)		SRR042462(GSM539854)
mouse macrophages [09-002]. (bone marrow)		SRR402761(SRX117944)
source: ES E14 male cells. (ESC)		SRR042466(GSM539858)
mouse CD8+ T cells (spleen) [09-002]. (spleen)		SRR039152(GSM471929)
HL1_siNon_smallRNAseq. (muscle)		SRR042463(GSM539855)
mouse natural killer cells [09-002]. (spleen)		SRR073955(GSM629281)
total RNA. (blood)		SRR553585(SRX182791)
source: Kidney. (Kidney)		mjLiverKO3()
Liver Data. (Zcchc11 liver)		SRR042461(GSM539853)
mouse dendritic cells [09-002]. (bone marrow)		SRR042460(GSM539852)
mouse neutrophil cells replicate 2 [09-002]. (blood)		SRR306541(GSM750584)
19-24nt. (ago2 brain)		SRR042455(GSM539847)
mouse plasma cells [09-002]. (blood)		SRR065052(SRR065052)
Tissue-specific Regulation of Mouse MicroRNA . (jejunum)		GSM509280(GSM509280)
small RNA cloning by length. (testes)		SRR391845(GSM852140)
gender: femalegenotype/variation: wild typeti. (embryo)		mjTestesKO7()
Testes Data. (Zcchc11 testes)		SRR306539(GSM750582)
19-24nt. (ago2 brain)		SRR042465(GSM539857)
mouse CD4+ T cells (spleen) [09-002]. (spleen)		SRR023848(GSM307157)
mEFsmallrna_rep1. (cell line)		SRR038743(GSM527278)
small RNA-Seq. (dicer brain)		SRR391849(GSM852144)
gender: femalegenotype/variation: ADAR2-/-tis. (embryo)		SRR206940(GSM723281)
other. (brain)		SRR306537(GSM750580)
19-24nt. (ago2 brain)		SRR306533(GSM750576)
19-24nt. (ago2 brain)		SRR391852(GSM852147)
gender: femalegenotype/variation: ADAR2-/-tis. (embryo)		SRR553604(SRX182810)
source: Spermatocytes. (Spermatocytes)		SRR037921(GSM510459)
e12p5_rep3. (embryo)		SRR206939(GSM723280)
other. (brain)		SRR037914(GSM510451)
newborn_rep7. (total RNA)		SRR073954(GSM629280)
total RNA. (blood)		SRR346416(SRX098257)
Global profiling of miRNA and the hairpin pre. (Kidney)		SRR039186(GSM485326)
shLuc.1309;ROSA-rtTA (+dox). (fibroblast)		SRR553584(SRX182790)
source: Heart. (Heart)		Ago2IP504(Rui)
Quantitative functions of Argonaute proteins . (ago2 skin)		SRR685339(GSM1079783)
"Small RNAs (15-50 nts in length) from immort. (cell line)		SRR029036(GSM433288)
18dpp_hetero_tdrd6-KO. (tdrd6 testes)		SRR032476(GSM485234)
sRNA_delayed_deep_sequencing. (uterus)		SRR060845(GSM561991)
total RNA. (brain)		SRR038741(GSM527276)
small RNA-Seq. (brain)		SRR346422(SRX098264)
Global profiling of miRNA and the hairpin pre. (Muscle)		SRR039183(GSM485323)
shLuc.1309 (-dox). (fibroblast)		SRR525242(SRA056111/SRX170318)
Mus musculus domesticus miRNA sequencing. (ago2 Blood)		SRR069810(GSM610966)
small RNA sequencing; sample 2. (testes)		SRR346419(SRX098260)
Global profiling of miRNA and the hairpin pre. (Lung)		mjTestesKO5()
Testes Data. (Zcchc11 testes)		SRR042486(GSM539878)
mouse ovaries [09-002]. (ovary)		GSM509278(GSM509278)
small RNA cloning by length. (piwi testes)		SRR029039(GSM433291)
25dpp_homo_tdrd6-KO. (tdrd6 testes)		SRR038744(GSM527279)
small RNA-Seq. (brain)		SRR042464(GSM539856)
mouse CD4+CD8+ T cells (thymus) [09-002]. (thymus)		GSM510453(GSM510453)
newborn_rep9. (total RNA)		SRR346420(SRX098261)
Global profiling of miRNA and the hairpin pre. (Uterus)		SRR346418(SRX098259)
Global profiling of miRNA and the hairpin pre. (Liver)		GSM509277(GSM509277)
small RNA cloning by length. (piwi testes)		GSM640581(GSM640581)
small RNA in the liver with paternal control. (liver)		SRR014231(GSM319955)
16.5 dpc total. (testes)		SRR206941(GSM723282)
other. (brain)		SRR042445(GSM539837)
mouse immature B cells [09-002]. (b cell)		Ago2IP517(Rui)
Quantitative functions of Argonaute proteins . (ago2 skin)		GSM510456(GSM510456)
newborn_rep12. (total RNA)		SRR306535(GSM750578)
19-24nt. (ago2 brain)		SRR306544(GSM750587)
19-24nt. (ago2 brain)
.............................................................................AAGGGCTGGTCAACAAGTAGGA...................................................................................................221138.00138.0015.0010.007.004.006.003.004.004.001.00-1.00-3.006.001.006.00--1.002.00--2.00-2.002.001.001.00--2.002.001.00-1.00--1.001.003.001.002.001.00-1.001.00-1.004.00--2.001.00-1.00---1.00--2.001.00------2.001.00-1.00-1.002.00-----1.001.00--1.00-1.001.001.00-1.00--1.00-----1.00----1.00---1.001.00-----1.00-1.00-1.00---1.001.00------1.00---1.00----
.............................................................................AAGGGCTGGTCAACAAGTAGG....................................................................................................21181.0081.0018.002.007.004.003.003.001.00--1.00-1.004.001.004.00-1.00---1.00-2.005.00---1.00-1.00-1.00------------1.002.002.00----1.00-1.00----------------------1.001.00---1.00----------1.00--1.001.00----1.00---------------1.00---1.001.00------1.00--------1.001.00-
.............................................................................AAGGGCTGGTCAACAAGTAGGAAG.................................................................................................24172.0072.0015.0011.00-4.001.001.001.00-6.003.001.003.00-1.00----1.001.002.00----1.001.00--------1.00--2.00-1.00----1.00----1.00--1.002.00-1.00---1.00------------1.00---------1.00---1.00----------------1.00---1.00--------------1.00---1.00------1.00------
.............................................................................AAGGGCTGGTCAACAAGTAGGAA..................................................................................................23164.0064.004.004.003.00-1.003.003.003.00-1.002.00----1.002.00-1.001.001.00-2.001.00---1.00----2.00-2.00-1.001.001.00----1.00---1.00-2.00--1.00--1.002.00--1.001.001.00--1.00-----1.001.00--1.00-------1.00--1.00--1.00----1.00---1.001.00--------------------1.00---------------1.00-----
.............................................................................AAGGGCTGGTCAACAAGTAG.....................................................................................................20135.0035.001.00-3.003.00-1.00---3.002.003.001.00----8.00-1.00-------1.00-----------1.00-1.00----1.001.00-----------------2.00------1.00---------------------------------1.00----------------------------------
.............................................................................AAGGGCTGGTCAACAAGTAGGAAGT................................................................................................25126.0072.002.006.00--2.001.003.00-----------1.002.00----1.00----1.002.00-------------1.00--1.00--------------------------------1.00------------------------------1.00---1.00-------------------------
..............................................................................AGGGCTGGTCAACAAGTAGGAAG.................................................................................................23121.0021.001.00-1.00-----4.00--1.00----1.00-------1.001.003.00---1.00---1.00-----------1.00--1.00--------------------------1.00---1.00-----1.00---1.00--------------------------------------------------
..............................................................................AGGGCTGGTCAACAAGTAGGAAGG................................................................................................24114.0014.003.00------5.00--------1.00---------1.00-------------1.00-----------1.00-----1.00-1.00--------------------------------------------------------------------------------
.............................................................................AAGGGCTGGTCAACAAGTAGGAAA.................................................................................................24111.0064.002.00--1.00-----1.001.00-----1.00-1.00-----1.00-----------------1.00------------------------------------1.00---1.00---------------------------------------------------------
..................................................GTGAGAACCTAAGTGGGAATGAAATGGAAGGGCTGGTCAACAAGTAGGAAGGCATTGAGAAGTCAGTTT...............................................................................6917.007.00---------------------7.00-----------------------------------------------------------------------------------------------------------------------
..................................................GTGAGAACCTAAGTGGGAATGAAATGG.........................................................................................................................2716.006.00-----------------------------1.00-1.00-2.00------1.00-------------------------1.00--------------------------------------------------------------------------
..............................................................................AGGGCTGGTCAACAAGTAGGA...................................................................................................2116.006.00---1.00-------1.00--------1.00----------------------------------1.00---------------------1.001.00--------------------------------------------------------------
.................TACCTTCTGGATCATGCTACCTGCTC...........................................................................................................................................................2616.006.00----------------------------6.00----------------------------------------------------------------------------------------------------------------
..............................................................................AGGGCTGGTCAACAAGTAGG....................................................................................................2015.005.00--2.00-1.00---------1.00---------------------------------------------------------------------------------------1.00--------------------------------------
..............................................................................AGGGCTGGTCAACAAGTAG.....................................................................................................1914.004.00---1.00-----------1.00-----------1.00---------------------------1.00-------------------------------------------------------------------------------------
.............................................................................................................................TTTCCTCCTTGGTCCTGCCC.....................................................2014.004.001.00----------------------------------3.00---------------------------------------------------------------------------------------------------------
.............................................................................AAGGGCTGGTCAACAAGTAGGAAGGT...............................................................................................2613.003.003.00--------------------------------------------------------------------------------------------------------------------------------------------
.............................................................................AAGGGCTGGTCAACAAGTAGGT...................................................................................................2213.0081.00-1.00----------------1.00---------------------------------------------------------------------------------------------------------------1.00----------
.............................................................................AAGGGCTGGTCAACAAGTAGGAAGG................................................................................................2513.003.001.002.00-------------------------------------------------------------------------------------------------------------------------------------------
...............................................................................................................................TCCTCCTTGGTCCTGCCCCAGT.................................................223.000.00----------------1.00------------------------1.00-----------------1.00---------------------------------------------------------------------------------
.....................TTCTGGATCATGCTACCTGCTCTGCA.......................................................................................................................................................2613.003.00---------------------------------------------------------3.00-----------------------------------------------------------------------------------
............................................................................GAAGGGCTGGTCAACAAGTAGGA...................................................................................................2313.003.001.00-------------------------------------------1.00--------------------------1.00---------------------------------------------------------------------
..............................................................................................................................TTCCTCCTTGGTCCTGCCCCAGT.................................................233.000.002.00------------------------------------------------------------------------1.00-------------------------------------------------------------------
..............................................................................AGGGCTGGTCAACAAGTAGGAA..................................................................................................2213.003.00----1.00-----1.00--------------1.00-------------------------------------------------------------------------------------------------------------------
.............................................................................AAGGGCTGGTCAACAAGTAGGAAT.................................................................................................2413.0064.00---1.00----------------1.00------1.00-----------------------------------------------------------------------------------------------------------------
.............................................................................AAGGGCTGGTCAACAAGTAGTAA..................................................................................................2312.0035.00-----1.00-------------------------------1.00-------------------------------------------------------------------------------------------------------
.............................................................................AAGGGCTGGTCAACAAGTAGGAT..................................................................................................2312.00138.00------------------1.00-------------------------------1.00------------------------------------------------------------------------------------------
.......................CTGGATCATGCTACCTGCTCTGCAGTG....................................................................................................................................................2712.002.00--------------------1.00---------------------------------------------------------1.00--------------------------------------------------------------
......................TCTGGATCATGCTACCTGCTCTGCAGT.....................................................................................................................................................2712.002.00--------------2.00------------------------------------------------------------------------------------------------------------------------------
...............................................................................................AGGAAGGCATTGAGAAGTCAGT.................................................................................2212.002.00------------------------------------2.00--------------------------------------------------------------------------------------------------------
..................................................GTGAGAACCTAAGTGGGAATGAAATG..........................................................................................................................2612.002.00-----------------------------1.00-1.00-------------------------------------------------------------------------------------------------------------
..............................................................................AGGGCTGGTCAACAAGTAGGAAGGT...............................................................................................2512.0014.00------1.00------------------------------------1.00-------------------------------------------------------------------------------------------------
...............TTTACCTTCTGGATCATGCTACCTGC.............................................................................................................................................................2612.002.00-------------------------------------------------------------------2.00-------------------------------------------------------------------------
..................................................GTGAGAACCTAAGTGGGAATGAAATGGA........................................................................................................................2812.002.00---------------------------------2.00-----------------------------------------------------------------------------------------------------------
.............................................................................AAGGGCTGGTCAACAAGTAGGAAGGTAT.............................................................................................2811.003.001.00--------------------------------------------------------------------------------------------------------------------------------------------
..............................................................................AGGGCTGGTCAACAAGTAGGAT..................................................................................................2211.006.00-------------------------1.00-------------------------------------------------------------------------------------------------------------------
......................TCTGGATCATGCTACCTGCTCTGCAGTG....................................................................................................................................................2811.001.00-----------------------------1.00---------------------------------------------------------------------------------------------------------------
.............................................................................AAGGGCTGGTCAACAAGTAGGAC..................................................................................................2311.00138.001.00--------------------------------------------------------------------------------------------------------------------------------------------
.........................................................................................................................................................................GGAGTGAGCAGCTTCTATG..........191.000.00---------------------------------------------------------------1.00-----------------------------------------------------------------------------
..............................................................................................................................................................GCTTAGCCCCAGGAGTGAGCAGCTTC..............2611.001.00------------------------------------------------------------------------------------------------------------------1.00--------------------------
..............................................................................AGGGCTGGTCAACAAGTAGGAAGGTACT............................................................................................2811.0014.00---------------------------------1.00-----------------------------------------------------------------------------------------------------------
.............................................................................AAGGGCTGGTCAACAAGTAGAA...................................................................................................2211.0035.00----------1.00----------------------------------------------------------------------------------------------------------------------------------
.............................................................................AAGGGCTGGTCAACAAGTAGTAAA.................................................................................................2411.0035.00-------------------------------------------------------------------------------1.00-------------------------------------------------------------
.............................................................................................................................................................................TGAGCAGCTTCCTACAGATGGC...2211.001.00------------------------------------1.00--------------------------------------------------------------------------------------------------------
..................................................................................................................................................................AGCCCCAGGAGTGAGCAGCTTCCT............2411.001.00---------------------------------------------------------------------------------------------------1.00-----------------------------------------
..............................................................................AGGGCTGGTCAACAAGTAGGAAGT................................................................................................2411.0021.00------------1.00--------------------------------------------------------------------------------------------------------------------------------
.......................................................................................................................ATCTGGTTTCCTCCTCCA.............................................................181.000.00-----------------------------------------------------------------------------------------------------------1.00---------------------------------
.............................................................................AAGGGCTGGTCAACAAGTAGTAAG.................................................................................................2411.0035.00--------------------------------------------------1.00------------------------------------------------------------------------------------------
..............................................................................................................................TTCCTCCTTGGTCCTGCCCCTTT.................................................231.000.00-----------------------------------------------------------------------------------------------------------------------------------------1.00---
.............................................................................AAGGGCTGGTCAACAAGTAGGCA..................................................................................................2311.0081.00-------------------------------------1.00-------------------------------------------------------------------------------------------------------
.............................................................................AAGGGCTGGTCAACAAGTAGGTTA.................................................................................................2411.0081.00------------------1.00--------------------------------------------------------------------------------------------------------------------------
...............................................................................................................................TCCTCCTTGGTCCTGCCCCAGTAA...............................................241.000.00--------------------------------1.00------------------------------------------------------------------------------------------------------------
.............................................................................AAGGGCTGGTCAACAAGTAT.....................................................................................................201.000.00-----1.00---------------------------------------------------------------------------------------------------------------------------------------
.............................................................................AAGGGCTGGTCAACAAGTAGGC...................................................................................................2211.0081.00----------------------------------------------------------------------------------------------------------------1.00----------------------------
.............................................................................AAGGGCTGGTCAACAAGTAGGG...................................................................................................2211.0081.00--------------------------------------------------------------------------------------1.00------------------------------------------------------
.............................................................................AAGGGCTGGTCAACAAGCAGG....................................................................................................211.000.00----1.00----------------------------------------------------------------------------------------------------------------------------------------
.............................................................................AAGGGCTGGTCAACAAGTAGGAAGTT...............................................................................................2611.0072.00----1.00----------------------------------------------------------------------------------------------------------------------------------------
.............................................................................AAGGGCTGGTCAACAAGTAGGTA..................................................................................................2311.0081.00---------1.00-----------------------------------------------------------------------------------------------------------------------------------
.............................................................................AAGGGCTGGTCAACAAGTATGAA..................................................................................................231.000.00------------------------1.00--------------------------------------------------------------------------------------------------------------------
.............................................................................AAGGGCTGGTCAACAAGTATT....................................................................................................211.000.00----------------1.00----------------------------------------------------------------------------------------------------------------------------
.............................................................................................................................TTTCCTCCTTGGTCCTGCCCCAGA.................................................2411.001.00----------------------------------------------------------------1.00----------------------------------------------------------------------------
.............................................................................AAGGGCTGGTCAACAAGTATGA...................................................................................................221.000.00----------1.00----------------------------------------------------------------------------------------------------------------------------------
.............................................................................AAGGGCTGGTCAACAAGTAGGTT..................................................................................................2311.0081.00----------------------------------1.00----------------------------------------------------------------------------------------------------------
.............................................................................................................AAGTCAGTTTATCTGATC.......................................................................181.000.00-------------------------------------------------------------------------------------------------------------------------------------1.00-------
.................................................................................................................................................CAGACACCTGCTGGCGCT...................................181.000.00---------------------------------------------------------------1.00-----------------------------------------------------------------------------
.............................................................................AAGGGCTGGTCAACAAGTGGGA...................................................................................................221.000.00------------------------------------------1.00--------------------------------------------------------------------------------------------------
.............................................................................................................................TTTCCTCCTTGGTCCTGCCCCAAT.................................................2411.001.00----------------------------------------------------------1.00----------------------------------------------------------------------------------
..................................................GTGAGAACCTAAGTGGGAAT................................................................................................................................2011.001.00-------------------------------------------------------------------------------------------------------1.00-------------------------------------
...............................TGCTACCTGCTCTGCAGTGAC..................................................................................................................................................211.000.00-----------------------------------------------------------------------------------------------------------------------------------1.00---------
.............................................................................AAGGGCTGGTCAACAAGTAGGAAGTAT..............................................................................................2711.0072.00--------------------------------------------------------------------------------------------------------------------------------1.00------------
...............................................................................................................................TCCTCCTTGGTCCTGCCCCAA..................................................211.000.00-----------------------------------------------------------------------------------------------------------------1.00---------------------------
...TAGGACCCGATCTTTACCTTCTGGATCATGC....................................................................................................................................................................3111.001.00-----------------------------------------------------1.00---------------------------------------------------------------------------------------
..............................................................................................TAGGAAGGCATTGAGAAGTCAGTT................................................................................2411.001.00-------------------------------------------1.00-------------------------------------------------------------------------------------------------
..............................................................................................................................TTCCTCCTTGGTCCTGCCCCAGTT................................................241.000.001.00--------------------------------------------------------------------------------------------------------------------------------------------
............................................................................GAAGGGCTGGTCAACAAGTAGG....................................................................................................2211.001.00-----1.00---------------------------------------------------------------------------------------------------------------------------------------
..............................................................................AGGGCTGGTCAACAAGTACGA...................................................................................................211.000.00--------------------------------1.00------------------------------------------------------------------------------------------------------------
..............................................................................................................................TTCCTCCTTGGTCCTGCCCCAGA.................................................2311.001.00------------------------------------------1.00--------------------------------------------------------------------------------------------------
.....................................................................................GTCAACAAGTAGGAAGGCATTGAGAA.......................................................................................2611.001.00--------------------------------------------------------------------1.00------------------------------------------------------------------------
............................................................................................................................................................TGGCTTAGCCCCAGGAGTGAGCAGC.................2511.001.00--------------------------------------------------------------1.00------------------------------------------------------------------------------
.............................................................................AAGGGCTGGTCAACAAGGAG.....................................................................................................201.000.001.00--------------------------------------------------------------------------------------------------------------------------------------------
...............TTTACCTTCTGGATCATGCTACCTGCTCT..........................................................................................................................................................2911.001.00------------------------------------------------------------------------------------------------------------------------------1.00--------------
........................................................................................................................................................................AGGAGTGAGCAGCTTCCTACAGATGGCT..2811.001.00-------------------------------------------1.00-------------------------------------------------------------------------------------------------
.............................................................................AAGGGCTGGTCAACAAGTAGA....................................................................................................2111.0035.00---1.00-----------------------------------------------------------------------------------------------------------------------------------------
............................................................................GAAGGGCTGGTCAACAAGTAG.....................................................................................................2111.001.00-----------1.00---------------------------------------------------------------------------------------------------------------------------------
..............................................................................AGGGCTGGTCAACAAGTAGGAAGGCAT.............................................................................................2711.001.00------------------------------------------------------------------1.00--------------------------------------------------------------------------
............................................................AAGTGGGAATGAAATGGAAGGGCT..................................................................................................................2411.001.00-----------------------------------------------------------1.00---------------------------------------------------------------------------------
...TAGGACCCGATCTTTACCTTCT.............................................................................................................................................................................2211.001.00--------------------------------------------------------------------1.00------------------------------------------------------------------------
.............................................................................................................................TTTCCTCCTTGGTCCTGCCCCA...................................................2211.001.00-----------------------------------1.00---------------------------------------------------------------------------------------------------------
.......................................................................................CAACAAGTAGGAAGGC...............................................................................................1620.500.50--------------------------------------------------------------------------------------------------------------------------------------------0.50

Antisense strand
CTGTAGGACCCGATCTTTACCTTCTGGATCATGCTACCTGCTCTGCAGTGGTGAGAACCTAAGTGGGAATGAAATGGAAGGGCTGGTCAACAAGTAGGAAGGCATTGAGAAGTCAGTTTATCTGGTTTCCTCCTTGGTCCTGCCCCAGACACCTGCTGGCTTAGCCCCAGGAGTGAGCAGCTTCCTACAGATGGCTGT
...............................................................................((((.((....((((.((((((.((...(((......)))...)).)))))).))))..)).)))).....................................................
........................................................................73.........................................................................148................................................
SizePerfect hitTotal NormPerfect NormSRR546155(SRX180174)
Global profiling of miRNA and the hairpin pre. (ago2 Neuroblastoma)		SRR553602(SRX182808)
source: Sertoli cells. (Sertoli cells)		SRR553583(SRX182789)
source: Cerebellum. (Cerebellum)		SRR553582(SRX182788)
source: Brain. (Brain)		SRR346425(SRX098267)
Global profiling of miRNA and the hairpin pre. (Neuroblastoma)		SRR042469(GSM539861)
mouse Th2 cells [09-002]. (lymph)		SRR346424(SRX098266)
Global profiling of miRNA and the hairpin pre. (Neuroblastoma)		mjTestesWT4()
Testes Data. (testes)		SRR402760(SRX117943)
source: ES E14 male cells. (ESC)		SRR042470(GSM539862)
mouse Th17 cells [09-002]. (lymph)		SRR042447(GSM539839)
mouse mature B cells (spleen) replicate 2 [09-002]. (b cell)		SRR042471(GSM539863)
mouse TFHS cells [09-002]. (spleen)		SRR346423(SRX098265)
Global profiling of miRNA and the hairpin pre. (Brain)		SRR402762(SRX117945)
source: ES E14 male cells. (ESC)		mjTestesWT3()
Testes Data. (testes)		SRR345207(SRX097268)
source: size fractionated RNA from mouse hipp. (brain)		SRR042468(GSM539860)
mouse Th1 cells [09-002]. (lymph)		mjTestesWT1()
Testes Data. (testes)		SRR042446(GSM539838)
mouse mature B cells (spleen) replicate 1 [09-002]. (b cell)		SRR042458(GSM539850)
mouse basophil cells [09-002]. (b cell)		SRR042454(GSM539846)
mouse germinal center B cells (lymph node) [09-002]. (b cell)		SRR346421(SRX098263)
Global profiling of miRNA and the hairpin pre. (mixture)		SRR042472(GSM539864)
mouse iTreg cells [09-002]. (lymph)		mjLiverWT3()
Liver Data. (liver)		SRR042450(GSM539842)
mouse B cells activated in vitro with LPS/IL4 replicate 3 [09-002]. (b cell)		SRR346417(SRX098258)
Global profiling of miRNA and the hairpin pre. (Brain)		SRR279907(GSM689057)
cell type: mouse embryonic stem cellcell line. (ESC)		SRR042459(GSM539851)
mouse neutrophil cells replicate 1 [09-002]. (blood)		SRR394084(GSM855970)
"background strain: C57BL6/SV129cell type: KR. (dicer cell line)		SRR248523(GSM733811)
cell type: Thy1+ spermatogonial stem cellstra. (testes)		SRR042456(GSM539848)
mouse hematopoetic progenitor cells [09-002]. (bone marrow)		SRR248526(GSM733814)
cell type: Thy1- spermatogonial stem cellstra. (testes)		SRR039154(GSM471931)
HL1_siSrf2_smallRNAseq. (muscle)		SRR248524(GSM733812)
cell type: Thy1+ spermatogonial stem cellstra. (testes)		SRR042443(GSM539835)
mouse pro B cells [09-002]. (b cell)		SRR390300(GSM849858)
cell line: NIH-3T3cell type: fibroblastinfect. (ago2 fibroblast)		SRR391847(GSM852142)
gender: femalegenotype/variation: ADAR2-/-/AD. (embryo)		SRR042477(GSM539869)
mouse brain tissue [09-002]. (brain)		SRR042448(GSM539840)
mouse B cells activated in vitro with LPS/IL4 replicate 1 [09-002]. (b cell)		SRR345205(SRX097266)
source: size fractionated RNA from mouse hipp. (brain)		SRR248525(GSM733813)
cell type: Thy1- spermatogonial stem cellstra. (testes)		SRR059769(GSM562831)
Treg_Drosha. (spleen)		GSM510444(GSM510444)
brain_rep5. (brain)		SRR042449(GSM539841)
mouse B cells activated in vitro with LPS/IL4 replicate 2 [09-002]. (b cell)		SRR391851(GSM852146)
gender: femalegenotype/variation: wild typeti. (embryo)		mjTestesKO8()
Testes Data. (Zcchc11 testes)		SRR042457(GSM539849)
mouse mast cells [09-002]. (bone marrow)		SRR042451(GSM539843)
mouse B cells activated in vitro with LPS/aIgD-Dextran [09-002]. (b cell)		SRR345204(SRX097265)
source: size fractionated RNA from mouse hipp. (brain)		SRR042467(GSM539859)
mouse T cells activated in vitro with Concanavalin A [09-002]. (spleen)		SRR042478(GSM539870)
mouse lung tissue [09-002]. (lung)		SRR042444(GSM539836)
mouse pre B cells [09-002]. (b cell)		SRR042453(GSM539845)
mouse marginal zone B cells (spleen) [09-002]. (b cell)		SRR248527(GSM733815)
cell type: spermatogonial stem cell enriched . (testes)		SRR279904(GSM689054)
cell type: mouse embryonic stem cellcell line. (ESC)		SRR042488(GSM539880)
mouse BclXL germinal center B cells [BalbC] [09-002]. (B cell)		SRR390299(GSM849857)
cell line: NIH-3T3cell type: fibroblastip ant. (ago2 fibroblast)		SRR391846(GSM852141)
gender: femalegenotype/variation: ADAR2-/-tis. (embryo)		SRR391848(GSM852143)
gender: femalegenotype/variation: wild typeti. (embryo)		SRR391853(GSM852148)
gender: femalegenotype/variation: ADAR2-/-/AD. (embryo)		SRR346414(SRX098255)
Global profiling of miRNA and the hairpin pre. (Spleen)		SRR032477(GSM485235)
sRNA_activation_deep_sequencing. (uterus)		SRR029037(GSM433289)
18dpp_homo_tdrd6-KO. (tdrd6 testes)		SRR345196(SRX097257)
source: size fractionated RNA from mouse hipp. (brain)		SRR402766(SRX117949)
source: ES PGK female cells. (ESC)		SRR345202(SRX097263)
source: size fractionated RNA from mouse hipp. (brain)		SRR028732(GSM400969)
Mili-Tdrd1 KO associated. (mili testes)		SRR279906(GSM689056)
cell type: mouse embryonic stem cellcell line. (ESC)		GSM475280(GSM475280)
Mili-IP. (mili testes)		Ago3IP805(Rui)
Quantitative functions of Argonaute proteins . (ago3 skin)		SRR553586(SRX182792)
source: Testis. (testes)		SRR042475(GSM539867)
mouse embryonic fibroblast cells [09-002]. (fibroblast)		SRR306540(GSM750583)
19-24nt. (ago2 brain)		SRR042487(GSM539879)
mouse BclXL B activated with LPS/IL4 [BalbC] [09-002]. (spleen)		SRR042473(GSM539865)
mouse nTreg cells [09-002]. (lymph)		SRR345203(SRX097264)
source: size fractionated RNA from mouse hipp. (brain)		SRR038742(GSM527277)
small RNA-Seq. (dgcr8 brain)		SRR042483(GSM539875)
mouse muscle tissue [09-002]. (muscle)		SRR069809(GSM610965)
small RNA sequencing; sample 1. (testes)		SRR042462(GSM539854)
mouse macrophages [09-002]. (bone marrow)		SRR402761(SRX117944)
source: ES E14 male cells. (ESC)		SRR042466(GSM539858)
mouse CD8+ T cells (spleen) [09-002]. (spleen)		SRR039152(GSM471929)
HL1_siNon_smallRNAseq. (muscle)		SRR042463(GSM539855)
mouse natural killer cells [09-002]. (spleen)		SRR073955(GSM629281)
total RNA. (blood)		SRR553585(SRX182791)
source: Kidney. (Kidney)		mjLiverKO3()
Liver Data. (Zcchc11 liver)		SRR042461(GSM539853)
mouse dendritic cells [09-002]. (bone marrow)		SRR042460(GSM539852)
mouse neutrophil cells replicate 2 [09-002]. (blood)		SRR306541(GSM750584)
19-24nt. (ago2 brain)		SRR042455(GSM539847)
mouse plasma cells [09-002]. (blood)		SRR065052(SRR065052)
Tissue-specific Regulation of Mouse MicroRNA . (jejunum)		GSM509280(GSM509280)
small RNA cloning by length. (testes)		SRR391845(GSM852140)
gender: femalegenotype/variation: wild typeti. (embryo)		mjTestesKO7()
Testes Data. (Zcchc11 testes)		SRR306539(GSM750582)
19-24nt. (ago2 brain)		SRR042465(GSM539857)
mouse CD4+ T cells (spleen) [09-002]. (spleen)		SRR023848(GSM307157)
mEFsmallrna_rep1. (cell line)		SRR038743(GSM527278)
small RNA-Seq. (dicer brain)		SRR391849(GSM852144)
gender: femalegenotype/variation: ADAR2-/-tis. (embryo)		SRR206940(GSM723281)
other. (brain)		SRR306537(GSM750580)
19-24nt. (ago2 brain)		SRR306533(GSM750576)
19-24nt. (ago2 brain)		SRR391852(GSM852147)
gender: femalegenotype/variation: ADAR2-/-tis. (embryo)		SRR553604(SRX182810)
source: Spermatocytes. (Spermatocytes)		SRR037921(GSM510459)
e12p5_rep3. (embryo)		SRR206939(GSM723280)
other. (brain)		SRR037914(GSM510451)
newborn_rep7. (total RNA)		SRR073954(GSM629280)
total RNA. (blood)		SRR346416(SRX098257)
Global profiling of miRNA and the hairpin pre. (Kidney)		SRR039186(GSM485326)
shLuc.1309;ROSA-rtTA (+dox). (fibroblast)		SRR553584(SRX182790)
source: Heart. (Heart)		Ago2IP504(Rui)
Quantitative functions of Argonaute proteins . (ago2 skin)		SRR685339(GSM1079783)
"Small RNAs (15-50 nts in length) from immort. (cell line)		SRR029036(GSM433288)
18dpp_hetero_tdrd6-KO. (tdrd6 testes)		SRR032476(GSM485234)
sRNA_delayed_deep_sequencing. (uterus)		SRR060845(GSM561991)
total RNA. (brain)		SRR038741(GSM527276)
small RNA-Seq. (brain)		SRR346422(SRX098264)
Global profiling of miRNA and the hairpin pre. (Muscle)		SRR039183(GSM485323)
shLuc.1309 (-dox). (fibroblast)		SRR525242(SRA056111/SRX170318)
Mus musculus domesticus miRNA sequencing. (ago2 Blood)		SRR069810(GSM610966)
small RNA sequencing; sample 2. (testes)		SRR346419(SRX098260)
Global profiling of miRNA and the hairpin pre. (Lung)		mjTestesKO5()
Testes Data. (Zcchc11 testes)		SRR042486(GSM539878)
mouse ovaries [09-002]. (ovary)		GSM509278(GSM509278)
small RNA cloning by length. (piwi testes)		SRR029039(GSM433291)
25dpp_homo_tdrd6-KO. (tdrd6 testes)		SRR038744(GSM527279)
small RNA-Seq. (brain)		SRR042464(GSM539856)
mouse CD4+CD8+ T cells (thymus) [09-002]. (thymus)		GSM510453(GSM510453)
newborn_rep9. (total RNA)		SRR346420(SRX098261)
Global profiling of miRNA and the hairpin pre. (Uterus)		SRR346418(SRX098259)
Global profiling of miRNA and the hairpin pre. (Liver)		GSM509277(GSM509277)
small RNA cloning by length. (piwi testes)		GSM640581(GSM640581)
small RNA in the liver with paternal control. (liver)		SRR014231(GSM319955)
16.5 dpc total. (testes)		SRR206941(GSM723282)
other. (brain)		SRR042445(GSM539837)
mouse immature B cells [09-002]. (b cell)		Ago2IP517(Rui)
Quantitative functions of Argonaute proteins . (ago2 skin)		GSM510456(GSM510456)
newborn_rep12. (total RNA)		SRR306535(GSM750578)
19-24nt. (ago2 brain)		SRR306544(GSM750587)
19-24nt. (ago2 brain)
.........................................................................................................................................TCCTGCCCCAGACACGGCC.......................................... 191.000.00------------------------------------------------------------------------------------1.00--------------------------------------------------------
.........................................................................................................................................TCCTGCCCCAGACACGGTC.......................................... 191.000.00------------------------------------------------------------------------------------1.00--------------------------------------------------------