| (1) AGO.mut | (1) AGO1.ip | (5) AGO2.ip | (2) AGO3.ip | (13) B-CELL | (5) BRAIN | (2) CELL-LINE | (5) EMBRYO | (1) ESC | (1) FIBROBLAST | (1) KIDNEY | (4) LIVER | (1) LUNG | (5) LYMPH | (16) OTHER | (4) OTHER.mut | (1) PANCREAS | (5) SKIN | (10) SPLEEN | (6) TESTES | (2) THYMUS |
| AGGGGGTATTTAATATTGAAGTGCAAGCTGTTTCTTCCGTCCACACCCAGGTAAGGGACATCAAGGTCTGCCACCGTCCGGGTTAGCCATCTGCTTTGTGCTCTCTCTTGACAGTGTGATACCTAGTACATCACCTACCTACAGCATGAGTTGGAGCCTGGTTTATTGTTTCTTTAATTAATAGTTGTCAAAAGGTCCTATGTTGTATACCACATTCTACAAATAAGCCCACTGCCTTTGCTGGAAGCATCTGAGATTTCGAGTTCTAATCCAGAGCACTGGCTAAGGGATTGCACCAAGCTCCTGGGTGGATGGTGAAAGAATAACACCTCCTGAGAGTCTTCCACCCTCTGCCCTCCCAGGATAACCACCTGGAGAAGTTCTTCACCCTTTGCCACTCCCTGGAGAGCCA .................................................................................................................................................................................................................................................................................................................(((..((.((((.((((.......(((....))))))).)))).))..)))........................................................ .........................................................................................................................................................................................................................................................................................................298.............................................................362................................................ | Size | Perfect hit | Total Norm | Perfect Norm | SRR042471(GSM539863) mouse TFHS cells [09-002]. (spleen) | SRR042458(GSM539850) mouse basophil cells [09-002]. (b cell) | SRR059769(GSM562831) Treg_Drosha. (spleen) | SRR042469(GSM539861) mouse Th2 cells [09-002]. (lymph) | SRR042447(GSM539839) mouse mature B cells (spleen) replicate 2 [09-002]. (b cell) | SRR042459(GSM539851) mouse neutrophil cells replicate 1 [09-002]. (blood) | SRR042473(GSM539865) mouse nTreg cells [09-002]. (lymph) | SRR042463(GSM539855) mouse natural killer cells [09-002]. (spleen) | SRR042470(GSM539862) mouse Th17 cells [09-002]. (lymph) | SRR042468(GSM539860) mouse Th1 cells [09-002]. (lymph) | SRR042465(GSM539857) mouse CD4+ T cells (spleen) [09-002]. (spleen) | SRR042457(GSM539849) mouse mast cells [09-002]. (bone marrow) | SRR042445(GSM539837) mouse immature B cells [09-002]. (b cell) | SRR042472(GSM539864) mouse iTreg cells [09-002]. (lymph) | SRR042452(GSM539844) mouse B1 B cells [09-002]. (b cell) | SRR042466(GSM539858) mouse CD8+ T cells (spleen) [09-002]. (spleen) | SRR042460(GSM539852) mouse neutrophil cells replicate 2 [09-002]. (blood) | SRR042456(GSM539848) mouse hematopoetic progenitor cells [09-002]. (bone marrow) | SRR042443(GSM539835) mouse pro B cells [09-002]. (b cell) | SRR042467(GSM539859) mouse T cells activated in vitro with Concanavalin A [09-002]. (spleen) | SRR042461(GSM539853) mouse dendritic cells [09-002]. (bone marrow) | SRR037925(GSM510463) e9p5_rep3. (embryo) | SRR042484(GSM539876) mouse salivary gland tissue [09-002]. (gland) | SRR059770(GSM562832) Treg_Dicer. (spleen) | SRR042454(GSM539846) mouse germinal center B cells (lymph node) [09-002]. (b cell) | SRR042448(GSM539840) mouse B cells activated in vitro with LPS/IL4 replicate 1 [09-002]. (b cell) | SRR042462(GSM539854) mouse macrophages [09-002]. (bone marrow) | SRR042464(GSM539856) mouse CD4+CD8+ T cells (thymus) [09-002]. (thymus) | SRR059768(GSM562830) Treg_control. (spleen) | SRR073954(GSM629280) total RNA. (blood) | SRR390300(GSM849858) cell line: NIH-3T3cell type: fibroblastinfect. (ago2 fibroblast) | SRR042446(GSM539838) mouse mature B cells (spleen) replicate 1 [09-002]. (b cell) | SRR037924(GSM510462) e9p5_rep2. (embryo) | SRR042487(GSM539879) mouse BclXL B activated with LPS/IL4 [BalbC] [09-002]. (spleen) | SRR042444(GSM539836) mouse pre B cells [09-002]. (b cell) | Ago1IP517(Rui) Quantitative functions of Argonaute proteins . (ago1 skin) | SRR042449(GSM539841) mouse B cells activated in vitro with LPS/IL4 replicate 2 [09-002]. (b cell) | SRR042480(GSM539872) mouse kidney tissue [09-002]. (kidney) | SRR029042(GSM433294) 18.5dpc_hetero_tdrd1-KO. (tdrd1 testes) | SRR042488(GSM539880) mouse BclXL germinal center B cells [BalbC] [09-002]. (B cell) | Ago2IP504(Rui) Quantitative functions of Argonaute proteins . (ago2 skin) | SRR042450(GSM539842) mouse B cells activated in vitro with LPS/IL4 replicate 3 [09-002]. (b cell) | Ago3IP812(Rui) Quantitative functions of Argonaute proteins . (ago3 skin) | SRR059766(GSM562828) DN3_Drosha. (thymus) | SRR525244(SRA056111/SRX170320) Mus musculus domesticus miRNA sequencing. (ago2 Blood) | SRR029037(GSM433289) 18dpp_homo_tdrd6-KO. (tdrd6 testes) | SRR065052(SRR065052) Tissue-specific Regulation of Mouse MicroRNA . (jejunum) | GSM509280(GSM509280) small RNA cloning by length. (testes) | SRR065054(SRR065054) Tissue-specific Regulation of Mouse MicroRNA . (jejunum) | SRR042478(GSM539870) mouse lung tissue [09-002]. (lung) | SRR391848(GSM852143) gender: femalegenotype/variation: wild typeti. (embryo) | SRR345199(SRX097260) source: size fractionated RNA from mouse hipp. (brain) | SRR042477(GSM539869) mouse brain tissue [09-002]. (brain) | SRR345202(SRX097263) source: size fractionated RNA from mouse hipp. (brain) | SRR042453(GSM539845) mouse marginal zone B cells (spleen) [09-002]. (b cell) | SRR391849(GSM852144) gender: femalegenotype/variation: ADAR2-/-tis. (embryo) | SRR065045(SRR065045) Tissue-specific Regulation of Mouse MicroRNA . (liver) | SRR345203(SRX097264) source: size fractionated RNA from mouse hipp. (brain) | SRR042483(GSM539875) mouse muscle tissue [09-002]. (muscle) | mjTestesKO8() Testes Data. (Zcchc11 testes) | GSM640578(GSM640578) small RNA in the liver with paternal control. (liver) | Ago3IP805(Rui) Quantitative functions of Argonaute proteins . (ago3 skin) | SRR029043(GSM433295) 18.5dpc_homo_tdrd1-KO. (tdrd1 testes) | SRR037921(GSM510459) e12p5_rep3. (embryo) | SRR039154(GSM471931) HL1_siSrf2_smallRNAseq. (muscle) | SRR039152(GSM471929) HL1_siNon_smallRNAseq. (muscle) | SRR553586(SRX182792) source: Testis. (testes) | SRR037936(GSM510474) 293cand1. (cell line) | GSM640581(GSM640581) small RNA in the liver with paternal control. (liver) | SRR345201(SRX097262) source: size fractionated RNA from mouse hipp. (brain) | SRR040489(GSM533912) E18.5 Ago2 catalytically inactive LIVER small RNA. (ago2 liver) | SRR065059(SRR065059) Tissue-specific Regulation of Mouse MicroRNA . (pancreas) | GSM519104(GSM519104) mouse_granulocyte_nuclei_smallRNAs. (cell line) | SRR525242(SRA056111/SRX170318) Mus musculus domesticus miRNA sequencing. (ago2 Blood) | Ago2IP517(Rui) Quantitative functions of Argonaute proteins . (ago2 skin) | SRR059771(GSM562833) CD4_control. (spleen) | SRR402762(SRX117945) source: ES E14 male cells. (ESC) | SRR346425(SRX098267) Global profiling of miRNA and the hairpin pre. (Neuroblastoma) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ..............................................................................................................................................................................................................................................................................................................CCTGGGTGGATGGTGAAAGAAT........................................................................................ | 22 | 1 | 72.00 | 72.00 | 1.00 | 2.00 | 5.00 | 1.00 | - | 1.00 | - | 4.00 | - | 1.00 | 2.00 | 3.00 | 4.00 | - | 5.00 | - | - | 4.00 | 5.00 | 3.00 | 3.00 | 3.00 | - | 1.00 | 3.00 | - | - | - | - | 1.00 | 3.00 | 1.00 | 3.00 | 1.00 | 1.00 | - | 1.00 | - | - | - | - | - | 1.00 | - | - | - | - | - | 1.00 | - | - | - | 1.00 | - | - | - | - | 1.00 | - | 1.00 | 1.00 | - | 1.00 | - | - | - | - | - | - | - | 1.00 | 1.00 | - | - | 1.00 | - | - | - |
| ..............................................................................................................................................................................................................................................................................................................CCTGGGTGGATGGTGAAAG........................................................................................... | 19 | 1 | 58.00 | 58.00 | 12.00 | 10.00 | 1.00 | 5.00 | 9.00 | 3.00 | 2.00 | - | 3.00 | 3.00 | 4.00 | - | - | 2.00 | - | 2.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..............................................................................................................................................................................................................................................................................................................CCTGGGTGGATGGTGAAAGAA......................................................................................... | 21 | 1 | 53.00 | 53.00 | 8.00 | 6.00 | 3.00 | 4.00 | 3.00 | 5.00 | - | - | 6.00 | 3.00 | - | 2.00 | - | 1.00 | - | 1.00 | - | - | - | - | 1.00 | - | 1.00 | 1.00 | - | - | - | 2.00 | - | - | - | - | - | - | - | 1.00 | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | 1.00 | - | - | - | - | - | - | 1.00 | - | - |
| ..............................................................................................................................................................................................................................................................................................................CCTGGGTGGATGGTGAAAGA.......................................................................................... | 20 | 1 | 53.00 | 53.00 | 10.00 | 4.00 | 8.00 | 5.00 | 3.00 | 2.00 | 3.00 | - | - | 1.00 | 1.00 | - | 1.00 | 2.00 | - | 1.00 | 1.00 | - | - | 1.00 | - | 1.00 | - | 1.00 | - | - | - | - | 2.00 | 1.00 | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | 1.00 | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - |
| ..............................................................................................................................................................................................................................................................................................................CCTGGGTGGATGGTGAAAGAATT....................................................................................... | 23 | 1 | 11.00 | 72.00 | - | - | - | - | - | 2.00 | 1.00 | 1.00 | - | - | - | - | 1.00 | - | 1.00 | - | 2.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...............................................................................................................................................................................................................................................................................................................CTGGGTGGATGGTGAAAGAATA....................................................................................... | 22 | 1 | 9.00 | 9.00 | 1.00 | - | - | 1.00 | - | - | - | 1.00 | - | 1.00 | - | 2.00 | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | 1.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .............................................................................................................................................................................................................................................................................................................TCCTGGGTGGATGGTGAAAGA.......................................................................................... | 21 | 1 | 9.00 | 9.00 | - | 1.00 | 3.00 | - | 1.00 | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 2.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..............................................................................................................................................................................................................................................................................................................CCTGGGTGGATGGTGAAAGAATA....................................................................................... | 23 | 1 | 9.00 | 9.00 | - | 1.00 | - | 1.00 | - | - | - | 1.00 | - | - | - | 1.00 | 1.00 | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...............................................................................................................................................................................................................................................................................................................CTGGGTGGATGGTGAAAGAAT........................................................................................ | 21 | 1 | 7.00 | 7.00 | - | 1.00 | - | - | 1.00 | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...............................................................................................................................................................................................................................................................................................................CTGGGTGGATGGTGAAAGAATAT...................................................................................... | 23 | 1 | 7.00 | 9.00 | 2.00 | - | - | - | - | 1.00 | 2.00 | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..............................................................................................................................................................................................................................................................................................................CCTGGGTGGATGGTGAAAGAAA........................................................................................ | 22 | 1 | 5.00 | 53.00 | - | - | - | - | - | - | 1.00 | - | - | - | - | 1.00 | - | - | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...............................................................................................................................................................................................................................................................................................................CTGGGTGGATGGTGAAAGAA......................................................................................... | 20 | 1 | 5.00 | 5.00 | 1.00 | - | - | 1.00 | - | - | 2.00 | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .............................................................................................................................................................................................................................................................................................................TCCTGGGTGGATGGTGAAAG........................................................................................... | 20 | 1 | 5.00 | 5.00 | - | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .............................................................................................................................................................................................................................................................................................................TCCTGGGTGGATGGTGAAAGAATT....................................................................................... | 24 | 1 | 4.00 | 3.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...............................................................................................................................................................................................................................................................................................................CTGGGTGGATGGTGAAAG........................................................................................... | 18 | 1 | 3.00 | 3.00 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .............................................................................................................................................................................................................................................................................................................TCCTGGGTGGATGGTGAAAGAA......................................................................................... | 22 | 1 | 3.00 | 3.00 | - | - | - | 2.00 | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...............................................................................................................................................................................................................................................................................................................CTGGGTGGATGGTGAAAGA.......................................................................................... | 19 | 1 | 3.00 | 3.00 | - | - | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ................................................................................................................................................................................................................................................................................................................TGGGTGGATGGTGAAAGAAT........................................................................................ | 20 | 1 | 3.00 | 3.00 | - | - | 3.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..............................................................................................................................................................................................................................................................................................................CCTGGGTGGATGGTGAAAGAATAT...................................................................................... | 24 | 1 | 3.00 | 9.00 | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - |
| ................................................................................................................................................................................................................................................................................................................TGGGTGGATGGTGAAAGAATAA...................................................................................... | 22 | 1 | 3.00 | 3.00 | - | - | - | - | - | - | - | 3.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .............................................................................................................................................................................................................................................................................................................TCCTGGGTGGATGGTGAAAGAAT........................................................................................ | 23 | 1 | 3.00 | 3.00 | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...............................................................................................................................................................................................................................................................................................................CTGGGTGGATGGTGAAAGAATAA...................................................................................... | 23 | 1 | 3.00 | 3.00 | - | - | - | - | - | - | - | - | - | - | 1.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..............................................................................................................................................................................................................................................................................................................CCTGGGTGGATGGTGAAA............................................................................................ | 18 | 1 | 2.00 | 2.00 | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ................................................................................................................................................................................................................................................................................................................TGGGTGGATGGTGAAAGAATA....................................................................................... | 21 | 1 | 2.00 | 2.00 | - | - | - | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..................................................................................................................................................................................................................................................................................................................................................GTCTTCCACCCTCTGCCC........................................................ | 18 | 1 | 2.00 | 2.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..............................................................................................................................................................................................................................................................................................................CCTGGGTGGATGGTGAAAGAAAT....................................................................................... | 23 | 1 | 2.00 | 53.00 | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ........................................................................................................................................................................................................................................................................................................................................................................AGGATAACCACCTGGAGAAGT............................... | 21 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...............................TTCTTCCGTCCACACCTTAA......................................................................................................................................................................................................................................................................................................................................................................... | 20 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .................................................................................................................................................................................................................................................................................................................................................................................ACCTGGAGAAGTTCTTCACGTT..................... | 22 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .............................................................................................................................................................................................................................................................................................................TCCTGGGTGGATGGTGAAAGAATTTT..................................................................................... | 26 | 1 | 1.00 | 3.00 | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..............................................................................................................................................................................................................................................................................................................CCTGGGTGGATGGTGCAAG........................................................................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..............................................................................................................................................................................................................................................................................................................CCTGGGTGGATGGTGAACGA.......................................................................................... | 20 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..............................................................................................................................................................................................................................................................................................................CCTGGGTGGATGGTGAAAGT.......................................................................................... | 20 | 1 | 1.00 | 58.00 | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ................................................................................................................................................................................................................................................................................................................TGGGTGGATGGTGAAAGAATAACA.................................................................................... | 24 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..................................................................................................................................................................................................................................................................................................................................................GTCTTCCACCCTCTGCCCTCCT.................................................... | 22 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | |
| ..............................................................................................................................................................................................................................................................................................................CCTGGGTGGATGGTGAAAT........................................................................................... | 19 | 1 | 1.00 | 2.00 | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .............................................................................................................................................................................................................................................................................................................TCCTGGGTGGATGGTGAAAGT.......................................................................................... | 21 | 1 | 1.00 | 5.00 | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .............................................................................................................................................................................................................................................................................................................................................................................AACCACCTGGAGAAGTTCTTCACC....................... | 24 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..............................................................................................................................................................................................................................................................................................................CCTGGGTGGATGGTGAAATAAT........................................................................................ | 22 | 1 | 1.00 | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...............................................................................................................................................................................................................................................................................................................CTGGGTGGATGGTGAAAGACTAT...................................................................................... | 23 | 1 | 1.00 | 3.00 | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .............................................................................................................................................................................................................................................................................................................TCCTGGGTGGATGGTGAAAGAATTT...................................................................................... | 25 | 1 | 1.00 | 3.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..............................................................................................................................................................................................................................................................................................................CCTGGGTGGATGGTGAAAGTT......................................................................................... | 21 | 1 | 1.00 | 58.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..............................................................................................................................................................................................................................................................................................................CCTGGGTGGATGGTGAAAGTA......................................................................................... | 21 | 1 | 1.00 | 58.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .............................................................................................................................................................................................................................................................................................................TCCTGGGTGGATGGTGACAGA.......................................................................................... | 21 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .............................GTTTCTTCCGTCCACAGCTC........................................................................................................................................................................................................................................................................................................................................................................... | 20 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | |
| .................................................................................................................................................................................................................................................TGGAAGCATCTGAGACCGG........................................................................................................................................................ | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .............................................................................................................................................................................................................................................................................................................TCCTGGGTGGATGGTGAACGA.......................................................................................... | 21 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ............................................................................................................................................................................................................................................................................................................CTCCTGGGTGGATGGTGAAAGA.......................................................................................... | 22 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| AGGGGGTATTTAATATTGAAGTGCAAGCTGTTTCTTCCGTCCACACCCAGGTAAGGGACATCAAGGTCTGCCACCGTCCGGGTTAGCCATCTGCTTTGTGCTCTCTCTTGACAGTGTGATACCTAGTACATCACCTACCTACAGCATGAGTTGGAGCCTGGTTTATTGTTTCTTTAATTAATAGTTGTCAAAAGGTCCTATGTTGTATACCACATTCTACAAATAAGCCCACTGCCTTTGCTGGAAGCATCTGAGATTTCGAGTTCTAATCCAGAGCACTGGCTAAGGGATTGCACCAAGCTCCTGGGTGGATGGTGAAAGAATAACACCTCCTGAGAGTCTTCCACCCTCTGCCCTCCCAGGATAACCACCTGGAGAAGTTCTTCACCCTTTGCCACTCCCTGGAGAGCCA .................................................................................................................................................................................................................................................................................................................(((..((.((((.((((.......(((....))))))).)))).))..)))........................................................ .........................................................................................................................................................................................................................................................................................................298.............................................................362................................................ | Size | Perfect hit | Total Norm | Perfect Norm | SRR042471(GSM539863) mouse TFHS cells [09-002]. (spleen) | SRR042458(GSM539850) mouse basophil cells [09-002]. (b cell) | SRR059769(GSM562831) Treg_Drosha. (spleen) | SRR042469(GSM539861) mouse Th2 cells [09-002]. (lymph) | SRR042447(GSM539839) mouse mature B cells (spleen) replicate 2 [09-002]. (b cell) | SRR042459(GSM539851) mouse neutrophil cells replicate 1 [09-002]. (blood) | SRR042473(GSM539865) mouse nTreg cells [09-002]. (lymph) | SRR042463(GSM539855) mouse natural killer cells [09-002]. (spleen) | SRR042470(GSM539862) mouse Th17 cells [09-002]. (lymph) | SRR042468(GSM539860) mouse Th1 cells [09-002]. (lymph) | SRR042465(GSM539857) mouse CD4+ T cells (spleen) [09-002]. (spleen) | SRR042457(GSM539849) mouse mast cells [09-002]. (bone marrow) | SRR042445(GSM539837) mouse immature B cells [09-002]. (b cell) | SRR042472(GSM539864) mouse iTreg cells [09-002]. (lymph) | SRR042452(GSM539844) mouse B1 B cells [09-002]. (b cell) | SRR042466(GSM539858) mouse CD8+ T cells (spleen) [09-002]. (spleen) | SRR042460(GSM539852) mouse neutrophil cells replicate 2 [09-002]. (blood) | SRR042456(GSM539848) mouse hematopoetic progenitor cells [09-002]. (bone marrow) | SRR042443(GSM539835) mouse pro B cells [09-002]. (b cell) | SRR042467(GSM539859) mouse T cells activated in vitro with Concanavalin A [09-002]. (spleen) | SRR042461(GSM539853) mouse dendritic cells [09-002]. (bone marrow) | SRR037925(GSM510463) e9p5_rep3. (embryo) | SRR042484(GSM539876) mouse salivary gland tissue [09-002]. (gland) | SRR059770(GSM562832) Treg_Dicer. (spleen) | SRR042454(GSM539846) mouse germinal center B cells (lymph node) [09-002]. (b cell) | SRR042448(GSM539840) mouse B cells activated in vitro with LPS/IL4 replicate 1 [09-002]. (b cell) | SRR042462(GSM539854) mouse macrophages [09-002]. (bone marrow) | SRR042464(GSM539856) mouse CD4+CD8+ T cells (thymus) [09-002]. (thymus) | SRR059768(GSM562830) Treg_control. (spleen) | SRR073954(GSM629280) total RNA. (blood) | SRR390300(GSM849858) cell line: NIH-3T3cell type: fibroblastinfect. (ago2 fibroblast) | SRR042446(GSM539838) mouse mature B cells (spleen) replicate 1 [09-002]. (b cell) | SRR037924(GSM510462) e9p5_rep2. (embryo) | SRR042487(GSM539879) mouse BclXL B activated with LPS/IL4 [BalbC] [09-002]. (spleen) | SRR042444(GSM539836) mouse pre B cells [09-002]. (b cell) | Ago1IP517(Rui) Quantitative functions of Argonaute proteins . (ago1 skin) | SRR042449(GSM539841) mouse B cells activated in vitro with LPS/IL4 replicate 2 [09-002]. (b cell) | SRR042480(GSM539872) mouse kidney tissue [09-002]. (kidney) | SRR029042(GSM433294) 18.5dpc_hetero_tdrd1-KO. (tdrd1 testes) | SRR042488(GSM539880) mouse BclXL germinal center B cells [BalbC] [09-002]. (B cell) | Ago2IP504(Rui) Quantitative functions of Argonaute proteins . (ago2 skin) | SRR042450(GSM539842) mouse B cells activated in vitro with LPS/IL4 replicate 3 [09-002]. (b cell) | Ago3IP812(Rui) Quantitative functions of Argonaute proteins . (ago3 skin) | SRR059766(GSM562828) DN3_Drosha. (thymus) | SRR525244(SRA056111/SRX170320) Mus musculus domesticus miRNA sequencing. (ago2 Blood) | SRR029037(GSM433289) 18dpp_homo_tdrd6-KO. (tdrd6 testes) | SRR065052(SRR065052) Tissue-specific Regulation of Mouse MicroRNA . (jejunum) | GSM509280(GSM509280) small RNA cloning by length. (testes) | SRR065054(SRR065054) Tissue-specific Regulation of Mouse MicroRNA . (jejunum) | SRR042478(GSM539870) mouse lung tissue [09-002]. (lung) | SRR391848(GSM852143) gender: femalegenotype/variation: wild typeti. (embryo) | SRR345199(SRX097260) source: size fractionated RNA from mouse hipp. (brain) | SRR042477(GSM539869) mouse brain tissue [09-002]. (brain) | SRR345202(SRX097263) source: size fractionated RNA from mouse hipp. (brain) | SRR042453(GSM539845) mouse marginal zone B cells (spleen) [09-002]. (b cell) | SRR391849(GSM852144) gender: femalegenotype/variation: ADAR2-/-tis. (embryo) | SRR065045(SRR065045) Tissue-specific Regulation of Mouse MicroRNA . (liver) | SRR345203(SRX097264) source: size fractionated RNA from mouse hipp. (brain) | SRR042483(GSM539875) mouse muscle tissue [09-002]. (muscle) | mjTestesKO8() Testes Data. (Zcchc11 testes) | GSM640578(GSM640578) small RNA in the liver with paternal control. (liver) | Ago3IP805(Rui) Quantitative functions of Argonaute proteins . (ago3 skin) | SRR029043(GSM433295) 18.5dpc_homo_tdrd1-KO. (tdrd1 testes) | SRR037921(GSM510459) e12p5_rep3. (embryo) | SRR039154(GSM471931) HL1_siSrf2_smallRNAseq. (muscle) | SRR039152(GSM471929) HL1_siNon_smallRNAseq. (muscle) | SRR553586(SRX182792) source: Testis. (testes) | SRR037936(GSM510474) 293cand1. (cell line) | GSM640581(GSM640581) small RNA in the liver with paternal control. (liver) | SRR345201(SRX097262) source: size fractionated RNA from mouse hipp. (brain) | SRR040489(GSM533912) E18.5 Ago2 catalytically inactive LIVER small RNA. (ago2 liver) | SRR065059(SRR065059) Tissue-specific Regulation of Mouse MicroRNA . (pancreas) | GSM519104(GSM519104) mouse_granulocyte_nuclei_smallRNAs. (cell line) | SRR525242(SRA056111/SRX170318) Mus musculus domesticus miRNA sequencing. (ago2 Blood) | Ago2IP517(Rui) Quantitative functions of Argonaute proteins . (ago2 skin) | SRR059771(GSM562833) CD4_control. (spleen) | SRR402762(SRX117945) source: ES E14 male cells. (ESC) | SRR346425(SRX098267) Global profiling of miRNA and the hairpin pre. (Neuroblastoma) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ............................................ACCCAGGTAAGGGACAAGA............................................................................................................................................................................................................................................................................................................................................................. | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | |
| ...................................................................................................................................................................................................................................................................................................................................................................................................CCCTTTGCCACTCCCTACT...... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .................................................................................................................................................................................................................................................................................................................................................AGTCTTCCACCCTCTGAA......................................................... | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .....................................................................................................................................................................................................................................................................................................................................................TTCCACCCTCTGCCCTTTG.................................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | |
| ........................................................................ACCGTCCGGGTTA....................................................................................................................................................................................................................................................................................................................................... | 13 | 3 | 0.33 | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.33 | - |
| .......................................................................................................................................................................................................................TCTACAAATAAGCCC...................................................................................................................................................................................... | 15 | 5 | 0.20 | 0.20 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.20 |