ID: uc008dha.11
GENE: Ddx11(12)
chr17:66489524-66489740+


(1)
AGO.mut 		(2)
AGO1.ip 		(11)
AGO2.ip 		(2)
AGO3.ip 		(8)
B-CELL 		(16)
BRAIN 		(4)
CELL-LINE 		(2)
DCR.mut 		(2)
DGCR8.mut 		(10)
EMBRYO 		(11)
ESC 		(5)
FIBROBLAST 		(5)
HEART 		(2)
KIDNEY 		(16)
LIVER 		(1)
LUNG 		(4)
LYMPH 		(25)
OTHER 		(9)
OTHER.mut 		(1)
OVARY 		(1)
PANCREAS 		(3)
PIWI.ip 		(5)
SKIN 		(8)
SPLEEN 		(23)
TESTES 		(3)
THYMUS 		(1)
UTERUS

Sense strand
TTTAGGTAATGTTAAGCAAAATCCTACTACACAGAGCCTGTCTCAAACAGGTGAGGAGGTTGCTGTCAAGGGTGGGAGGTGGTGTGAGCCACCCAGAGCTTACCAGATAGAACTGGGCTGAGAGGACTTGGTAAGGTACAAAACCAGCGTCCTTTGTCTGCTCACAGGGTCTGAGCTGAAGAGCATCAACGACTTTCTCTTTCAGAGCCAGGTGGAC
.................................................................................................................(((((.(((((((((((((..........))))).))))))..)).))))).....................................................
.........................................................................................................106..........................................................167................................................
SizePerfect hitTotal NormPerfect NormSRR546155(SRX180174)
Global profiling of miRNA and the hairpin pre. (ago2 Neuroblastoma)		SRR402760(SRX117943)
source: ES E14 male cells. (ESC)		SRR391852(GSM852147)
gender: femalegenotype/variation: ADAR2-/-tis. (embryo)		SRR346424(SRX098266)
Global profiling of miRNA and the hairpin pre. (Neuroblastoma)		SRR391853(GSM852148)
gender: femalegenotype/variation: ADAR2-/-/AD. (embryo)		SRR279907(GSM689057)
cell type: mouse embryonic stem cellcell line. (ESC)		SRR391851(GSM852146)
gender: femalegenotype/variation: wild typeti. (embryo)		SRR248526(GSM733814)
cell type: Thy1- spermatogonial stem cellstra. (testes)		SRR248525(GSM733813)
cell type: Thy1- spermatogonial stem cellstra. (testes)		SRR553602(SRX182808)
source: Sertoli cells. (Sertoli cells)		SRR346425(SRX098267)
Global profiling of miRNA and the hairpin pre. (Neuroblastoma)		SRR402762(SRX117945)
source: ES E14 male cells. (ESC)		SRR390299(GSM849857)
cell line: NIH-3T3cell type: fibroblastip ant. (ago2 fibroblast)		mjTestesWT4()
Testes Data. (testes)		SRR279904(GSM689054)
cell type: mouse embryonic stem cellcell line. (ESC)		mjTestesWT2()
Testes Data. (testes)		SRR391845(GSM852140)
gender: femalegenotype/variation: wild typeti. (embryo)		mjTestesKO7()
Testes Data. (Zcchc11 testes)		mjTestesWT1()
Testes Data. (testes)		mjTestesKO6()
Testes Data. (Zcchc11 testes)		SRR391848(GSM852143)
gender: femalegenotype/variation: wild typeti. (embryo)		mjLiverKO2()
Liver Data. (Zcchc11 liver)		SRR553583(SRX182789)
source: Cerebellum. (Cerebellum)		GSM519104(GSM519104)
mouse_granulocyte_nuclei_smallRNAs. (cell line)		SRR390297(GSM849855)
cell line: NIH-3T3cell type: fibroblastip ant. (fibroblast)		SRR391847(GSM852142)
gender: femalegenotype/variation: ADAR2-/-/AD. (embryo)		SRR391846(GSM852141)
gender: femalegenotype/variation: ADAR2-/-tis. (embryo)		SRR346414(SRX098255)
Global profiling of miRNA and the hairpin pre. (Spleen)		mjLiverKO3()
Liver Data. (Zcchc11 liver)		SRR346417(SRX098258)
Global profiling of miRNA and the hairpin pre. (Brain)		SRR390300(GSM849858)
cell line: NIH-3T3cell type: fibroblastinfect. (ago2 fibroblast)		SRR685340(GSM1079784)
"Small RNAs (15-50 nts in length) from immort. (dicer cell line)		SRR248523(GSM733811)
cell type: Thy1+ spermatogonial stem cellstra. (testes)		SRR248524(GSM733812)
cell type: Thy1+ spermatogonial stem cellstra. (testes)		SRR346415(SRX098256)
source: Testis. (Testes)		mjTestesKO8()
Testes Data. (Zcchc11 testes)		SRR059766(GSM562828)
DN3_Drosha. (thymus)		mjTestesWT3()
Testes Data. (testes)		mjLiverWT1()
Liver Data. (liver)		mjLiverWT3()
Liver Data. (liver)		SRR059769(GSM562831)
Treg_Drosha. (spleen)		SRR391849(GSM852144)
gender: femalegenotype/variation: ADAR2-/-tis. (embryo)		SRR248527(GSM733815)
cell type: spermatogonial stem cell enriched . (testes)		GSM640580(GSM640580)
small RNA in the liver with paternal Low pro. (liver)		SRR553604(SRX182810)
source: Spermatocytes. (Spermatocytes)		SRR042483(GSM539875)
mouse muscle tissue [09-002]. (muscle)		SRR346418(SRX098259)
Global profiling of miRNA and the hairpin pre. (Liver)		SRR402761(SRX117944)
source: ES E14 male cells. (ESC)		SRR391850(GSM852145)
gender: femalegenotype/variation: ADAR2-/-/AD. (embryo)		SRR116846(GSM678422)
Small RNA deep sequencing from mouse epididym. (epididymis)		SRR059765(GSM562827)
DN3_control. (thymus)		mjTestesKO5()
Testes Data. (Zcchc11 testes)		SRR042464(GSM539856)
mouse CD4+CD8+ T cells (thymus) [09-002]. (thymus)		SRR042459(GSM539851)
mouse neutrophil cells replicate 1 [09-002]. (blood)		SRR042451(GSM539843)
mouse B cells activated in vitro with LPS/aIgD-Dextran [09-002]. (b cell)		mjLiverKO1()
Liver Data. (Zcchc11 liver)		SRR553585(SRX182791)
source: Kidney. (Kidney)		GSM314557(GSM314557)
ESC dgcr8 (Illumina). (ESC)		SRR039184(GSM485324)
shLuc.1309 (+dox). (fibroblast)		GSM640579(GSM640579)
small RNA in the liver with paternal Low pro. (liver)		SRR073954(GSM629280)
total RNA. (blood)		SRR039186(GSM485326)
shLuc.1309;ROSA-rtTA (+dox). (fibroblast)		SRR553584(SRX182790)
source: Heart. (Heart)		Ago2IP504(Rui)
Quantitative functions of Argonaute proteins . (ago2 skin)		SRR346422(SRX098264)
Global profiling of miRNA and the hairpin pre. (Muscle)		SRR346419(SRX098260)
Global profiling of miRNA and the hairpin pre. (Lung)		SRR279903(GSM689053)
cell type: mouse embryonic stem cellcell line. (ESC)		SRR038742(GSM527277)
small RNA-Seq. (dgcr8 brain)		SRR065053(SRR065053)
Tissue-specific Regulation of Mouse MicroRNA . (jejunum)		Ago2IP517(Rui)
Quantitative functions of Argonaute proteins . (ago2 skin)		SRR042472(GSM539864)
mouse iTreg cells [09-002]. (lymph)		SRR029037(GSM433289)
18dpp_homo_tdrd6-KO. (tdrd6 testes)		GSM509280(GSM509280)
small RNA cloning by length. (testes)		SRR034121(GSM466731)
Mili IP_Tdrd9-/- replicate2. (mili testes)		SRR402766(SRX117949)
source: ES PGK female cells. (ESC)		SRR279906(GSM689056)
cell type: mouse embryonic stem cellcell line. (ESC)		SRR206940(GSM723281)
other. (brain)		GSM475280(GSM475280)
Mili-IP. (mili testes)		SRR042456(GSM539848)
mouse hematopoetic progenitor cells [09-002]. (bone marrow)		SRR014232(GSM319956)
16.5 dpc MILI. (mili testes)		SRR042447(GSM539839)
mouse mature B cells (spleen) replicate 2 [09-002]. (b cell)		SRR553586(SRX182792)
source: Testis. (testes)		SRR685339(GSM1079783)
"Small RNAs (15-50 nts in length) from immort. (cell line)		SRR040489(GSM533912)
E18.5 Ago2 catalytically inactive LIVER small RNA. (ago2 liver)		SRR095855BC8(SRX039178)
sequencing of miRNA from wild type and diseas. (heart)		SRR525244(SRA056111/SRX170320)
Mus musculus domesticus miRNA sequencing. (ago2 Blood)		SRR042469(GSM539861)
mouse Th2 cells [09-002]. (lymph)		SRR042471(GSM539863)
mouse TFHS cells [09-002]. (spleen)		SRR042473(GSM539865)
mouse nTreg cells [09-002]. (lymph)		GSM640578(GSM640578)
small RNA in the liver with paternal control. (liver)		SRR042466(GSM539858)
mouse CD8+ T cells (spleen) [09-002]. (spleen)		SRR306536(GSM750579)
19-24nt. (ago2 brain)		SRR345200(SRX097261)
source: size fractionated RNA from mouse hipp. (brain)		GSM640581(GSM640581)
small RNA in the liver with paternal control. (liver)		SRR553582(SRX182788)
source: Brain. (Brain)		SRR042460(GSM539852)
mouse neutrophil cells replicate 2 [09-002]. (blood)		SRR059770(GSM562832)
Treg_Dicer. (spleen)		SRR306541(GSM750584)
19-24nt. (ago2 brain)		SRR065052(SRR065052)
Tissue-specific Regulation of Mouse MicroRNA . (jejunum)		SRR042470(GSM539862)
mouse Th17 cells [09-002]. (lymph)		SRR042444(GSM539836)
mouse pre B cells [09-002]. (b cell)		SRR042465(GSM539857)
mouse CD4+ T cells (spleen) [09-002]. (spleen)		SRR038743(GSM527278)
small RNA-Seq. (dicer brain)		SRR525237(SRA056111/SRX170313)
Mus musculus domesticus miRNA sequencing. (Blood)		SRR095855BC6(SRX039178)
sequencing of miRNA from wild type and diseas. (heart)		SRR553603(SRX182809)
source: Spermatids. (Spermatids)		SRR042448(GSM539840)
mouse B cells activated in vitro with LPS/IL4 replicate 1 [09-002]. (b cell)		SRR029042(GSM433294)
18.5dpc_hetero_tdrd1-KO. (tdrd1 testes)		SRR059776(GSM562838)
MEF_Dicer. (MEF)		GSM640583(GSM640583)
small RNA in the liver with paternal Low prot. (liver)		SRR069834(GSM304914)
Analysis of small RNAs in murine neutrophils cultured in vitro by Solexa/Illumina genome analyzer. (blood)		SRR525243(SRA056111/SRX170319)
Mus musculus domesticus miRNA sequencing. (ago2 Blood)		Ago3IP805(Rui)
Quantitative functions of Argonaute proteins . (ago3 skin)		SRR059774(GSM562836)
MEF_control. (MEF)		SRR038745(GSM527280)
small RNA-Seq. (dgcr8 brain)		SRR525239(SRA056111/SRX170315)
Mus musculus domesticus miRNA sequencing. (ago1 Blood)		SRR306533(GSM750576)
19-24nt. (ago2 brain)		SRR346413(SRX098254)
Global profiling of miRNA and the hairpin pre. (Heart)		GSM361395(GSM361395)
CGNP_P6_wt_rep2. (brain)		SRR037921(GSM510459)
e12p5_rep3. (embryo)		SRR206939(GSM723280)
other. (brain)		SRR042488(GSM539880)
mouse BclXL germinal center B cells [BalbC] [09-002]. (B cell)		SRR346416(SRX098257)
Global profiling of miRNA and the hairpin pre. (Kidney)		SRR306527(GSM750570)
19-24nt. (ago2 brain)		SRR039153(GSM471930)
HL1_siSrf1_smallRNAseq. (muscle)		SRR077865(GSM637802)
18-30 nt small RNAs. (liver)		Ago3IP812(Rui)
Quantitative functions of Argonaute proteins . (ago3 skin)		SRR059771(GSM562833)
CD4_control. (spleen)		Ago1IP812(Rui)
Quantitative functions of Argonaute proteins . (ago1 skin)		SRR042454(GSM539846)
mouse germinal center B cells (lymph node) [09-002]. (b cell)		SRR042486(GSM539878)
mouse ovaries [09-002]. (ovary)		SRR042449(GSM539841)
mouse B cells activated in vitro with LPS/IL4 replicate 2 [09-002]. (b cell)		SRR042481(GSM539873)
mouse pancreatic tissue [09-002]. (pancreas)		SRR095855BC7(SRX039178)
sequencing of miRNA from wild type and diseas. (heart)		SRR346420(SRX098261)
Global profiling of miRNA and the hairpin pre. (Uterus)		GSM314552(GSM314552)
ESC wild type (Illumina). (ESC)		SRR037937(GSM510475)
293cand2. (cell line)		SRR040488(GSM533911)
E18.5 wild type LIVER small RNA. (liver)		GSM361398(GSM361398)
CGNP_P6_p53--_Ink4c--_rep1. (brain)		SRR042463(GSM539855)
mouse natural killer cells [09-002]. (spleen)		SRR042446(GSM539838)
mouse mature B cells (spleen) replicate 1 [09-002]. (b cell)		SRR014231(GSM319955)
16.5 dpc total. (testes)		SRR059775(GSM562837)
MEF_Drosha. (MEF)		SRR077864(GSM637801)
18-30 nt small RNAs. (liver)		GSM361402(GSM361402)
CGNP_P6_p53--_Ink4c--_rep5. (brain)		GSM509279(GSM509279)
MVH-/- E16.5 small RNA. (testes)		SRR065050(SRR065050)
Tissue-specific Regulation of Mouse MicroRNA . (liver)		SRR345204(SRX097265)
source: size fractionated RNA from mouse hipp. (brain)		SRR042474(GSM539866)
mouse embryonic stem cells [09-002]. (ESC)
..............................................................................................................AACTGGGCTGAGAGGACTTGGT.....................................................................................221501.00501.00159.0023.0022.0017.0017.0026.0016.0018.009.0014.0012.0010.0021.004.0014.008.008.003.0010.004.008.00-3.001.00-5.005.004.003.002.00--4.003.005.00-1.00--3.003.001.002.001.001.00-1.002.001.002.001.001.001.00----1.001.00-3.002.00-2.001.00-2.001.00-1.00------------2.00-1.00----1.00-------1.00--------------1.00---------------1.00----1.00---------------
...............................................................................................................ACTGGGCTGAGAGGACTTGGT.....................................................................................211409.00409.00113.0048.0013.0019.0012.0013.0013.0011.0017.0010.003.009.002.008.005.005.001.002.009.004.005.00-4.001.0012.003.005.002.00-5.00--2.002.001.003.001.005.00-2.00-1.003.001.003.00-1.001.002.001.00----1.00-2.002.00-1.00--1.00---1.001.00-2.00-1.001.00-1.001.00-----2.00--1.00----1.001.00---1.00---------1.00--------1.00---1.00----1.00-----------1.00--------------
................................................................................................................CTGGGCTGAGAGGACTTGGT.....................................................................................20184.0084.0030.0014.002.001.002.004.005.001.003.002.001.001.00--2.001.00---5.00---1.00-1.00--1.00----------1.00---------------2.001.00------1.00--------------------------------------------------------------1.00----------1.00-----------
..............................................................................................................AACTGGGCTGAGAGGACTTGG......................................................................................21183.0083.0022.006.003.004.001.003.00-5.004.004.002.002.001.00--2.00-6.00-2.002.00-1.00------1.00---1.001.001.001.00-----1.001.00---1.00-1.00------------1.00-1.00--1.00---------------------------------------------------1.00-----------------------------
...............................................................................................................ACTGGGCTGAGAGGACTTGG......................................................................................20164.0064.0016.0010.001.003.003.003.003.00-3.00-3.00-1.00--3.00-1.00---------1.004.00---1.00-----------------1.00---------------------1.00------------------2.00----------1.00-----------1.00-----1.00------------------------1.00---
...............................................................................................................ACTGGGCTGAGAGGACTTGGTA....................................................................................22146.0046.0010.00-3.001.004.00-2.001.00-1.00-2.00-5.00-1.001.003.00-2.00--------2.00-2.00-----2.00----------------1.001.00----1.00----------------1.00------------------------------------------------------------------------
..............................................................................................................AACTGGGCTGAGAGGACTTGGTA....................................................................................23135.0035.008.00-1.004.003.00-4.00-1.00---2.00----3.00----1.001.00----------2.00---------1.00--------1.001.00----------1.00----------------------------------------1.00------------------------------------------
..............................................................................................................AACTGGGCTGAGAGGACTTGGTAT...................................................................................24132.0035.001.00-1.00---1.002.00--1.00-----2.00------1.00--------------7.00-2.001.00---2.00-------------1.00----------1.00-----1.00---------2.001.001.00----------1.00---1.00-----------1.00--------------------------------1.00
...............................................................................................................ACTGGGCTGAGAGGACTTGGTAT...................................................................................23130.0046.001.00-2.00---1.002.001.00-----------2.00--------1.00-------------1.00-4.00------2.001.001.00-1.00-------------1.00-------1.00-1.00----1.00--1.00------1.001.00---------------------------------1.00---------1.00-----1.00--
..............................................................................................................AACTGGGCTGAGAGGACTTGGA.....................................................................................22122.0083.003.00-2.003.001.00-3.001.001.001.00-------2.00----1.001.00-----1.00------1.00----------------------------------------------------------------------------------------------------------1.00-----
...............................................................................................................ACTGGGCTGAGAGGACTTGGTAA...................................................................................23119.0019.00--3.001.00-------1.00----3.00-----1.00---1.00---------1.00----1.00-----------------------------------------2.00-1.00---------------------1.00---------------1.00-1.00-------------1.00---------
...............................................................................................................ACTGGGCTGAGAGGACTTGGTT....................................................................................22118.00409.005.00---3.00--2.00-1.00----1.00-1.00-----1.00----1.00------------------1.00-----------------------------------------------------------------------------1.00------1.00-----------------
...............................................................................................................ACTGGGCTGAGAGGACTTGGA.....................................................................................21117.0064.004.00-1.001.00-3.00-2.00------1.00--1.00----1.001.00--------1.00--1.00-----------------------------------------------------------------------------------------------------------------
..............................................................................................................AACTGGGCTGAGAGGACTTGGTT....................................................................................23114.00501.001.00--2.001.00--2.00-------1.00-----------1.00--------------------1.00-1.00--------------1.00--1.00----------2.00---------------------------------------------------------------------
...............................................................................................................ACTGGGCTGAGAGGACTTGAAA....................................................................................2214.000.00---------------------14.00-------------------------------------------------------------------------------------------------------------------------------
..............................................................................................................AACTGGGCTGAGAGGACTTGGTAA...................................................................................24113.0013.00--3.00-1.00--1.00-----------------1.00---------2.00-----------1.00---1.00----------------2.00-----------1.00--------------------------------------------------------------------
................................................................................................................CTGGGCTGAGAGGACTTGGTA....................................................................................21111.0011.004.00-2.00--3.001.00--------------------------------------------------------------------1.00-------------------------------------------------------------------------
................................................................................................................CTGGGCTGAGAGGACTTGGTT....................................................................................21110.0084.004.00-3.00------1.00-------------1.00-----------------------------------------------1.00-----------------------------------------------------------------------------
.............................................................................................................................................AACCAGCGTCCTTTGTCTGCTCACA...................................................2519.009.00-------------------------------9.00---------------------------------------------------------------------------------------------------------------------
................................................................................................................CTGGGCTGAGAGGACTTGGTAA...................................................................................2219.009.002.00---3.00-1.00-----------------------1.00-------------------------------------------1.00---------------------------------------------------------1.00----------------
................................................................................................................CTGGGCTGAGAGGACTTGG......................................................................................1918.008.00-3.00----1.00------3.00-----------------------------------------------------------------------------------------------------------1.00---------------------------
..............................................................................................................AACTGGGCTGAGAGGACTTGGTAAT..................................................................................2517.0013.00-------------6.00---------1.00-----------------------------------------------------------------------------------------------------------------------------
...........................................................................................................TAGAACTGGGCTGAGAGGACTTGGT.....................................................................................2517.007.00------------------------------7.00----------------------------------------------------------------------------------------------------------------------
.............................................................................................................GAACTGGGCTGAGAGGACTTGGT.....................................................................................2316.006.00-4.00-1.00-----------------------------1.00-------------------------------------------------------------------------------------------------------------------
..............................................................................................................AACTGGGCTGAGAGGACTTGGTTT...................................................................................2415.00501.00---------------------------------1.00------1.001.00--------1.00---------------------------1.00----------------------------------------------------------------------
...............................................................................................................ACTGGGCTGAGAGGACTTGGAA....................................................................................2215.0064.002.00---------------2.00-------------------------------------------------------------------------1.00----------------------------------------------------------
................................................................................................................CTGGGCTGAGAGGACTTGGTAT...................................................................................2215.0011.001.00--2.00-----------------------------1.00-------------------------------------------------------------1.00-----------------------------------------------------
...............................................................................................................ACTGGGCTGAGAGGACTTGGTTT...................................................................................2315.00409.00----------------1.00----------1.00------------------1.00------1.00-----------------------------------------------1.00-----------------------------------------------
..............................................................................................................AACTGGGCTGAGAGGACTTG.......................................................................................2014.004.001.00--------1.00------1.00--------------------------------------------1.00---------------------------------------------------------------------------------------
..............................................................................................................AACTGGGCTGAGAGGACTTGA......................................................................................2114.004.002.00---------1.00-----------------------------------1.00------------------------------------------------------------------------------------------------------
.................................................................................................................TGGGCTGAGAGGACTTGGTAT...................................................................................214.000.002.00--1.00------1.00------------------------------------------------------------------------------------------------------------------------------------------
...............................................................................................................ACTGGGCTGAGAGGACTTGGTAAT..................................................................................2414.0019.00--1.00--------------------1.00----1.00----------------------------------------------------------------1.00-------------------------------------------------------
..............................................................................................................AACTGGGCTGAGAGGACTTGGTG....................................................................................2313.00501.00----1.00----------1.00-------------------------1.00-----------------------------------------------------------------------------------------------------------
.................................................................................................................TGGGCTGAGAGGACTTGGT.....................................................................................1913.003.00---1.00------------1.00--------------------------------------------------------------------------------------------------------------1.00---------------------
..............................................................................................................AACTGGGCTGAGAGGACTTGGG.....................................................................................2213.0083.002.00----------------------------------1.00-----------------------------------------------------------------------------------------------------------------
................................................................................................................CTGGGCTGAGAGGACTTGGTAAAA.................................................................................2413.009.00--2.00------1.00-------------------------------------------------------------------------------------------------------------------------------------------
..............................................................................................................AACTGGGCTGAGAGGACTTGGTTA...................................................................................2413.00501.00-------------------------------------------2.00--------------1.00------------------------------------------------------------------------------------------
...............................................................................................................ACTGGGCTGAGAGGACT.........................................................................................1713.003.00-----------2.00-------------------------------------------------------------------------------------------------1.00---------------------------------------
..............................................................................................................AACTGGGCTGAGAGGACTT........................................................................................1913.003.001.00---------1.00----------------------------------------------------------------------------------------------------------------------------1.00-------------
..............................................................................................................AACTGGGCTGAGAGGACTTGGTAAAT.................................................................................2612.0013.00-------------------------------------------------------2.00---------------------------------------------------------------------------------------------
................................................................................................................................................CAGCGTCCTTTGTCTGCTCACAG..................................................2312.002.00----2.00------------------------------------------------------------------------------------------------------------------------------------------------
................................................................................................................CTGGGCTGAGAGGACTTGGTTT...................................................................................2212.0084.001.00-----1.00----------------------------------------------------------------------------------------------------------------------------------------------
................................................................................................................CTGGGCTGAGAGGACTTGGA.....................................................................................2012.008.00---1.00-----------------------------------1.00-------------------------------------------------------------------------------------------------------------
...............................................................................................................ACTGGGCTGAGAGGACTTGGTTA...................................................................................2312.00409.00--2.00--------------------------------------------------------------------------------------------------------------------------------------------------
............................................................................................................AGAACTGGGCTGAGAGGACTTGGT.....................................................................................2412.002.00--1.00---------------------------------------------1.00----------------------------------------------------------------------------------------------------
..............................................................................................................AACTGGGCTGAGAGGACTTGT......................................................................................2112.004.00----------1.00-----------------------------------------------------------------------------------1.00------------------------------------------------------
..............................................................................................................AACTGGGCTGAGAGGACT.........................................................................................1812.002.00----------------------------------------------------1.00-----------------------------------------------1.00------------------------------------------------
.........................................................................................................................................................TTGTCTGCTCACAGGGTCTGAGCTG.......................................2512.002.00-------------------------------------2.00---------------------------------------------------------------------------------------------------------------
..............................................................................................................AACTGGGCTGAGAGGACTTGGCA....................................................................................2312.0083.001.00--1.00-------------------------------------------------------------------------------------------------------------------------------------------------
...............................................................................................................ACTGGGCTGAGAGGACTT........................................................................................1812.002.00-------1.00-----------------1.00---------------------------------------------------------------------------------------------------------------------------
..............................................................................................................AACTGGGCTGAGAGGACTTGGTACC..................................................................................2512.0035.002.00----------------------------------------------------------------------------------------------------------------------------------------------------
...............................................................................................................ACTGGGCTGAGAGGACTTGGTAG...................................................................................2312.0046.00----------------------------------------------1.00----1.00-------------------------------------------------------------------------------------------------
..............................................................................................................AACTGGGCTGAGAGGACTTGGTAG...................................................................................2412.0035.00--------------------------------------------------------------1.00------------------------1.00-------------------------------------------------------------
..............................................................................................................AACTGGGCTGAGAGGACTTGGTGT...................................................................................2412.00501.00----------------------1.00-------------1.00----------------------------------------------------------------------------------------------------------------
...............................................................................................................ACTGGGCTGAGAGGACTTCGT.....................................................................................2112.002.001.00--------------------------------------------------------------------------------------------1.00-------------------------------------------------------
.....................................................................................................................................................................AGGGTCTGAGCTGAAGAGCAT...............................2111.001.00--1.00--------------------------------------------------------------------------------------------------------------------------------------------------
.........TGTTAAGCAAAATCCTACTACACAGAGC....................................................................................................................................................................................2811.001.00-----------------------------------------------------------------------------1.00-----------------------------------------------------------------------
.................................................................................................................TGGGCTGAGAGGACTTGGTAA...................................................................................2111.001.00------------------------------------------------------------------------------------------------------------1.00----------------------------------------
...............................................................................................................ACTGGGCTGAGAGGACTTGGTATAT.................................................................................2511.0046.00--------------------------------------------------------------------------------------------------------------1.00--------------------------------------
.................................................................................................................TGGGCTGAGAGGACTTGGTT....................................................................................2011.003.00----------------1.00------------------------------------------------------------------------------------------------------------------------------------
................................................................................................................CTGGGCTGAGAGGACTTGGTAAA..................................................................................2311.009.00--------------------------------------------------------------------------------------------------------------------1.00--------------------------------
..............................................................................................................AACTGGGCTGAGAGGACTTGGTGA...................................................................................2411.00501.00-----------------1.00-----------------------------------------------------------------------------------------------------------------------------------
.......................................................................................................................................................................................CATCAACGACTTTCTCTTTCAGAGCC........2611.001.00--------------------------------------------1.00--------------------------------------------------------------------------------------------------------
...............................................................................................................ACTGGGCTGAGAGGACTTGGTAAAT.................................................................................2511.0019.00------1.00----------------------------------------------------------------------------------------------------------------------------------------------
...............................................................................................................ACTGGGCTGAGAGGACTTTG......................................................................................2011.002.001.00----------------------------------------------------------------------------------------------------------------------------------------------------
................................................................................................................CTGGGCTGAGAGGACTTGGAAA...................................................................................2211.008.00--1.00--------------------------------------------------------------------------------------------------------------------------------------------------
...............................................................................................................ACTGGGCTGAGAGGACTTGGTATAAG................................................................................2611.0046.00--------------------------------------------------------------------------------------------------1.00--------------------------------------------------
.............................................................................................................................................AACCAGCGTCCTTTGTCTGCTAACA...................................................251.000.00-------------------------------1.00---------------------------------------------------------------------------------------------------------------------
...............................................................................................................ACTGGGCTGAGAGGACTTGGTGT...................................................................................2311.00409.00---1.00-------------------------------------------------------------------------------------------------------------------------------------------------
..............................................................................................................AACTGGGCTGAGAGGACTGGGT.....................................................................................2211.002.001.00----------------------------------------------------------------------------------------------------------------------------------------------------
.......AATGTTAAGCAAAATCCTCGT.............................................................................................................................................................................................211.000.00--------------------------------------------------------------------------------------------1.00--------------------------------------------------------
.................................................................................................................TGGGCTGAGAGGACTTGGGAAT..................................................................................221.000.00----------1.00------------------------------------------------------------------------------------------------------------------------------------------
...............................................................................................................ACTGGGCTGAGAGGACTTGGTATT..................................................................................2411.0046.00---------------------------1.00-------------------------------------------------------------------------------------------------------------------------
...............................................................................................................ACTGGGCTGAGAGGACTTGA......................................................................................201.000.001.00----------------------------------------------------------------------------------------------------------------------------------------------------
..............................................................................................................AACTGGGCTGAGAGGACTTGGTTTA..................................................................................2511.00501.00---------------------------------------------------------------------------------------------------------------------------------------------1.00-------
..............................................................................................................AACTGGGCTGAGAGGACTTGGAAAG..................................................................................2511.0083.001.00----------------------------------------------------------------------------------------------------------------------------------------------------
...........................................................................................................TAGAACTGGGCTGAGAGGGGGA........................................................................................221.000.00---------------------------------------------------------------------------------------------------------------------------------------------------1.00-
.............................................................................................................GAACTGGGCTGAGAGGACTTGG......................................................................................2211.001.00---1.00-------------------------------------------------------------------------------------------------------------------------------------------------
.............................................................................................................GAACTGGGCTGAGAGGACTTGGTAT...................................................................................251.000.00----------1.00------------------------------------------------------------------------------------------------------------------------------------------
..............................................................................................................AACTGGGCTGAGAGGACTTGGTATAT.................................................................................2611.0035.001.00----------------------------------------------------------------------------------------------------------------------------------------------------
...............................................................................................................ACTGGGCTGAGAGGACTTGGAAA...................................................................................2311.0064.00----------------------------------------------------------1.00------------------------------------------------------------------------------------------
................................................................................................................CTGGGCTGAGAGGACTTGGATA...................................................................................2211.008.00-----------------------1.00-----------------------------------------------------------------------------------------------------------------------------
...............................................................................................................ACTGGGCTGAGAGGACTTGGCAT...................................................................................2311.0064.00---------------------------------------------------------------------------------------------------------------1.00-------------------------------------
...............................................................................................................ACTGGGCTGAGAGGACTTA.......................................................................................1911.002.00---1.00-------------------------------------------------------------------------------------------------------------------------------------------------
...............GCAAAATCCTACTACACAGAGCCTGTCTC.............................................................................................................................................................................2911.001.00-----------------------------------------------------------------------------1.00-----------------------------------------------------------------------
..............................................................................................................AACTGGGCTGAGAGGACTTGTAT....................................................................................2311.004.00----------------------------------------------------------------1.00------------------------------------------------------------------------------------
...................................................................AAGGGTGGGAGGTGGTGTT...................................................................................................................................191.000.00--------------------------------------------------------------------------------------------1.00--------------------------------------------------------
..............................................................................................................AACTGGGCTGAGAGGACTTGAG.....................................................................................2211.004.001.00----------------------------------------------------------------------------------------------------------------------------------------------------
................................................................................................................CTGGGCTGAGAGGACTTGGTATT..................................................................................2311.0011.00---------1.00-------------------------------------------------------------------------------------------------------------------------------------------
..............................................................................................................AACTGGGCTGAGAGGACTTGGAAA...................................................................................2411.0083.00---------------------------------------------------1.00-------------------------------------------------------------------------------------------------
..............................................................................................................AACTGGGCTGAGAGGACTTGGTAAC..................................................................................2511.0013.00---------1.00-------------------------------------------------------------------------------------------------------------------------------------------
...............................................................................................................ACTGGGCTGAGAGGACTTGTT.....................................................................................211.000.001.00----------------------------------------------------------------------------------------------------------------------------------------------------
..............................................................................................................AACTGGGCTGAGAGGACTTGGTAGA..................................................................................2511.0035.00-------------------1.00---------------------------------------------------------------------------------------------------------------------------------
...............................................................................................................ACTGGGCTGAGAGGACTTGGTAGA..................................................................................2411.0046.00-----------------------------------------------------------------1.00-----------------------------------------------------------------------------------
.........................................................................................................................................................................TCTGAGCTGAAGAGCATCAACGACTTTC....................2811.001.00-------------------------------------------------------------------------1.00---------------------------------------------------------------------------
...................................................................................................................................................................ACAGGGTCTGAGCTGAAGAGCATA..............................241.000.00---------------------------------------------------------------------------------------------------------------------------------1.00-------------------
..............................................................................................................AACTGGGCTGAGAGGACTAGGT.....................................................................................2211.002.00--------------------------------1.00--------------------------------------------------------------------------------------------------------------------
................................................................................................................CTGGGCTGAGAGGACTTGAA.....................................................................................201.000.00-----------------------1.00-----------------------------------------------------------------------------------------------------------------------------
.................................................................................................................TGGGCTGAGAGGACTTGGTTT...................................................................................2111.003.00----------------------------------------------------------------------------------------------------------------------------------------------1.00------
..............................................................................................................AACTGGGCTGAGAGGACTTGGAA....................................................................................2311.0083.00----------------------------------------1.00------------------------------------------------------------------------------------------------------------
..............................................................................................................AACTGGGCTGAGAGGACTTGGTAGAAT................................................................................2711.0035.00---------------1.00-------------------------------------------------------------------------------------------------------------------------------------
..............................................................................................................AACTGGGCTGAGAGGACTTGGTATT..................................................................................2511.0035.00-----------------------1.00-----------------------------------------------------------------------------------------------------------------------------
.................................................................................................................TGGGCTGAGAGGACTTGGTAAGGTACAAAT..........................................................................301.000.00---------------------------------------------------------------------------------------------------------1.00-------------------------------------------
................................................................................................................CTGGGCTGAGAGGACTTGGTTAGA.................................................................................2411.0084.00----1.00------------------------------------------------------------------------------------------------------------------------------------------------
...............................................................................................................ACTGGGCTGAGAGGACTTTGT.....................................................................................2111.002.001.00----------------------------------------------------------------------------------------------------------------------------------------------------
................................................................................................................CTGGGCTGAGAGGACTTGTT.....................................................................................201.000.00------1.00----------------------------------------------------------------------------------------------------------------------------------------------
...........................................................................................................................................................................TGAGCTGAAGAGCATCAACGACTTTC....................2611.001.00-------------------------------------------------------------------------1.00---------------------------------------------------------------------------
..............................ACAGAGCCTGTCTCAAACAGGT.....................................................................................................................................................................2211.001.00--1.00--------------------------------------------------------------------------------------------------------------------------------------------------
..............................................................................................................AACTGGGCTGAGAGGA...........................................................................................1650.200.20---------------------------------------------------------0.20-------------------------------------------------------------------------------------------

Antisense strand
TTTAGGTAATGTTAAGCAAAATCCTACTACACAGAGCCTGTCTCAAACAGGTGAGGAGGTTGCTGTCAAGGGTGGGAGGTGGTGTGAGCCACCCAGAGCTTACCAGATAGAACTGGGCTGAGAGGACTTGGTAAGGTACAAAACCAGCGTCCTTTGTCTGCTCACAGGGTCTGAGCTGAAGAGCATCAACGACTTTCTCTTTCAGAGCCAGGTGGAC
.................................................................................................................(((((.(((((((((((((..........))))).))))))..)).))))).....................................................
.........................................................................................................106..........................................................167................................................
SizePerfect hitTotal NormPerfect NormSRR546155(SRX180174)
Global profiling of miRNA and the hairpin pre. (ago2 Neuroblastoma)		SRR402760(SRX117943)
source: ES E14 male cells. (ESC)		SRR391852(GSM852147)
gender: femalegenotype/variation: ADAR2-/-tis. (embryo)		SRR346424(SRX098266)
Global profiling of miRNA and the hairpin pre. (Neuroblastoma)		SRR391853(GSM852148)
gender: femalegenotype/variation: ADAR2-/-/AD. (embryo)		SRR279907(GSM689057)
cell type: mouse embryonic stem cellcell line. (ESC)		SRR391851(GSM852146)
gender: femalegenotype/variation: wild typeti. (embryo)		SRR248526(GSM733814)
cell type: Thy1- spermatogonial stem cellstra. (testes)		SRR248525(GSM733813)
cell type: Thy1- spermatogonial stem cellstra. (testes)		SRR553602(SRX182808)
source: Sertoli cells. (Sertoli cells)		SRR346425(SRX098267)
Global profiling of miRNA and the hairpin pre. (Neuroblastoma)		SRR402762(SRX117945)
source: ES E14 male cells. (ESC)		SRR390299(GSM849857)
cell line: NIH-3T3cell type: fibroblastip ant. (ago2 fibroblast)		mjTestesWT4()
Testes Data. (testes)		SRR279904(GSM689054)
cell type: mouse embryonic stem cellcell line. (ESC)		mjTestesWT2()
Testes Data. (testes)		SRR391845(GSM852140)
gender: femalegenotype/variation: wild typeti. (embryo)		mjTestesKO7()
Testes Data. (Zcchc11 testes)		mjTestesWT1()
Testes Data. (testes)		mjTestesKO6()
Testes Data. (Zcchc11 testes)		SRR391848(GSM852143)
gender: femalegenotype/variation: wild typeti. (embryo)		mjLiverKO2()
Liver Data. (Zcchc11 liver)		SRR553583(SRX182789)
source: Cerebellum. (Cerebellum)		GSM519104(GSM519104)
mouse_granulocyte_nuclei_smallRNAs. (cell line)		SRR390297(GSM849855)
cell line: NIH-3T3cell type: fibroblastip ant. (fibroblast)		SRR391847(GSM852142)
gender: femalegenotype/variation: ADAR2-/-/AD. (embryo)		SRR391846(GSM852141)
gender: femalegenotype/variation: ADAR2-/-tis. (embryo)		SRR346414(SRX098255)
Global profiling of miRNA and the hairpin pre. (Spleen)		mjLiverKO3()
Liver Data. (Zcchc11 liver)		SRR346417(SRX098258)
Global profiling of miRNA and the hairpin pre. (Brain)		SRR390300(GSM849858)
cell line: NIH-3T3cell type: fibroblastinfect. (ago2 fibroblast)		SRR685340(GSM1079784)
"Small RNAs (15-50 nts in length) from immort. (dicer cell line)		SRR248523(GSM733811)
cell type: Thy1+ spermatogonial stem cellstra. (testes)		SRR248524(GSM733812)
cell type: Thy1+ spermatogonial stem cellstra. (testes)		SRR346415(SRX098256)
source: Testis. (Testes)		mjTestesKO8()
Testes Data. (Zcchc11 testes)		SRR059766(GSM562828)
DN3_Drosha. (thymus)		mjTestesWT3()
Testes Data. (testes)		mjLiverWT1()
Liver Data. (liver)		mjLiverWT3()
Liver Data. (liver)		SRR059769(GSM562831)
Treg_Drosha. (spleen)		SRR391849(GSM852144)
gender: femalegenotype/variation: ADAR2-/-tis. (embryo)		SRR248527(GSM733815)
cell type: spermatogonial stem cell enriched . (testes)		GSM640580(GSM640580)
small RNA in the liver with paternal Low pro. (liver)		SRR553604(SRX182810)
source: Spermatocytes. (Spermatocytes)		SRR042483(GSM539875)
mouse muscle tissue [09-002]. (muscle)		SRR346418(SRX098259)
Global profiling of miRNA and the hairpin pre. (Liver)		SRR402761(SRX117944)
source: ES E14 male cells. (ESC)		SRR391850(GSM852145)
gender: femalegenotype/variation: ADAR2-/-/AD. (embryo)		SRR116846(GSM678422)
Small RNA deep sequencing from mouse epididym. (epididymis)		SRR059765(GSM562827)
DN3_control. (thymus)		mjTestesKO5()
Testes Data. (Zcchc11 testes)		SRR042464(GSM539856)
mouse CD4+CD8+ T cells (thymus) [09-002]. (thymus)		SRR042459(GSM539851)
mouse neutrophil cells replicate 1 [09-002]. (blood)		SRR042451(GSM539843)
mouse B cells activated in vitro with LPS/aIgD-Dextran [09-002]. (b cell)		mjLiverKO1()
Liver Data. (Zcchc11 liver)		SRR553585(SRX182791)
source: Kidney. (Kidney)		GSM314557(GSM314557)
ESC dgcr8 (Illumina). (ESC)		SRR039184(GSM485324)
shLuc.1309 (+dox). (fibroblast)		GSM640579(GSM640579)
small RNA in the liver with paternal Low pro. (liver)		SRR073954(GSM629280)
total RNA. (blood)		SRR039186(GSM485326)
shLuc.1309;ROSA-rtTA (+dox). (fibroblast)		SRR553584(SRX182790)
source: Heart. (Heart)		Ago2IP504(Rui)
Quantitative functions of Argonaute proteins . (ago2 skin)		SRR346422(SRX098264)
Global profiling of miRNA and the hairpin pre. (Muscle)		SRR346419(SRX098260)
Global profiling of miRNA and the hairpin pre. (Lung)		SRR279903(GSM689053)
cell type: mouse embryonic stem cellcell line. (ESC)		SRR038742(GSM527277)
small RNA-Seq. (dgcr8 brain)		SRR065053(SRR065053)
Tissue-specific Regulation of Mouse MicroRNA . (jejunum)		Ago2IP517(Rui)
Quantitative functions of Argonaute proteins . (ago2 skin)		SRR042472(GSM539864)
mouse iTreg cells [09-002]. (lymph)		SRR029037(GSM433289)
18dpp_homo_tdrd6-KO. (tdrd6 testes)		GSM509280(GSM509280)
small RNA cloning by length. (testes)		SRR034121(GSM466731)
Mili IP_Tdrd9-/- replicate2. (mili testes)		SRR402766(SRX117949)
source: ES PGK female cells. (ESC)		SRR279906(GSM689056)
cell type: mouse embryonic stem cellcell line. (ESC)		SRR206940(GSM723281)
other. (brain)		GSM475280(GSM475280)
Mili-IP. (mili testes)		SRR042456(GSM539848)
mouse hematopoetic progenitor cells [09-002]. (bone marrow)		SRR014232(GSM319956)
16.5 dpc MILI. (mili testes)		SRR042447(GSM539839)
mouse mature B cells (spleen) replicate 2 [09-002]. (b cell)		SRR553586(SRX182792)
source: Testis. (testes)		SRR685339(GSM1079783)
"Small RNAs (15-50 nts in length) from immort. (cell line)		SRR040489(GSM533912)
E18.5 Ago2 catalytically inactive LIVER small RNA. (ago2 liver)		SRR095855BC8(SRX039178)
sequencing of miRNA from wild type and diseas. (heart)		SRR525244(SRA056111/SRX170320)
Mus musculus domesticus miRNA sequencing. (ago2 Blood)		SRR042469(GSM539861)
mouse Th2 cells [09-002]. (lymph)		SRR042471(GSM539863)
mouse TFHS cells [09-002]. (spleen)		SRR042473(GSM539865)
mouse nTreg cells [09-002]. (lymph)		GSM640578(GSM640578)
small RNA in the liver with paternal control. (liver)		SRR042466(GSM539858)
mouse CD8+ T cells (spleen) [09-002]. (spleen)		SRR306536(GSM750579)
19-24nt. (ago2 brain)		SRR345200(SRX097261)
source: size fractionated RNA from mouse hipp. (brain)		GSM640581(GSM640581)
small RNA in the liver with paternal control. (liver)		SRR553582(SRX182788)
source: Brain. (Brain)		SRR042460(GSM539852)
mouse neutrophil cells replicate 2 [09-002]. (blood)		SRR059770(GSM562832)
Treg_Dicer. (spleen)		SRR306541(GSM750584)
19-24nt. (ago2 brain)		SRR065052(SRR065052)
Tissue-specific Regulation of Mouse MicroRNA . (jejunum)		SRR042470(GSM539862)
mouse Th17 cells [09-002]. (lymph)		SRR042444(GSM539836)
mouse pre B cells [09-002]. (b cell)		SRR042465(GSM539857)
mouse CD4+ T cells (spleen) [09-002]. (spleen)		SRR038743(GSM527278)
small RNA-Seq. (dicer brain)		SRR525237(SRA056111/SRX170313)
Mus musculus domesticus miRNA sequencing. (Blood)		SRR095855BC6(SRX039178)
sequencing of miRNA from wild type and diseas. (heart)		SRR553603(SRX182809)
source: Spermatids. (Spermatids)		SRR042448(GSM539840)
mouse B cells activated in vitro with LPS/IL4 replicate 1 [09-002]. (b cell)		SRR029042(GSM433294)
18.5dpc_hetero_tdrd1-KO. (tdrd1 testes)		SRR059776(GSM562838)
MEF_Dicer. (MEF)		GSM640583(GSM640583)
small RNA in the liver with paternal Low prot. (liver)		SRR069834(GSM304914)
Analysis of small RNAs in murine neutrophils cultured in vitro by Solexa/Illumina genome analyzer. (blood)		SRR525243(SRA056111/SRX170319)
Mus musculus domesticus miRNA sequencing. (ago2 Blood)		Ago3IP805(Rui)
Quantitative functions of Argonaute proteins . (ago3 skin)		SRR059774(GSM562836)
MEF_control. (MEF)		SRR038745(GSM527280)
small RNA-Seq. (dgcr8 brain)		SRR525239(SRA056111/SRX170315)
Mus musculus domesticus miRNA sequencing. (ago1 Blood)		SRR306533(GSM750576)
19-24nt. (ago2 brain)		SRR346413(SRX098254)
Global profiling of miRNA and the hairpin pre. (Heart)		GSM361395(GSM361395)
CGNP_P6_wt_rep2. (brain)		SRR037921(GSM510459)
e12p5_rep3. (embryo)		SRR206939(GSM723280)
other. (brain)		SRR042488(GSM539880)
mouse BclXL germinal center B cells [BalbC] [09-002]. (B cell)		SRR346416(SRX098257)
Global profiling of miRNA and the hairpin pre. (Kidney)		SRR306527(GSM750570)
19-24nt. (ago2 brain)		SRR039153(GSM471930)
HL1_siSrf1_smallRNAseq. (muscle)		SRR077865(GSM637802)
18-30 nt small RNAs. (liver)		Ago3IP812(Rui)
Quantitative functions of Argonaute proteins . (ago3 skin)		SRR059771(GSM562833)
CD4_control. (spleen)		Ago1IP812(Rui)
Quantitative functions of Argonaute proteins . (ago1 skin)		SRR042454(GSM539846)
mouse germinal center B cells (lymph node) [09-002]. (b cell)		SRR042486(GSM539878)
mouse ovaries [09-002]. (ovary)		SRR042449(GSM539841)
mouse B cells activated in vitro with LPS/IL4 replicate 2 [09-002]. (b cell)		SRR042481(GSM539873)
mouse pancreatic tissue [09-002]. (pancreas)		SRR095855BC7(SRX039178)
sequencing of miRNA from wild type and diseas. (heart)		SRR346420(SRX098261)
Global profiling of miRNA and the hairpin pre. (Uterus)		GSM314552(GSM314552)
ESC wild type (Illumina). (ESC)		SRR037937(GSM510475)
293cand2. (cell line)		SRR040488(GSM533911)
E18.5 wild type LIVER small RNA. (liver)		GSM361398(GSM361398)
CGNP_P6_p53--_Ink4c--_rep1. (brain)		SRR042463(GSM539855)
mouse natural killer cells [09-002]. (spleen)		SRR042446(GSM539838)
mouse mature B cells (spleen) replicate 1 [09-002]. (b cell)		SRR014231(GSM319955)
16.5 dpc total. (testes)		SRR059775(GSM562837)
MEF_Drosha. (MEF)		SRR077864(GSM637801)
18-30 nt small RNAs. (liver)		GSM361402(GSM361402)
CGNP_P6_p53--_Ink4c--_rep5. (brain)		GSM509279(GSM509279)
MVH-/- E16.5 small RNA. (testes)		SRR065050(SRR065050)
Tissue-specific Regulation of Mouse MicroRNA . (liver)		SRR345204(SRX097265)
source: size fractionated RNA from mouse hipp. (brain)		SRR042474(GSM539866)
mouse embryonic stem cells [09-002]. (ESC)
...............................................................................................................ACTGGGCTGAGAGGACTTGG...................................................................................... 2012.002.00----------------------------------------------------------------------------------------------------------------------1.00-------------------------1.00----
...............................................................................................................ACTGGGCTGAGAGGACTTGGTAA................................................................................... 2311.001.00------------------------------------------------------------------------------------------------------------------------------------------1.00----------
...............................................................TGTCAAGGGTGGGAGCCA........................................................................................................................................ 181.000.00----------------------------------------------------------------------------------------------------------------------------------------1.00------------