| (8) AGO2.ip | (5) B-CELL | (11) BRAIN | (1) CELL-LINE | (1) DCR.mut | (7) EMBRYO | (6) ESC | (1) FIBROBLAST | (2) LIVER | (1) LYMPH | (7) OTHER | (1) OTHER.mut | (1) PIWI.ip | (2) SPLEEN | (5) TESTES | (3) TOTAL-RNA |
| AAAAGACATAATCCAAAAATCAGAATTCTGAATTTTGTCCTTAGTAGTAGTGTAGTCAAGCTCACTTGTTTTGATGTTTTGGTTTTTAATTTTTAATAGCTTCCTTATTATTTTGACATTAATATAACTAAAGTATTGAAAATGAGCATATGAAAGCGCTGTGATTATAAAGATTAGTAATCGCAGATATTCTTTCATAGGAGCGCCTTTAACAGAGTTAGACTCACCTCGCCTGCCTGCTCACTTGTCA ....................................................................................................................................................((((((((..((((((((((........)))))))))).....))))))))................................................... ..............................................................................................................................................143......................................................200................................................ | Size | Perfect hit | Total Norm | Perfect Norm | SRR391847(GSM852142) gender: femalegenotype/variation: ADAR2-/-/AD. (embryo) | SRR345200(SRX097261) source: size fractionated RNA from mouse hipp. (brain) | SRR391845(GSM852140) gender: femalegenotype/variation: wild typeti. (embryo) | SRR391846(GSM852141) gender: femalegenotype/variation: ADAR2-/-tis. (embryo) | SRR390300(GSM849858) cell line: NIH-3T3cell type: fibroblastinfect. (ago2 fibroblast) | SRR391853(GSM852148) gender: femalegenotype/variation: ADAR2-/-/AD. (embryo) | SRR279903(GSM689053) cell type: mouse embryonic stem cellcell line. (ESC) | SRR042458(GSM539850) mouse basophil cells [09-002]. (b cell) | SRR306535(GSM750578) 19-24nt. (ago2 brain) | SRR042447(GSM539839) mouse mature B cells (spleen) replicate 2 [09-002]. (b cell) | SRR391851(GSM852146) gender: femalegenotype/variation: wild typeti. (embryo) | SRR065055(SRR065055) Tissue-specific Regulation of Mouse MicroRNA . (jejunum) | SRR391852(GSM852147) gender: femalegenotype/variation: ADAR2-/-tis. (embryo) | GSM314552(GSM314552) ESC wild type (Illumina). (ESC) | SRR279904(GSM689054) cell type: mouse embryonic stem cellcell line. (ESC) | SRR279905(GSM689055) cell type: mouse embryonic stem cellcell line. (ESC) | SRR014236(GSM319960) 10 dpp total. (testes) | SRR073955(GSM629281) total RNA. (blood) | SRR037912(GSM510449) newborn_rep5. (total RNA) | SRR069809(GSM610965) small RNA sequencing; sample 1. (testes) | SRR042459(GSM539851) mouse neutrophil cells replicate 1 [09-002]. (blood) | SRR306534(GSM750577) 19-24nt. (ago2 brain) | SRR073954(GSM629280) total RNA. (blood) | SRR345197(SRX097258) source: size fractionated RNA from mouse hipp. (brain) | SRR065054(SRR065054) Tissue-specific Regulation of Mouse MicroRNA . (jejunum) | SRR306542(GSM750585) 19-24nt. (ago2 brain) | SRR306539(GSM750582) 19-24nt. (ago2 brain) | SRR029041(GSM433293) 6w_homo_tdrd6-KO. (tdrd6 testes) | SRR042450(GSM539842) mouse B cells activated in vitro with LPS/IL4 replicate 3 [09-002]. (b cell) | SRR042449(GSM539841) mouse B cells activated in vitro with LPS/IL4 replicate 2 [09-002]. (b cell) | SRR014231(GSM319955) 16.5 dpc total. (testes) | SRR345201(SRX097262) source: size fractionated RNA from mouse hipp. (brain) | SRR391849(GSM852144) gender: femalegenotype/variation: ADAR2-/-tis. (embryo) | SRR042471(GSM539863) mouse TFHS cells [09-002]. (spleen) | SRR402762(SRX117945) source: ES E14 male cells. (ESC) | GSM640579(GSM640579) small RNA in the liver with paternal Low pro. (liver) | SRR042468(GSM539860) mouse Th1 cells [09-002]. (lymph) | SRR060845(GSM561991) total RNA. (brain) | SRR042448(GSM539840) mouse B cells activated in vitro with LPS/IL4 replicate 1 [09-002]. (b cell) | SRR346417(SRX098258) Global profiling of miRNA and the hairpin pre. (Brain) | SRR346421(SRX098263) Global profiling of miRNA and the hairpin pre. (mixture) | GSM475279(GSM475279) Miwi-IP. (miwi testes) | SRR306537(GSM750580) 19-24nt. (ago2 brain) | SRR037911(GSM510448) newborn_rep4. (total RNA) | SRR059769(GSM562831) Treg_Drosha. (spleen) | GSM510456(GSM510456) newborn_rep12. (total RNA) | SRR685340(GSM1079784) "Small RNAs (15-50 nts in length) from immort. (dicer cell line) | SRR346418(SRX098259) Global profiling of miRNA and the hairpin pre. (Liver) | SRR306538(GSM750581) 19-24nt. (ago2 brain) | SRR546155(SRX180174) Global profiling of miRNA and the hairpin pre. (ago2 Neuroblastoma) | SRR042474(GSM539866) mouse embryonic stem cells [09-002]. (ESC) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ...................................................................................................................................................ATATGAAAGCGCTGTGATTAT.................................................................................. | 21 | 1 | 17.00 | 17.00 | 4.00 | - | 2.00 | 1.00 | - | - | - | 3.00 | 1.00 | 1.00 | - | - | - | 1.00 | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | 1.00 | - | - | - | - | - | - |
| ....................................................................................................................................................TATGAAAGCGCTGTGATTA................................................................................... | 19 | 1 | 8.00 | 8.00 | - | - | 1.00 | 4.00 | - | - | - | - | 3.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...................................................................................................................................................ATATGAAAGCGCTGTGATT.................................................................................... | 19 | 1 | 7.00 | 7.00 | - | 2.00 | - | - | - | 1.00 | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - |
| ..................................................................................................................................................CATATGAAAGCGCTGTGATTA................................................................................... | 21 | 1 | 5.00 | 5.00 | - | - | - | - | - | - | - | 1.00 | - | - | 1.00 | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - |
| ..................................................................................................................................................CATATGAAAGCGCTGTGATTAT.................................................................................. | 22 | 1 | 4.00 | 4.00 | - | - | - | - | 4.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...................................................................................................................................................ATATGAAAGCGCTGTGATTA................................................................................... | 20 | 1 | 4.00 | 4.00 | - | - | - | - | - | - | - | - | - | 1.00 | - | - | 1.00 | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...................................................................................................................................................................................ATCGCAGATATTCTTTCATAGA................................................. | 22 | 4.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | 1.00 | - | - | - | - | - | |
| ..................................................................................................................................................................................AATCGCAGATATTCTTTCATAGT................................................. | 23 | 3.00 | 0.00 | - | - | - | - | - | - | 3.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .................................................................................................................................................................................TAATCGCAGATATTCTTTCATAG.................................................. | 23 | 1 | 3.00 | 3.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 3.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...................................................................................................................................................................................ATCGCAGATATTCTTTCATAGT................................................. | 22 | 2.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | 1.00 | - | |
| ...................................................................................................................................................................................ATCGCAGATATTCTTTCATAGTT................................................ | 23 | 2.00 | 0.00 | - | - | 1.00 | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...................................................................................................................................................ATATGAAAGCGCTGTGATA.................................................................................... | 19 | 2.00 | 0.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..................................................................................................................................................................................AATCGCAGATATTCTTTCATAGA................................................. | 23 | 2.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..................................................................................................................................................CATATGAAAGCGCTGTGATT.................................................................................... | 20 | 1 | 2.00 | 2.00 | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...................................................................................................................................................................................ATCGCAGATATTCTTTCATAGTTT............................................... | 24 | 2.00 | 0.00 | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...................................................................................................................................................ATATGAAAGCGCTGTGATAT................................................................................... | 20 | 2.00 | 0.00 | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ....................................................................................................................................................TATGAAAGCGCTGTGATTAT.................................................................................. | 20 | 1 | 2.00 | 2.00 | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .............................................................................................................................................................................TTAGTAATCGCAGATCAGC.......................................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ....................................................................TTTTGATGTTTTGGTCG..................................................................................................................................................................... | 17 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...................................................................................................................................................ATATGAAAGCGCTGTGATC.................................................................................... | 19 | 1.00 | 0.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...........................................................................................................................ATAACTAAAGTATTGAAAATGAGCAT..................................................................................................... | 26 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ........................................................................................................................................TGAAAATGAGCATATGAAAGCGCTGTGATTATAAAGATTAGTAATCGCAGATATTCTTTCATAG.................................................. | 64 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - |
| .........................................................................................................................................................................................................................TTAGACTCACCTCGCCTGCCTGC.......... | 23 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .............................................................................................................................................................................TTAGTAATCGCAGATATTCTTTC...................................................... | 23 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...................................................................................................................................................ATATGAAAGCGCTGTGATTT................................................................................... | 20 | 1 | 1.00 | 7.00 | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...................................................................................................................................................ATATGAAAGCGCTGTGATG.................................................................................... | 19 | 1.00 | 0.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .............................................................................................................................................................................TTAGTAATCGCAGATATTCTTT....................................................... | 22 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - |
| ...................................................................................................................................................................................ATCGCAGATATTCTTTCATAGATA............................................... | 24 | 1.00 | 0.00 | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...............................................................................................................................................................................................................................TCACCTCGCCTGCCTGCTCACTTG... | 24 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...............................................................................................................................................................................................................................TCACCTCGCCTGCCTGCTCACTTGTC. | 26 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .............................................................................................................................................................................TTAGTAATCGCAGATCA............................................................ | 17 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..............................................................................................................................................................................TAGTAATCGCAGATATTCTTTCATAG.................................................. | 26 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - |
| ...................................................................................................................................................ATATGAAAGCGCTGTGAGT.................................................................................... | 19 | 1.00 | 0.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...................................................................................................................................................................................ATCGCAGATATTCTTTCATAGAT................................................ | 23 | 1.00 | 0.00 | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .......................................................................................................................................................................................................................AGTTAGACTCACCTCGCC................. | 18 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - |
| .................................................................................................................................................................................TAATCGCAGATATTCTT........................................................ | 17 | 1 | 1.00 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .....................................................................................................................................................ATGAAAGCGCTGTGATTATAAAGA............................................................................. | 24 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...................................................................................................................................................ATATGAAAGCGCTGTGATTATA................................................................................. | 22 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..................................................................................................................................................................................AATCGCAGATATTCTTTCATAGTT................................................ | 24 | 1.00 | 0.00 | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .................................................................................................................................AAAGTATTGAAAATGAGCATA.................................................................................................... | 21 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 |
| .....................................................................................................................................................ATGAAAGCGCTGTGATTAT.................................................................................. | 19 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...................................................................................................................................................ATATGAAAGCGCTGTGATTAA.................................................................................. | 21 | 1 | 1.00 | 4.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .................................................................................................................................................................................TAATCGCAGATATTCTTTCATAGT................................................. | 24 | 1 | 1.00 | 3.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..................................................................................................................................................CATATGAAAGCGCTGTGATTAA.................................................................................. | 22 | 1 | 1.00 | 5.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...............................................................................................................................................................................AGTAATCGCAGAT.............................................................. | 13 | 10 | 0.20 | 0.20 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.20 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| AAAAGACATAATCCAAAAATCAGAATTCTGAATTTTGTCCTTAGTAGTAGTGTAGTCAAGCTCACTTGTTTTGATGTTTTGGTTTTTAATTTTTAATAGCTTCCTTATTATTTTGACATTAATATAACTAAAGTATTGAAAATGAGCATATGAAAGCGCTGTGATTATAAAGATTAGTAATCGCAGATATTCTTTCATAGGAGCGCCTTTAACAGAGTTAGACTCACCTCGCCTGCCTGCTCACTTGTCA ....................................................................................................................................................((((((((..((((((((((........)))))))))).....))))))))................................................... ..............................................................................................................................................143......................................................200................................................ | Size | Perfect hit | Total Norm | Perfect Norm | SRR391847(GSM852142) gender: femalegenotype/variation: ADAR2-/-/AD. (embryo) | SRR345200(SRX097261) source: size fractionated RNA from mouse hipp. (brain) | SRR391845(GSM852140) gender: femalegenotype/variation: wild typeti. (embryo) | SRR391846(GSM852141) gender: femalegenotype/variation: ADAR2-/-tis. (embryo) | SRR390300(GSM849858) cell line: NIH-3T3cell type: fibroblastinfect. (ago2 fibroblast) | SRR391853(GSM852148) gender: femalegenotype/variation: ADAR2-/-/AD. (embryo) | SRR279903(GSM689053) cell type: mouse embryonic stem cellcell line. (ESC) | SRR042458(GSM539850) mouse basophil cells [09-002]. (b cell) | SRR306535(GSM750578) 19-24nt. (ago2 brain) | SRR042447(GSM539839) mouse mature B cells (spleen) replicate 2 [09-002]. (b cell) | SRR391851(GSM852146) gender: femalegenotype/variation: wild typeti. (embryo) | SRR065055(SRR065055) Tissue-specific Regulation of Mouse MicroRNA . (jejunum) | SRR391852(GSM852147) gender: femalegenotype/variation: ADAR2-/-tis. (embryo) | GSM314552(GSM314552) ESC wild type (Illumina). (ESC) | SRR279904(GSM689054) cell type: mouse embryonic stem cellcell line. (ESC) | SRR279905(GSM689055) cell type: mouse embryonic stem cellcell line. (ESC) | SRR014236(GSM319960) 10 dpp total. (testes) | SRR073955(GSM629281) total RNA. (blood) | SRR037912(GSM510449) newborn_rep5. (total RNA) | SRR069809(GSM610965) small RNA sequencing; sample 1. (testes) | SRR042459(GSM539851) mouse neutrophil cells replicate 1 [09-002]. (blood) | SRR306534(GSM750577) 19-24nt. (ago2 brain) | SRR073954(GSM629280) total RNA. (blood) | SRR345197(SRX097258) source: size fractionated RNA from mouse hipp. (brain) | SRR065054(SRR065054) Tissue-specific Regulation of Mouse MicroRNA . (jejunum) | SRR306542(GSM750585) 19-24nt. (ago2 brain) | SRR306539(GSM750582) 19-24nt. (ago2 brain) | SRR029041(GSM433293) 6w_homo_tdrd6-KO. (tdrd6 testes) | SRR042450(GSM539842) mouse B cells activated in vitro with LPS/IL4 replicate 3 [09-002]. (b cell) | SRR042449(GSM539841) mouse B cells activated in vitro with LPS/IL4 replicate 2 [09-002]. (b cell) | SRR014231(GSM319955) 16.5 dpc total. (testes) | SRR345201(SRX097262) source: size fractionated RNA from mouse hipp. (brain) | SRR391849(GSM852144) gender: femalegenotype/variation: ADAR2-/-tis. (embryo) | SRR042471(GSM539863) mouse TFHS cells [09-002]. (spleen) | SRR402762(SRX117945) source: ES E14 male cells. (ESC) | GSM640579(GSM640579) small RNA in the liver with paternal Low pro. (liver) | SRR042468(GSM539860) mouse Th1 cells [09-002]. (lymph) | SRR060845(GSM561991) total RNA. (brain) | SRR042448(GSM539840) mouse B cells activated in vitro with LPS/IL4 replicate 1 [09-002]. (b cell) | SRR346417(SRX098258) Global profiling of miRNA and the hairpin pre. (Brain) | SRR346421(SRX098263) Global profiling of miRNA and the hairpin pre. (mixture) | GSM475279(GSM475279) Miwi-IP. (miwi testes) | SRR306537(GSM750580) 19-24nt. (ago2 brain) | SRR037911(GSM510448) newborn_rep4. (total RNA) | SRR059769(GSM562831) Treg_Drosha. (spleen) | GSM510456(GSM510456) newborn_rep12. (total RNA) | SRR685340(GSM1079784) "Small RNAs (15-50 nts in length) from immort. (dicer cell line) | SRR346418(SRX098259) Global profiling of miRNA and the hairpin pre. (Liver) | SRR306538(GSM750581) 19-24nt. (ago2 brain) | SRR546155(SRX180174) Global profiling of miRNA and the hairpin pre. (ago2 Neuroblastoma) | SRR042474(GSM539866) mouse embryonic stem cells [09-002]. (ESC) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| .............................................................TCACTTGTTTTGATGTTAAGA........................................................................................................................................................................ | 21 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ......................................................................................................................................................................................................................................GCCTGCCTGCTCACTTCTC. | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..............................................................................................AATAGCTTCCTTATTATATA........................................................................................................................................ | 20 | 1.00 | 0.00 | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ......................................................................................................................................................................................................................................GCCTGCCTGCTCACTTGCTCG | 21 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ......................................................................................................................................................................................................................................GCCTGCCTGCTCACTCTC.. | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ................................................................................................TAGCTTCCTTATTATTTA........................................................................................................................................ | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .....................................................AGTCAAGCTCACTTGTGT................................................................................................................................................................................... | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |