ID: uc007qhn.31
GENE: Kif13a(31)
chr13:46922100-46922349-


(2)
AGO1.ip 		(12)
AGO2.ip 		(1)
AGO3.ip 		(1)
B-CELL 		(29)
BRAIN 		(6)
CELL-LINE 		(1)
DCR.mut 		(1)
DGCR8.mut 		(9)
EMBRYO 		(8)
ESC 		(4)
FIBROBLAST 		(4)
HEART 		(1)
KIDNEY 		(3)
LIVER 		(1)
LUNG 		(1)
LYMPH 		(12)
OTHER 		(3)
OTHER.mut 		(2)
PANCREAS 		(1)
PIWI.ip 		(5)
SKIN 		(2)
SPLEEN 		(9)
TESTES 		(4)
TOTAL-RNA 		(1)
UTERUS

Sense strand
AATAGTATCACTGTTTGAAATCAGAGTCTAAGGCATTTCTCATGCAGAGTGCTGCTTTGCTATAAAGTGGCCATTAAAGCACCTTCTAATCACTAAAAGACCCTTTTGAGTTTGTAATCTGAATGTCTAAGTGCTTGGGAGAAAGGAGAATCCCCCAAGTGTGGTAAGATTCACCCACTTGATTCTTCTTCCTCCCCTAGGAGCAGGCAGTCTCTGAAAGTCCGAGAGCATAAGGTCCTGGGGCCGTATG
........................................................................................................................................(((((.((((((((((....(((((.(((.......)))))))))))))))))).)))))......................................................
................................................................................................................................129....................................................................200................................................
SizePerfect hitTotal NormPerfect NormSRR546155(SRX180174)
Global profiling of miRNA and the hairpin pre. (ago2 Neuroblastoma)		SRR279904(GSM689054)
cell type: mouse embryonic stem cellcell line. (ESC)		mjLiverWT1()
Liver Data. (liver)		SRR038742(GSM527277)
small RNA-Seq. (dgcr8 brain)		SRR391852(GSM852147)
gender: femalegenotype/variation: ADAR2-/-tis. (embryo)		GSM314557(GSM314557)
ESC dgcr8 (Illumina). (ESC)		SRR402762(SRX117945)
source: ES E14 male cells. (ESC)		SRR553583(SRX182789)
source: Cerebellum. (Cerebellum)		SRR206941(GSM723282)
other. (brain)		GSM510444(GSM510444)
brain_rep5. (brain)		Ago1IP517(Rui)
Quantitative functions of Argonaute proteins . (ago1 skin)		SRR391853(GSM852148)
gender: femalegenotype/variation: ADAR2-/-/AD. (embryo)		SRR391851(GSM852146)
gender: femalegenotype/variation: wild typeti. (embryo)		SRR306542(GSM750585)
19-24nt. (ago2 brain)		SRR345200(SRX097261)
source: size fractionated RNA from mouse hipp. (brain)		Ago1IP812(Rui)
Quantitative functions of Argonaute proteins . (ago1 skin)		SRR402760(SRX117943)
source: ES E14 male cells. (ESC)		SRR390300(GSM849858)
cell line: NIH-3T3cell type: fibroblastinfect. (ago2 fibroblast)		Ago3IP812(Rui)
Quantitative functions of Argonaute proteins . (ago3 skin)		SRR391845(GSM852140)
gender: femalegenotype/variation: wild typeti. (embryo)		SRR391848(GSM852143)
gender: femalegenotype/variation: wild typeti. (embryo)		SRR038743(GSM527278)
small RNA-Seq. (dicer brain)		SRR345198(SRX097259)
source: size fractionated RNA from mouse hipp. (brain)		SRR345203(SRX097264)
source: size fractionated RNA from mouse hipp. (brain)		SRR206940(GSM723281)
other. (brain)		SRR685339(GSM1079783)
"Small RNAs (15-50 nts in length) from immort. (cell line)		SRR391846(GSM852141)
gender: femalegenotype/variation: ADAR2-/-tis. (embryo)		SRR306526(GSM750569)
19-24nt. (ago2 brain)		SRR391849(GSM852144)
gender: femalegenotype/variation: ADAR2-/-tis. (embryo)		SRR279903(GSM689053)
cell type: mouse embryonic stem cellcell line. (ESC)		SRR346417(SRX098258)
Global profiling of miRNA and the hairpin pre. (Brain)		SRR248523(GSM733811)
cell type: Thy1+ spermatogonial stem cellstra. (testes)		SRR042459(GSM539851)
mouse neutrophil cells replicate 1 [09-002]. (blood)		SRR206939(GSM723280)
other. (brain)		SRR346423(SRX098265)
Global profiling of miRNA and the hairpin pre. (Brain)		SRR040488(GSM533911)
E18.5 wild type LIVER small RNA. (liver)		SRR059773(GSM562835)
CD4_Dicer. (spleen)		SRR206942(GSM723283)
other. (brain)		SRR038741(GSM527276)
small RNA-Seq. (brain)		SRR346422(SRX098264)
Global profiling of miRNA and the hairpin pre. (Muscle)		SRR346421(SRX098263)
Global profiling of miRNA and the hairpin pre. (mixture)		SRR037906(GSM510442)
brain_rep3. (brain)		SRR346419(SRX098260)
Global profiling of miRNA and the hairpin pre. (Lung)		SRR345207(SRX097268)
source: size fractionated RNA from mouse hipp. (brain)		SRR346416(SRX098257)
Global profiling of miRNA and the hairpin pre. (Kidney)		SRR306541(GSM750584)
19-24nt. (ago2 brain)		SRR037905(GSM510441)
brain_rep2. (brain)		SRR039184(GSM485324)
shLuc.1309 (+dox). (fibroblast)		GSM510450(GSM510450)
newborn_rep6. (total RNA)		SRR095855BC3(SRX039178)
sequencing of miRNA from wild type and diseas. (heart)		SRR345199(SRX097260)
source: size fractionated RNA from mouse hipp. (brain)		RuiDcrWT(Rui)
DGCR8-dependent microRNA biogenesis is essent. (skin)		SRR037929(GSM510467)
e7p5_rep3. (embryo)		SRR042469(GSM539861)
mouse Th2 cells [09-002]. (lymph)		SRR042449(GSM539841)
mouse B cells activated in vitro with LPS/IL4 replicate 2 [09-002]. (b cell)		SRR095855BC2(SRX039178)
sequencing of miRNA from wild type and diseas. (heart)		SRR042471(GSM539863)
mouse TFHS cells [09-002]. (spleen)		SRR023852(GSM307161)
ZHBT-c424hsmallrna_rep1. (cell line)		SRR042481(GSM539873)
mouse pancreatic tissue [09-002]. (pancreas)		mjTestesWT3()
Testes Data. (testes)		SRR038744(GSM527279)
small RNA-Seq. (brain)		mjTestesKO8()
Testes Data. (Zcchc11 testes)		SRR402761(SRX117944)
source: ES E14 male cells. (ESC)		SRR306537(GSM750580)
19-24nt. (ago2 brain)		SRR023850(GSM307159)
ZHBT-c40hsmallrna_rep1. (cell line)		SRR116846(GSM678422)
Small RNA deep sequencing from mouse epididym. (epididymis)		SRR029123(GSM416611)
NIH3T3. (cell line)		SRR029043(GSM433295)
18.5dpc_homo_tdrd1-KO. (tdrd1 testes)		GSM510453(GSM510453)
newborn_rep9. (total RNA)		SRR346413(SRX098254)
Global profiling of miRNA and the hairpin pre. (Heart)		SRR306536(GSM750579)
19-24nt. (ago2 brain)		SRR346418(SRX098259)
Global profiling of miRNA and the hairpin pre. (Liver)		GSM261957(GSM261957)
oocytesmallRNA-19to24. (oocyte)		SRR014232(GSM319956)
16.5 dpc MILI. (mili testes)		SRR037907(GSM510443)
brain_rep4. (brain)		SRR073954(GSM629280)
total RNA. (blood)		SRR279905(GSM689055)
cell type: mouse embryonic stem cellcell line. (ESC)		SRR065058(SRR065058)
Tissue-specific Regulation of Mouse MicroRNA . (pancreas)		SRR039154(GSM471931)
HL1_siSrf2_smallRNAseq. (muscle)		SRR039186(GSM485326)
shLuc.1309;ROSA-rtTA (+dox). (fibroblast)		SRR346424(SRX098266)
Global profiling of miRNA and the hairpin pre. (Neuroblastoma)		SRR306528(GSM750571)
19-24nt. (ago2 brain)		SRR391850(GSM852145)
gender: femalegenotype/variation: ADAR2-/-/AD. (embryo)		SRR306534(GSM750577)
19-24nt. (ago2 brain)		SRR306527(GSM750570)
19-24nt. (ago2 brain)		SRR073955(GSM629281)
total RNA. (blood)		SRR023851(GSM307160)
ZHBT-c412hsmallrna_rep1. (cell line)		SRR306540(GSM750583)
19-24nt. (ago2 brain)		SRR039183(GSM485323)
shLuc.1309 (-dox). (fibroblast)		GSM519104(GSM519104)
mouse_granulocyte_nuclei_smallRNAs. (cell line)		Ago2IP517(Rui)
Quantitative functions of Argonaute proteins . (ago2 skin)		GSM510456(GSM510456)
newborn_rep12. (total RNA)		SRR042484(GSM539876)
mouse salivary gland tissue [09-002]. (gland)		SRR039610(GSM527274)
small RNA-Seq. (brain)		GSM509279(GSM509279)
MVH-/- E16.5 small RNA. (testes)		SRR042474(GSM539866)
mouse embryonic stem cells [09-002]. (ESC)		SRR346420(SRX098261)
Global profiling of miRNA and the hairpin pre. (Uterus)		SRR346415(SRX098256)
source: Testis. (Testes)		SRR037914(GSM510451)
newborn_rep7. (total RNA)		SRR553584(SRX182790)
source: Heart. (Heart)		mjTestesKO7()
Testes Data. (Zcchc11 testes)		SRR248525(GSM733813)
cell type: Thy1- spermatogonial stem cellstra. (testes)
...................................................................................................................................................................................TGATTCTTCTTCCTCCCCTAGT.................................................22150.0017.0011.001.006.002.00-1.00-1.00---1.00------1.001.00----2.00-1.001.00-1.00--2.00-1.001.00-1.001.002.00-----1.00-----------1.00--1.00--1.001.00-1.001.00-------1.00--------1.00--1.00----1.001.00--------
...................................................................................................................................................................................TGATTCTTCTTCCTCCCCTAGA.................................................22129.0017.004.00--1.002.001.002.00-2.00-2.002.001.00----4.002.00-1.00----3.00-----------------------------------1.00------------------------1.00---------------
..................................................................................................................................................................................TTGATTCTTCTTCCTCCCCTAGA.................................................23129.0010.002.003.00--2.003.005.001.00-3.003.002.001.00--1.00-----------------1.00-------1.00---------1.00--------------------------------------------------
..................................................................................................................................................................................TTGATTCTTCTTCCTCCCCTAGT.................................................23126.0010.007.001.00-1.001.002.00-1.002.00-1.00-1.001.00-2.00----1.001.00-----------1.00-------------------------------------------1.00--1.00--1.00------------------
...................................................................................................................................................................................TGATTCTTCTTCCTCCCCTAG..................................................21117.0017.001.001.005.00---1.00---------4.00-------------1.00---1.00---------1.00--------------------------------------------1.00-1.00----------
..................................................................................................................................................................................TTGATTCTTCTTCCTCCCCTAG..................................................22110.0010.00-3.00-----1.001.001.00--------1.00----------------------1.00----------------1.00-------------------------------1.00-----------
.................................................................................................................................................................................CTTGATTCTTCTTCCTCCCCTAG..................................................2315.005.00---1.00---3.00---------------------1.00------------------------------------------------------------------------
.................................................................................................................................................................................CTTGATTCTTCTTCCTCCCCTAGT.................................................2415.005.00---1.00---1.00-------------1.00-------------------------1.00---------------------1.00--------------------------------
.................................................................................................................................................................................CTTGATTCTTCTTCCTCCCCTT...................................................2213.002.001.00----------------------2.00------------------------------------------------------------------------------
......................................................................................................................................................................................................AGGAGCAGGCAGTCTGTTT.................................193.000.00--------------2.00-------1.00-------------------------------------------------------------------------------
...................................................................................................................................................................................TGATTCTTCTTCCTCCCCTAGAA................................................2313.0017.00-3.00----------------------------------------------------------------------------------------------------
..................................................................................................................................................................................TTGATTCTTCTTCCTCCCCTA...................................................2113.003.00--------1.00----2.00----------------------------------------------------------------------------------------
..................................................................................................................................................................................TTGATTCTTCTTCCTCCCCTAGAA................................................2413.0010.00----2.00---------------------------------------------------------1.00---------------------------------------
............................................................................................................................................................................................................AGGCAGTCTCTGAAAGTCCGAGAGC.....................2513.003.00----1.00------1.001.00-----------------------------------------------------------------------------------------
...................................................................................................................................................................................TGATTCTTCTTCCTCCCCTAGTA................................................2313.0017.001.00----1.00--------------------------------------------------------------1.00---------------------------------
.................................................................................................................................................................................CTTGATTCTTCTTCCTCCCCTA...................................................2213.003.00---------------1.00------------------------------------------------------------1.00----1.00--------------------
..................................................................................................................................................................................TTGATTCTTCTTCCTCCCCTAGC.................................................2312.0010.002.00-----------------------------------------------------------------------------------------------------
.................................................................................................................................................................................CTTGATTCTTCTTCCTCCCC.....................................................2012.002.00-------------------------------------1.00----------1.00-----------------------------------------------------
...................................................................................................................................................................................TGATTCTTCTTCCTCCCCTAGAT................................................2312.0017.00----1.00---------------------------------1.00---------------------------------------------------------------
...................................................................................................................................................................................TGATTCTTCTTCCTCCCCTAGTAG...............................................2412.0017.00---1.00-------------------------------------------------------------------1.00------------------------------
..................................................................................................................................................................................TTGATTCTTCTTCCTCCCCTAGAT................................................2412.0010.00------------1.00------------------------------------------------------------1.00----------------------------
.....................................................................................................................................CTTGGGAGAAAGGAGAATCCC................................................................................................2112.002.00----1.00-----------------------------------------------------------------------------------1.00-------------
..................................................................................................................................................................................TTGATTCTTCTTCCTCCCCTAGTA................................................2412.0010.00---------1.00--------------------1.00-----------------------------------------------------------------------
.................................................................................................................................................................................CTTGATTCTTCTTCCTCCCCTAT..................................................2312.003.001.00--1.00--------------------------------------------------------------------------------------------------
.....................................................................................................................................................................................................................CTGAAAGTCCGAGAGCAT...................1812.002.00------------------------------------2.00-----------------------------------------------------------------
......................................................................................................................................................................................................................TGAAAGTCCGAGAGCATAAGGTCCTG..........2612.002.00-------------------------------1.00--------------------------------------------------------------1.00-------
......................................................................................................................................................................................................AGGAGCAGGCAGTCTGCGT.................................192.000.00--------------1.00-------1.00-------------------------------------------------------------------------------
.................................................................................................................................................................................CTTGATTCTTCTTCCTCCCCT....................................................2112.002.00---------1.00------------------------------------------------------------1.00-------------------------------
......................................................................................................................................................................................................AGGAGCAGGCAGTCTCTG..................................1821.501.50--------------1.50---------------------------------------------------------------------------------------
............................................CAGAGTGCTGCTTTGTGTT...........................................................................................................................................................................................191.000.00-----------------------------------1.00------------------------------------------------------------------
.......................................................................................................................................................................................................................................AAGGTCCTGGGGCCGTAT.1811.001.00----------------------------1.00-------------------------------------------------------------------------
...................................................................................................................................................................................TGATTCTTCTTCCTCCCCTGGT.................................................221.000.00---------------------------1.00--------------------------------------------------------------------------
..............................................................................................AAAAGACCCTTTTGAGTTTGT.......................................................................................................................................2111.001.00----------------------------1.00-------------------------------------------------------------------------
.........................................................................................................................................................................................................AGCAGGCAGTCTCTGAAAGTCCGAGA.......................2611.001.00-----------------------------------------------------1.00------------------------------------------------
...................................................................................................................................................................................TGATTCTTCTTCCTCCCCTAGC.................................................2211.0017.00-----1.00------------------------------------------------------------------------------------------------
.................................................................................................................................................................................CTTGATTCTTCTTCCTCCCCTAA..................................................2311.003.001.00-----------------------------------------------------------------------------------------------------
..................................................................................................................................................................................TTGATTCTTCTTCCTCCCCTAGTTC...............................................2511.0010.001.00-----------------------------------------------------------------------------------------------------
..................................................................................................................................................................................TTGATTCTTCTTCCTCCCCTAGTAA...............................................2511.0010.00-------------------1.00----------------------------------------------------------------------------------
..................................................................................................................................................................................TTGATTCTTCTTCCTCCCCTATT.................................................2311.003.00------------------------1.00-----------------------------------------------------------------------------
..................................................................................................................................................................................TTGATTCTTCTTCCTCCCCTAGTT................................................2411.0010.00-------------------------------------------------------------------------------------1.00----------------
.......................................................................................................................................TGGGAGAAAGGAGAATCCCCCAAGTG.........................................................................................2611.001.00----------------------------------------------------1.00-------------------------------------------------
...................................................................................................................................................................................................................................GCATAAGGTCCTGGGTTAT....191.000.00------------------------------------------------------1.00-----------------------------------------------
..................................................................................................................................................................................TTGATTCTTCTTCCTCCCCTAGAAT...............................................2511.0010.00-------------------1.00----------------------------------------------------------------------------------
.......TCACTGTTTGAAATCAGTGTT..............................................................................................................................................................................................................................211.000.00---1.00--------------------------------------------------------------------------------------------------
.......................................................................................................................................................................................................GGAGCAGGCAGTCTCTGAA................................1911.001.00-----------------------------------------------------------------------------------------------1.00------
..................................................................................................................................................................................TTGATTCTTCTTCCTCCCCTAAA.................................................2311.003.001.00-----------------------------------------------------------------------------------------------------
...................................................................................................................................................................................................................................GCATAAGGTCCTGGGTTA.....181.000.00------------------------------------------------------------------------1.00-----------------------------
.....................................................................................................................................CTTGGGAGAAAGGAGAATCCCCCA.............................................................................................2411.001.00-----------------------------------------------------------1.00------------------------------------------
............................................................................AAGCACCTTCTAATCTAG............................................................................................................................................................181.000.00-----------------------1.00------------------------------------------------------------------------------
......................................................................................................................................................................................................AGGAGCAGGCAGTCTGT...................................171.000.00----------------------1.00-------------------------------------------------------------------------------
...................................................................................................................................................................................TGATTCTTCTTCCTCCCCTAGCAG...............................................2411.0017.00------------1.00-----------------------------------------------------------------------------------------
.......................................................................................................................................TGGGAGAAAGGAGAATCC.................................................................................................1811.001.00-------------------------------------------------------------------------------1.00----------------------
..........................................................................................................TGAGTTTGTAATCTGAATGTCTAAGTGCTTGGGAGAAAGGAGAATCCCCCAAGTGTGGTAAGATTCACCCACTTGATTCTTCTTCCTCCCCTAG..................................................9411.001.00----------------------------------------1.00-------------------------------------------------------------
.....................................................................................................................................................................................................................CTGAAAGTCCGAGAGCTCTG.................201.000.00--------------------------------------------------1.00---------------------------------------------------
..................................................................................................................................................................................TTGATTCTTCTTCCTCCCCTAT..................................................2211.003.001.00-----------------------------------------------------------------------------------------------------
.....................................................................................................................TCTGAATGTCTAAGTG.....................................................................................................................1651.001.00------------------------------------------0.20-0.20---------------------------------------------------0.400.20----
..................................................................................................................................................................................TTGATTCTTCTTCCTCCCCT....................................................2011.001.00---------------------1.00--------------------------------------------------------------------------------
...................................................................................................................................................................................TGATTCTTCTTCCTCCCCTAGTGT...............................................2411.0017.00--------1.00---------------------------------------------------------------------------------------------
...................................................................................................................................................................................TGATTCTTCTTCCTCCCCTAGTAA...............................................2411.0017.00--------------------------1.00---------------------------------------------------------------------------
...................................................................................................................................................................................TGATTCTTCTTCCTCCCCTAT..................................................211.000.00-------------------------------------------------------1.00----------------------------------------------
...................................................................................................................................................................................TGATTCTTCTTCCTCCCCTAGTTT...............................................2411.0017.00-------------------------------------------------1.00----------------------------------------------------
.......................................................................................................................................TGGGAGAAAGGAGAATCCCCCAAG...........................................................................................2411.001.00----------------------------------------------------------------------------------1.00-------------------
...................................................................................................................................................................................TGATTCTTCTTCCTCCCCTAGATT...............................................2411.0017.00-----------------------------------------------------------------1.00------------------------------------
......................................................................................................................................................................................TTCTTCTTCCTCCCCTAGT.................................................1921.000.50-------------1.00----------------------------------------------------------------------------------------
.....................................................................................................................................CTTGGGAGAAAGGAGAATCCCCCAAGTGTGGTAAGATTCACCCACTTGATTCTTCTTCCTCCCCTAG..................................................6711.001.00----------------------------------------1.00-------------------------------------------------------------
...................................................................................................................................................................................TGATTCTTCTTCCTCCCCTAGTAT...............................................2411.0017.00------------------------------------------1.00-----------------------------------------------------------
......................................................................................................................................TTGGGAGAAAGGAGAATC..................................................................................................1811.001.00--------------------------------------------------------1.00---------------------------------------------
...................................................................................................................................................................................TGATTCTTCTTCCTCCCCTAGG.................................................2211.001.00--------------------1.00---------------------------------------------------------------------------------
.......................................................................................................................................TGGGAGAAAGGAGAATCCCCC..............................................................................................2111.001.00----------------------------------------------1.00-------------------------------------------------------
....................................................................................................................................................................................................................TCTGAAAGTCCGAGAGCATAAGGTCAT...........271.000.00-------------------------------1.00----------------------------------------------------------------------
.................................................................................................................................................................................CTTGATTCTTCTTCCTCCCCTAC..................................................2311.003.00-------------1.00----------------------------------------------------------------------------------------
......................................................................................................................................TTGGGAGAAAGGAGAATCCCCCAAGT..........................................................................................2611.001.00-----1.00------------------------------------------------------------------------------------------------
........................................................................................................................................................................................CTTCTTCCTCCCCTATAA................................................181.000.00--------------------------------------------------------------------------1.00---------------------------
..................................................................................................................................................................................TTGATTCTTCTTCCTCCCCTAA..................................................2211.003.00---1.00--------------------------------------------------------------------------------------------------
........................................................................................................................................................................................................................................AGGTCCTGGGGCCGT...1520.500.50---------------------------------------------------------------------------------------------------0.50--
......................................................................................................................................................................................TTCTTCTTCCTCCCCTAG..................................................1820.500.50--------------------------------------------------------------------------------------------------0.50---
......................................................................................................................CTGAATGTCTAAGTG.....................................................................................................................1580.500.50------------------------------------------0.12-----------------------------------------------------0.250.12----
.....................................................................................................................TCTGAATGTCTAAGTGAA...................................................................................................................1850.401.00------------------------------------------------------------------------------------------------0.200.20----
.....................................................................................................................TCTGAATGTCTAAGTGAAG..................................................................................................................1950.201.00-------------------------------------------0.20----------------------------------------------------------
.....................................................................................................................TCTGAATGTCTAAGTGAAGA.................................................................................................................2050.201.00----------------------------------------------------------------------------------------------------0.20-
......................................................................................................................CTGAATGTCTAAGTGAAGA.................................................................................................................1980.120.50-----------------------------------------------------------------------------------------------------0.12

Antisense strand
AATAGTATCACTGTTTGAAATCAGAGTCTAAGGCATTTCTCATGCAGAGTGCTGCTTTGCTATAAAGTGGCCATTAAAGCACCTTCTAATCACTAAAAGACCCTTTTGAGTTTGTAATCTGAATGTCTAAGTGCTTGGGAGAAAGGAGAATCCCCCAAGTGTGGTAAGATTCACCCACTTGATTCTTCTTCCTCCCCTAGGAGCAGGCAGTCTCTGAAAGTCCGAGAGCATAAGGTCCTGGGGCCGTATG
........................................................................................................................................(((((.((((((((((....(((((.(((.......)))))))))))))))))).)))))......................................................
................................................................................................................................129....................................................................200................................................
SizePerfect hitTotal NormPerfect NormSRR546155(SRX180174)
Global profiling of miRNA and the hairpin pre. (ago2 Neuroblastoma)		SRR279904(GSM689054)
cell type: mouse embryonic stem cellcell line. (ESC)		mjLiverWT1()
Liver Data. (liver)		SRR038742(GSM527277)
small RNA-Seq. (dgcr8 brain)		SRR391852(GSM852147)
gender: femalegenotype/variation: ADAR2-/-tis. (embryo)		GSM314557(GSM314557)
ESC dgcr8 (Illumina). (ESC)		SRR402762(SRX117945)
source: ES E14 male cells. (ESC)		SRR553583(SRX182789)
source: Cerebellum. (Cerebellum)		SRR206941(GSM723282)
other. (brain)		GSM510444(GSM510444)
brain_rep5. (brain)		Ago1IP517(Rui)
Quantitative functions of Argonaute proteins . (ago1 skin)		SRR391853(GSM852148)
gender: femalegenotype/variation: ADAR2-/-/AD. (embryo)		SRR391851(GSM852146)
gender: femalegenotype/variation: wild typeti. (embryo)		SRR306542(GSM750585)
19-24nt. (ago2 brain)		SRR345200(SRX097261)
source: size fractionated RNA from mouse hipp. (brain)		Ago1IP812(Rui)
Quantitative functions of Argonaute proteins . (ago1 skin)		SRR402760(SRX117943)
source: ES E14 male cells. (ESC)		SRR390300(GSM849858)
cell line: NIH-3T3cell type: fibroblastinfect. (ago2 fibroblast)		Ago3IP812(Rui)
Quantitative functions of Argonaute proteins . (ago3 skin)		SRR391845(GSM852140)
gender: femalegenotype/variation: wild typeti. (embryo)		SRR391848(GSM852143)
gender: femalegenotype/variation: wild typeti. (embryo)		SRR038743(GSM527278)
small RNA-Seq. (dicer brain)		SRR345198(SRX097259)
source: size fractionated RNA from mouse hipp. (brain)		SRR345203(SRX097264)
source: size fractionated RNA from mouse hipp. (brain)		SRR206940(GSM723281)
other. (brain)		SRR685339(GSM1079783)
"Small RNAs (15-50 nts in length) from immort. (cell line)		SRR391846(GSM852141)
gender: femalegenotype/variation: ADAR2-/-tis. (embryo)		SRR306526(GSM750569)
19-24nt. (ago2 brain)		SRR391849(GSM852144)
gender: femalegenotype/variation: ADAR2-/-tis. (embryo)		SRR279903(GSM689053)
cell type: mouse embryonic stem cellcell line. (ESC)		SRR346417(SRX098258)
Global profiling of miRNA and the hairpin pre. (Brain)		SRR248523(GSM733811)
cell type: Thy1+ spermatogonial stem cellstra. (testes)		SRR042459(GSM539851)
mouse neutrophil cells replicate 1 [09-002]. (blood)		SRR206939(GSM723280)
other. (brain)		SRR346423(SRX098265)
Global profiling of miRNA and the hairpin pre. (Brain)		SRR040488(GSM533911)
E18.5 wild type LIVER small RNA. (liver)		SRR059773(GSM562835)
CD4_Dicer. (spleen)		SRR206942(GSM723283)
other. (brain)		SRR038741(GSM527276)
small RNA-Seq. (brain)		SRR346422(SRX098264)
Global profiling of miRNA and the hairpin pre. (Muscle)		SRR346421(SRX098263)
Global profiling of miRNA and the hairpin pre. (mixture)		SRR037906(GSM510442)
brain_rep3. (brain)		SRR346419(SRX098260)
Global profiling of miRNA and the hairpin pre. (Lung)		SRR345207(SRX097268)
source: size fractionated RNA from mouse hipp. (brain)		SRR346416(SRX098257)
Global profiling of miRNA and the hairpin pre. (Kidney)		SRR306541(GSM750584)
19-24nt. (ago2 brain)		SRR037905(GSM510441)
brain_rep2. (brain)		SRR039184(GSM485324)
shLuc.1309 (+dox). (fibroblast)		GSM510450(GSM510450)
newborn_rep6. (total RNA)		SRR095855BC3(SRX039178)
sequencing of miRNA from wild type and diseas. (heart)		SRR345199(SRX097260)
source: size fractionated RNA from mouse hipp. (brain)		RuiDcrWT(Rui)
DGCR8-dependent microRNA biogenesis is essent. (skin)		SRR037929(GSM510467)
e7p5_rep3. (embryo)		SRR042469(GSM539861)
mouse Th2 cells [09-002]. (lymph)		SRR042449(GSM539841)
mouse B cells activated in vitro with LPS/IL4 replicate 2 [09-002]. (b cell)		SRR095855BC2(SRX039178)
sequencing of miRNA from wild type and diseas. (heart)		SRR042471(GSM539863)
mouse TFHS cells [09-002]. (spleen)		SRR023852(GSM307161)
ZHBT-c424hsmallrna_rep1. (cell line)		SRR042481(GSM539873)
mouse pancreatic tissue [09-002]. (pancreas)		mjTestesWT3()
Testes Data. (testes)		SRR038744(GSM527279)
small RNA-Seq. (brain)		mjTestesKO8()
Testes Data. (Zcchc11 testes)		SRR402761(SRX117944)
source: ES E14 male cells. (ESC)		SRR306537(GSM750580)
19-24nt. (ago2 brain)		SRR023850(GSM307159)
ZHBT-c40hsmallrna_rep1. (cell line)		SRR116846(GSM678422)
Small RNA deep sequencing from mouse epididym. (epididymis)		SRR029123(GSM416611)
NIH3T3. (cell line)		SRR029043(GSM433295)
18.5dpc_homo_tdrd1-KO. (tdrd1 testes)		GSM510453(GSM510453)
newborn_rep9. (total RNA)		SRR346413(SRX098254)
Global profiling of miRNA and the hairpin pre. (Heart)		SRR306536(GSM750579)
19-24nt. (ago2 brain)		SRR346418(SRX098259)
Global profiling of miRNA and the hairpin pre. (Liver)		GSM261957(GSM261957)
oocytesmallRNA-19to24. (oocyte)		SRR014232(GSM319956)
16.5 dpc MILI. (mili testes)		SRR037907(GSM510443)
brain_rep4. (brain)		SRR073954(GSM629280)
total RNA. (blood)		SRR279905(GSM689055)
cell type: mouse embryonic stem cellcell line. (ESC)		SRR065058(SRR065058)
Tissue-specific Regulation of Mouse MicroRNA . (pancreas)		SRR039154(GSM471931)
HL1_siSrf2_smallRNAseq. (muscle)		SRR039186(GSM485326)
shLuc.1309;ROSA-rtTA (+dox). (fibroblast)		SRR346424(SRX098266)
Global profiling of miRNA and the hairpin pre. (Neuroblastoma)		SRR306528(GSM750571)
19-24nt. (ago2 brain)		SRR391850(GSM852145)
gender: femalegenotype/variation: ADAR2-/-/AD. (embryo)		SRR306534(GSM750577)
19-24nt. (ago2 brain)		SRR306527(GSM750570)
19-24nt. (ago2 brain)		SRR073955(GSM629281)
total RNA. (blood)		SRR023851(GSM307160)
ZHBT-c412hsmallrna_rep1. (cell line)		SRR306540(GSM750583)
19-24nt. (ago2 brain)		SRR039183(GSM485323)
shLuc.1309 (-dox). (fibroblast)		GSM519104(GSM519104)
mouse_granulocyte_nuclei_smallRNAs. (cell line)		Ago2IP517(Rui)
Quantitative functions of Argonaute proteins . (ago2 skin)		GSM510456(GSM510456)
newborn_rep12. (total RNA)		SRR042484(GSM539876)
mouse salivary gland tissue [09-002]. (gland)		SRR039610(GSM527274)
small RNA-Seq. (brain)		GSM509279(GSM509279)
MVH-/- E16.5 small RNA. (testes)		SRR042474(GSM539866)
mouse embryonic stem cells [09-002]. (ESC)		SRR346420(SRX098261)
Global profiling of miRNA and the hairpin pre. (Uterus)		SRR346415(SRX098256)
source: Testis. (Testes)		SRR037914(GSM510451)
newborn_rep7. (total RNA)		SRR553584(SRX182790)
source: Heart. (Heart)		mjTestesKO7()
Testes Data. (Zcchc11 testes)		SRR248525(GSM733813)
cell type: Thy1- spermatogonial stem cellstra. (testes)
...............................................................................CACCTTCTAATCACTAAAT........................................................................................................................................................ 191.000.00------------------------------------------------------------------------------1.00-----------------------
....................................................................................................................................................................................GATTCTTCTTCCTCCGAAC................................................... 191.000.00-------------------------------------------1.00----------------------------------------------------------