ID: mmu-mir-6984
GENE: Mrpl21(4)
chr19:3288784-3289033+


(1)
AGO.mut 		(16)
AGO2.ip 		(1)
AGO3.ip 		(11)
B-CELL 		(34)
BRAIN 		(5)
CELL-LINE 		(2)
DCR.mut 		(3)
DGCR8.mut 		(9)
EMBRYO 		(9)
ESC 		(6)
FIBROBLAST 		(4)
HEART 		(2)
KIDNEY 		(6)
LIVER 		(1)
LUNG 		(5)
LYMPH 		(19)
OTHER 		(2)
OTHER.mut 		(1)
OVARY 		(4)
PIWI.ip 		(2)
PIWI.mut 		(2)
SKIN 		(8)
SPLEEN 		(16)
TESTES 		(2)
THYMUS 		(2)
TOTAL-RNA 		(3)
UTERUS

Sense strand
CTACACAGGAAGCAGAGGTAGGAGGGTCAGAGGTCAGTTTATTCCTTGGATGTAAAGAGAATTTAAGGTTGGTCTGGGCTGCATGAGACCCCACTGCAGAACCAGGAATTCTCTGGGGAGCTTCCGCAAGTTGTGCGTGAAACTGAAAGGCAATGAAGGAGGAGCACTGTCACAGTGTACTTTCTTTCCTGTCTTTCTAGAAAGGAGCTTGTACGAGTTGAAGCCACAGTCATTGAAAAGACAGAATCAT
................................................................................................................................................((((((((..((((((((.((((((...)))))).))))))))..)))))))).....................................................
........................................................................................................................................137............................................................200................................................
SizePerfect hitTotal NormPerfect NormSRR546155(SRX180174)
Global profiling of miRNA and the hairpin pre. (ago2 Neuroblastoma)		SRR279907(GSM689057)
cell type: mouse embryonic stem cellcell line. (ESC)		SRR391847(GSM852142)
gender: femalegenotype/variation: ADAR2-/-/AD. (embryo)		SRR391846(GSM852141)
gender: femalegenotype/variation: ADAR2-/-tis. (embryo)		SRR391852(GSM852147)
gender: femalegenotype/variation: ADAR2-/-tis. (embryo)		SRR306542(GSM750585)
19-24nt. (ago2 brain)		SRR685339(GSM1079783)
"Small RNAs (15-50 nts in length) from immort. (cell line)		SRR042471(GSM539863)
mouse TFHS cells [09-002]. (spleen)		SRR346414(SRX098255)
Global profiling of miRNA and the hairpin pre. (Spleen)		SRR279903(GSM689053)
cell type: mouse embryonic stem cellcell line. (ESC)		SRR346417(SRX098258)
Global profiling of miRNA and the hairpin pre. (Brain)		SRR402760(SRX117943)
source: ES E14 male cells. (ESC)		GSM314557(GSM314557)
ESC dgcr8 (Illumina). (ESC)		SRR402762(SRX117945)
source: ES E14 male cells. (ESC)		SRR391853(GSM852148)
gender: femalegenotype/variation: ADAR2-/-/AD. (embryo)		SRR391851(GSM852146)
gender: femalegenotype/variation: wild typeti. (embryo)		SRR038742(GSM527277)
small RNA-Seq. (dgcr8 brain)		SRR248526(GSM733814)
cell type: Thy1- spermatogonial stem cellstra. (testes)		SRR279904(GSM689054)
cell type: mouse embryonic stem cellcell line. (ESC)		SRR039186(GSM485326)
shLuc.1309;ROSA-rtTA (+dox). (fibroblast)		mjTestesWT4()
Testes Data. (testes)		SRR390300(GSM849858)
cell line: NIH-3T3cell type: fibroblastinfect. (ago2 fibroblast)		SRR059766(GSM562828)
DN3_Drosha. (thymus)		SRR391845(GSM852140)
gender: femalegenotype/variation: wild typeti. (embryo)		SRR306541(GSM750584)
19-24nt. (ago2 brain)		SRR042477(GSM539869)
mouse brain tissue [09-002]. (brain)		SRR391849(GSM852144)
gender: femalegenotype/variation: ADAR2-/-tis. (embryo)		SRR034118(GSM466728)
Mili IP_Tdrd9+/- replicate1. (mili testes)		SRR042458(GSM539850)
mouse basophil cells [09-002]. (b cell)		SRR073954(GSM629280)
total RNA. (blood)		SRR042450(GSM539842)
mouse B cells activated in vitro with LPS/IL4 replicate 3 [09-002]. (b cell)		SRR042469(GSM539861)
mouse Th2 cells [09-002]. (lymph)		SRR042466(GSM539858)
mouse CD8+ T cells (spleen) [09-002]. (spleen)		SRR206941(GSM723282)
other. (brain)		SRR042444(GSM539836)
mouse pre B cells [09-002]. (b cell)		SRR042480(GSM539872)
mouse kidney tissue [09-002]. (kidney)		SRR042448(GSM539840)
mouse B cells activated in vitro with LPS/IL4 replicate 1 [09-002]. (b cell)		mjTestesWT3()
Testes Data. (testes)		SRR346416(SRX098257)
Global profiling of miRNA and the hairpin pre. (Kidney)		mjLiverWT3()
Liver Data. (liver)		SRR059769(GSM562831)
Treg_Drosha. (spleen)		SRR306544(GSM750587)
19-24nt. (ago2 brain)		SRR345200(SRX097261)
source: size fractionated RNA from mouse hipp. (brain)		SRR206942(GSM723283)
other. (brain)		SRR346424(SRX098266)
Global profiling of miRNA and the hairpin pre. (Neuroblastoma)		SRR032477(GSM485235)
sRNA_activation_deep_sequencing. (uterus)		SRR553582(SRX182788)
source: Brain. (Brain)		SRR039610(GSM527274)
small RNA-Seq. (brain)		SRR042472(GSM539864)
mouse iTreg cells [09-002]. (lymph)		RuiDGCR8KO(Rui)
DGCR8-dependent microRNA biogenesis is essent. (dgcr8 skin)		SRR042455(GSM539847)
mouse plasma cells [09-002]. (blood)		SRR042470(GSM539862)
mouse Th17 cells [09-002]. (lymph)		SRR034121(GSM466731)
Mili IP_Tdrd9-/- replicate2. (mili testes)		SRR402766(SRX117949)
source: ES PGK female cells. (ESC)		SRR028732(GSM400969)
Mili-Tdrd1 KO associated. (mili testes)		SRR042453(GSM539845)
mouse marginal zone B cells (spleen) [09-002]. (b cell)		SRR206940(GSM723281)
other. (brain)		SRR248527(GSM733815)
cell type: spermatogonial stem cell enriched . (testes)		SRR116846(GSM678422)
Small RNA deep sequencing from mouse epididym. (epididymis)		SRR038745(GSM527280)
small RNA-Seq. (dgcr8 brain)		SRR029123(GSM416611)
NIH3T3. (cell line)		SRR346413(SRX098254)
Global profiling of miRNA and the hairpin pre. (Heart)		SRR206939(GSM723280)
other. (brain)		SRR346423(SRX098265)
Global profiling of miRNA and the hairpin pre. (Brain)		SRR034119(GSM466729)
Mili IP_Tdrd9+/- replicate2. (mili testes)		SRR040489(GSM533912)
E18.5 Ago2 catalytically inactive LIVER small RNA. (ago2 liver)		SRR032476(GSM485234)
sRNA_delayed_deep_sequencing. (uterus)		SRR306540(GSM750583)
19-24nt. (ago2 brain)		SRR306529(GSM750572)
19-24nt. (ago2 brain)		SRR346419(SRX098260)
Global profiling of miRNA and the hairpin pre. (Lung)		SRR042484(GSM539876)
mouse salivary gland tissue [09-002]. (gland)		SRR553583(SRX182789)
source: Cerebellum. (Cerebellum)		SRR095855BC8(SRX039178)
sequencing of miRNA from wild type and diseas. (heart)		SRR391848(GSM852143)
gender: femalegenotype/variation: wild typeti. (embryo)		SRR042449(GSM539841)
mouse B cells activated in vitro with LPS/IL4 replicate 2 [09-002]. (b cell)		SRR306530(GSM750573)
19-24nt. (ago2 brain)		SRR042473(GSM539865)
mouse nTreg cells [09-002]. (lymph)		SRR345203(SRX097264)
source: size fractionated RNA from mouse hipp. (brain)		SRR402761(SRX117944)
source: ES E14 male cells. (ESC)		SRR346420(SRX098261)
Global profiling of miRNA and the hairpin pre. (Uterus)		mjLiverKO1()
Liver Data. (Zcchc11 liver)		GSM510454(GSM510454)
newborn_rep10. (total RNA)		SRR345201(SRX097262)
source: size fractionated RNA from mouse hipp. (brain)		SRR306538(GSM750581)
19-24nt. (ago2 brain)		SRR059770(GSM562832)
Treg_Dicer. (spleen)		SRR039184(GSM485324)
shLuc.1309 (+dox). (fibroblast)		SRR390297(GSM849855)
cell line: NIH-3T3cell type: fibroblastip ant. (fibroblast)		SRR065054(SRR065054)
Tissue-specific Regulation of Mouse MicroRNA . (jejunum)		SRR042467(GSM539859)
mouse T cells activated in vitro with Concanavalin A [09-002]. (spleen)		SRR042465(GSM539857)
mouse CD4+ T cells (spleen) [09-002]. (spleen)		SRR346425(SRX098267)
Global profiling of miRNA and the hairpin pre. (Neuroblastoma)		SRR345202(SRX097263)
source: size fractionated RNA from mouse hipp. (brain)		SRR038743(GSM527278)
small RNA-Seq. (dicer brain)		SRR248523(GSM733811)
cell type: Thy1+ spermatogonial stem cellstra. (testes)		SRR306543(GSM750586)
19-24nt. (ago2 brain)		SRR306537(GSM750580)
19-24nt. (ago2 brain)		SRR345205(SRX097266)
source: size fractionated RNA from mouse hipp. (brain)		SRR065055(SRR065055)
Tissue-specific Regulation of Mouse MicroRNA . (jejunum)		SRR042456(GSM539848)
mouse hematopoetic progenitor cells [09-002]. (bone marrow)		SRR037901(GSM510437)
testes_rep2. (testes)		SRR042447(GSM539839)
mouse mature B cells (spleen) replicate 2 [09-002]. (b cell)		SRR037914(GSM510451)
newborn_rep7. (total RNA)		SRR306534(GSM750577)
19-24nt. (ago2 brain)		SRR390299(GSM849857)
cell line: NIH-3T3cell type: fibroblastip ant. (ago2 fibroblast)		SRR039153(GSM471930)
HL1_siSrf1_smallRNAseq. (muscle)		SRR248525(GSM733813)
cell type: Thy1- spermatogonial stem cellstra. (testes)		SRR038741(GSM527276)
small RNA-Seq. (brain)		SRR346422(SRX098264)
Global profiling of miRNA and the hairpin pre. (Muscle)		Ago3IP812(Rui)
Quantitative functions of Argonaute proteins . (ago3 skin)		SRR039183(GSM485323)
shLuc.1309 (-dox). (fibroblast)		GSM519104(GSM519104)
mouse_granulocyte_nuclei_smallRNAs. (cell line)		SRR059765(GSM562827)
DN3_control. (thymus)		GSM416732(GSM416732)
MEF. (cell line)		SRR042454(GSM539846)
mouse germinal center B cells (lymph node) [09-002]. (b cell)		SRR042452(GSM539844)
mouse B1 B cells [09-002]. (b cell)		SRR042486(GSM539878)
mouse ovaries [09-002]. (ovary)		SRR553602(SRX182808)
source: Sertoli cells. (Sertoli cells)		SRR037928(GSM510466)
e7p5_rep2. (embryo)		SRR095855BC2(SRX039178)
sequencing of miRNA from wild type and diseas. (heart)		SRR065045(SRR065045)
Tissue-specific Regulation of Mouse MicroRNA . (liver)		SRR042468(GSM539860)
mouse Th1 cells [09-002]. (lymph)		SRR069809(GSM610965)
small RNA sequencing; sample 1. (testes)		SRR034120(GSM466730)
Mili IP_Tdrd9-/- replicate1. (mili testes)		SRR038744(GSM527279)
small RNA-Seq. (brain)		SRR095855BC7(SRX039178)
sequencing of miRNA from wild type and diseas. (heart)		SRR042443(GSM539835)
mouse pro B cells [09-002]. (b cell)		SRR345206(SRX097267)
source: size fractionated RNA from mouse hipp. (brain)		SRR065056(SRR065056)
Tissue-specific Regulation of Mouse MicroRNA . (jejunum)		SRR042459(GSM539851)
mouse neutrophil cells replicate 1 [09-002]. (blood)		GSM509277(GSM509277)
small RNA cloning by length. (piwi testes)		SRR042463(GSM539855)
mouse natural killer cells [09-002]. (spleen)		GSM640581(GSM640581)
small RNA in the liver with paternal control. (liver)		SRR014231(GSM319955)
16.5 dpc total. (testes)		SRR038740(GSM527275)
small RNA-Seq. (dicer brain)		SRR306531(GSM750574)
19-24nt. (ago2 brain)		SRR346421(SRX098263)
Global profiling of miRNA and the hairpin pre. (mixture)		SRR042445(GSM539837)
mouse immature B cells [09-002]. (b cell)		mjLiverKO3()
Liver Data. (Zcchc11 liver)		SRR306535(GSM750578)
19-24nt. (ago2 brain)		SRR042461(GSM539853)
mouse dendritic cells [09-002]. (bone marrow)		GSM509279(GSM509279)
MVH-/- E16.5 small RNA. (testes)		SRR042474(GSM539866)
mouse embryonic stem cells [09-002]. (ESC)		SRR037935(GSM510473)
293cand3. (cell line)		SRR073955(GSM629281)
total RNA. (blood)		SRR306536(GSM750579)
19-24nt. (ago2 brain)
.............................................................................................................................................ACTGAAAGGCAATGAAGGAGGAG......................................................................................23141.0041.00--3.003.002.001.00--2.001.00----1.001.00---1.00---1.00-2.00-------2.00-----1.001.002.00----1.002.00--1.00----------1.00-1.00-1.00-------1.00-1.00-1.00-1.00----1.00--------1.001.00--------------------------------------1.001.00----1.00-----
.............................................................................................................................................ACTGAAAGGCAATGAAGGAGGAGC.....................................................................................24139.0039.00-3.003.00-3.002.00--1.004.00--2.00--1.002.002.001.001.00--1.002.00-----1.001.00-----1.00---------1.00----------1.001.002.00--------------1.00----1.00-----------------------1.00-----------------------------------------
.............................................................................................................................................ACTGAAAGGCAATGAAGGAGGA.......................................................................................22122.0022.001.00--1.001.00---1.001.001.00--1.00-2.00-2.00-1.00--1.00--------------------1.002.00-1.00---------1.00------------1.00--------1.00---------------------1.00--------1.00-----------------------------------
.............................................................................................................................................ACTGAAAGGCAATGAAGGAGG........................................................................................21122.0022.00---2.00----4.00-2.007.00--1.00------------------1.001.00---1.00------------------------------------------------------------------1.00-1.00--1.00----------------------------------
.................................................................................................................................................................................TACTTTCTTTCCTGTCTTTCTAG..................................................23119.0019.003.00-----6.00--1.00--1.001.00----------1.00----1.00-----------------------------------1.00--2.00---------------------------------------1.00----------------------------1.00-------
.................................................................................................................................................................................TACTTTCTTTCCTGTCTTTCT....................................................21117.0017.004.00----2.002.00------3.001.00-2.00------------------------------1.00--------1.00----------1.00-----------------------------------------------------------------------------
...............................................................................................................................................TGAAAGGCAATGAAGGAGGAGCA....................................................................................23114.0014.00-1.00-----1.00-------------5.001.00-----------1.00---1.00------1.00--1.00-----------------1.00---------------------1.00--------------------------------------------------------
...............................................................................................................................................TGAAAGGCAATGAAGGAGGAGCAT...................................................................................24113.0014.00---1.00---4.00---------------------1.002.00---------------------------------------------2.00------------------------------------------1.00--------1.00-------1.00--------
.............................................................................................................................................ACTGAAAGGCAATGAAGGAGGAGCA....................................................................................25113.0013.00-3.00----------1.00--1.00---------1.00--1.00-------1.00--------------1.00----------1.00-1.00----1.00---------------------------------------------------------1.00-----------------
.............................................................................................................................................ACTGAAAGGCAATGAAGGAG.........................................................................................20111.0011.001.00--1.00------2.00--------------------------------------------------1.001.00----1.00----2.00-----------------------1.00--------------------------1.00---------------------
...............................................................................................................................................TGAAAGGCAATGAAGGAGGAG......................................................................................21110.0010.00-2.00-1.00-1.00-1.00------------5.00----------------------------------------------------------------------------------------------------------------------------
.................................................................................................................................................................................TACTTTCTTTCCTGTCTTTCTAGT.................................................2419.0019.004.00-------------------------------------------1.00---------------------------------1.00-2.00-------------------------------------1.00--------------------------
............................................................................................................................................AACTGAAAGGCAATGAAGGAG.........................................................................................2119.009.00-------------1.001.00---------2.00------1.00-----------------------1.00----------------------------------------------1.00-----------------------1.00--------------1.00---
..............................................................................................................................................CTGAAAGGCAATGAAGGAGGAG......................................................................................2218.008.001.00---1.00--1.00--------------2.00------1.00--1.00--------------------------------------------------------------1.00-------------------------------------------------
.............................................................................................................................................ACTGAAAGGCAATGAAGGAGGAA......................................................................................2318.0022.00--2.00-1.00--------------------------------------1.00-----------1.00---------------1.00-----------1.00------------------------------------------------------1.00------
..............................................................................................................................................CTGAAAGGCAATGAAGGAGGAGC.....................................................................................2318.008.00------------------4.00--------------------------------------------------------------2.00--------------------------------1.00-1.00----------------------------
............................................................................................................................................AACTGAAAGGCAATGAAGGAGG........................................................................................2216.006.00---------1.00----1.00--------------------1.00------------1.00----------------------------1.00----------------------------------1.00--------------------------------
...............................................................................................................................................TGAAAGGCAATGAAGGAGGAGC.....................................................................................2216.006.00--1.00--1.00-----------1.00--------------------1.00-1.00---------------------------------------------1.00----------------------------------------------------------
.........................................................................................................................................................................................................AAGGAGCTTGTACGAGTTGAAGCCACA......................2716.006.00---------------------------1.00------------------------2.00-1.00---------1.00---------------------------------------------------------1.00----------------------
..............................................................................................................................................CTGAAAGGCAATGAAGGAGGAGCA....................................................................................2416.006.00---------------1.00---------------2.00---------------------2.00--------------------1.00----------------------------------------------------------------------
...............................................................................................................................................TGAAAGGCAATGAAGGAGGAGCAA...................................................................................2415.0014.00------------------------------------------------------------------1.00------1.00----------------1.00------------------------1.00--------------1.00--------------
..................................................................................................................................................................................................................GTACGAGTTGAAGCCACAGTCATT................2415.005.00--1.002.001.00---------------------1.00----------------------------------------------------------------------------------------------------------------------
............................................................................................................................................AACTGAAAGGCAATGAAGGAGGA.......................................................................................2315.005.00----1.00-------1.00--------------------------1.00-----1.00------------------------1.00--------------------------------------------------------------------------
.............................................................................................................................................ACTGAAAGGCAATGAAGGAGGAGT.....................................................................................2415.0041.001.00---------1.00----------------------------------------------------1.00-------------------1.00-----------------------------------------1.00-------------------
.............................................................................................................................................ACTGAAAGGCAATGAAGGAGGAGCAT...................................................................................2615.0013.00----------------1.00--------1.00--1.00--------------------------------------------------------------------1.00--------------------------1.00--------------------
.................................................................................................................................................................................TACTTTCTTTCCTGTCTTTCTAGA.................................................2415.005.00------------2.00--------------------------------------------1.00--2.00------------------------------------------------------------------------------------
.............................................................................................................................................ACTGAAAGGCAATGAAGGAGGAGA.....................................................................................2414.0041.00----------1.00--------------------------3.00-----------------------------------------------------------------------------------------------------------
.............................................................................................................................................ACTGAAAGGCAATGAAGGA..........................................................................................1914.004.00----------------------------2.00--1.00-----------1.00-----------------------------------------------------------------------------------------------------
...............................................................................................................................................TGAAAGGCAATGAAGGAGGA.......................................................................................2014.004.00-2.001.00-------------------------------------1.00--------------------------------------------------------------------------------------------------------
.............................................................................................................................................ACTGAAAGGCAATGAAGGAGGAT......................................................................................2314.0022.00------1.00-1.00-1.00---------------------1.00----------------------------------------------------------------------------------------------------------------
...............................................................................................................................................TGAAAGGCAATGAAGGAGGAGT.....................................................................................2213.0010.00-----1.00------------------1.00--------------------------------------------------------------------------------------1.00---------------------------------
...............................................................................................................................................TGAAAGGCAATGAAGGAGGAGCAG...................................................................................2413.0014.00-3.00-----------------------------------------------------------------------------------------------------------------------------------------------
.................................................................................................AGAACCAGGAATTCTGTTT......................................................................................................................................193.000.00------------------------------------------1.00---------------------------------------2.00--------------------------------------------------------------
............................................................................................................................................AACTGAAAGGCAATGAAGGA..........................................................................................2012.002.00-------------------2.00-----------------------------------------------------------------------------------------------------------------------------
................................................................................................................................................GAAAGGCAATGAAGGAGGAGC.....................................................................................2112.002.00-------------------------------------------------------------------------------------1.00------------------------------------------------------1.00----
.................................................................................................................................................................................TACTTTCTTTCCTGTCTTTC.....................................................2012.002.001.00----------------------------------------1.00-------------------------------------------------------------------------------------------------------
..............................................................................................................................................CTGAAAGGCAATGAAGGAGGGGC.....................................................................................232.000.001.00----------------------------------------------------------------------------------------------------1.00-------------------------------------------
..............................................................................................................................................CTGAAAGGCAATGAAGGAGGA.......................................................................................2112.002.00-----1.00--------------------------------------------------------------------------------------------1.00----------------------------------------------
..................................................................................................................................................................................ACTTTCTTTCCTGTCTTTCTAGA.................................................2312.002.00-------------------------------------------------2.00-----------------------------------------------------------------------------------------------
...............................................................................................................................................TGAAAGGCAATGAAGGAGGAGCATT..................................................................................2512.0014.00-------1.00-------------------------------------1.00---------------------------------------------------------------------------------------------------
...............................................................................................................................................TGAAAGGCAATGAAGGAGGAGCT....................................................................................2312.006.00----------------------------------1.00------------------------------------------------------1.00-------------------------------------------------------
....................................................................................................................................................................................................................ACGAGTTGAAGCCACAGTCATT................2221.501.50--0.50--------------------0.50--0.50----------------------------------------------------------------------------------------------------------------------
..............................................................................................................................................CTGAAAGGCAATGAAGGAGGAGCAAA..................................................................................2611.006.00---------------------------------------------------1.00---------------------------------------------------------------------------------------------
................................................................................................................................................................................................................TTGTACGAGTTGAAGCCACAGTCATTG...............2711.001.00------------------------------------------------------------------------------------------------------------------------------------1.00------------
.................................................................................................................................................................................................................TGTACGAGTTGAAGCCACAG.....................2011.001.00--------------------------1.00----------------------------------------------------------------------------------------------------------------------
...........................................................................................................................................AAACTGAAAGGCAATGAAGGAGGAGC.....................................................................................2611.001.00---------------------------------------------------------------------------------------------------------------------------------1.00---------------
...............................................................................................................................................TGAAAGGCAATGAAGGAGGAGCAGAA.................................................................................2611.0014.00------------------------------1.00------------------------------------------------------------------------------------------------------------------
.............................................................................................................................................ACTGAAAGGCAATGAAGGAGGAGCT....................................................................................2511.0039.00----------------------------------------------------------1.00--------------------------------------------------------------------------------------
........................................ATTCCTTGGATGTAAAGAGAATTT..........................................................................................................................................................................................2411.001.00--------------------------1.00----------------------------------------------------------------------------------------------------------------------
............................................................................................................................................AACTGAAAGGCAATGAACAA..........................................................................................201.000.00--------------------------------------------------------------------------------------------------------1.00----------------------------------------
.............................................................................................................................................ACTGAAAGGCAATGAAGGAGGAACG....................................................................................2511.0022.00--------------------------------------------------1.00----------------------------------------------------------------------------------------------
..................................................................................................................................................................................ACTTTCTTTCCTGTCTTTCTAG..................................................2211.001.001.00------------------------------------------------------------------------------------------------------------------------------------------------
............................................................................................................................................AACTGAAAGGCAATGAAGGAGGAGCAT...................................................................................2711.001.001.00------------------------------------------------------------------------------------------------------------------------------------------------
..........................................................................................................................................................................................................AGGAGCTTGTACGAGTTGAAGCCACAGTC...................2911.001.00---------------------------1.00---------------------------------------------------------------------------------------------------------------------
.............................................................................................................................................ACTGAAAGGCAATGAAGGAGGAGTA....................................................................................2511.0041.00----------------1.00--------------------------------------------------------------------------------------------------------------------------------
.............................................................................................................................................ACTGAAAGGCAATGAAGGAGGAAT.....................................................................................2411.0022.001.00------------------------------------------------------------------------------------------------------------------------------------------------
.............AGAGGTAGGAGGGTCATCCA.........................................................................................................................................................................................................................201.000.00---------------------------------------------------------------------------------------------------------------------1.00---------------------------
.................................................................................................................................................................................TACTTTCTTTCCTGTCTT.......................................................1811.001.00--------------------------------------------------------------------------------------------1.00----------------------------------------------------
...............................................................................................................................................TGAAAGGCAATGAAGGAGGAGCAAAT.................................................................................2611.0014.00------------------------------------1.00------------------------------------------------------------------------------------------------------------
.....CAGGAAGCAGAGGTAGGACCC................................................................................................................................................................................................................................211.000.00-----------------------------------1.00-------------------------------------------------------------------------------------------------------------
...............................................................................................................................................TGAAAGGCAATGAAGGAGGAA......................................................................................2111.004.00-------1.00-----------------------------------------------------------------------------------------------------------------------------------------
................................................................................................................................................GAAAGGCAATGAAGGAGGAG......................................................................................2011.001.00---------------------------------------------------------------------------1.00---------------------------------------------------------------------
................................................................................................................................................GAAAGGCAATGAAGGAGGAGCA....................................................................................2211.001.00--------------------------------1.00----------------------------------------------------------------------------------------------------------------
........GAAGCAGAGGTAGGAGGGGCA.............................................................................................................................................................................................................................211.000.00---------------------------------------------------------------------------------------1.00---------------------------------------------------------
...............................................................................................................................................TGAAAGGCAATGAAGGAGGAGCTT...................................................................................2411.006.00-----------------------------------1.00-------------------------------------------------------------------------------------------------------------
..............................................................................................................................................CTGAAAGGCAATGAAGGAGGAGCACTGTCACAGTGTACTTTCTTTCCTGTCTTTCTAGA.................................................5911.001.00---------------------------------------------------------------------------------------------------------------------------------------1.00---------
...............................................................................................................................................TGAAAGGCAATGAAGGAGA........................................................................................191.000.00-----------------------------------------------------------------------------------------------------------------------------------1.00-------------
............................................................................................................................................AACTGAAAGGCAATGAAGGAAG........................................................................................2211.002.00--------------------------------1.00----------------------------------------------------------------------------------------------------------------
.........................................................................................................................................................................................................AAGGAGCTTGTACGAGTTGAAGCCAC.......................2611.001.00------------------------------------------------------1.00------------------------------------------------------------------------------------------
..............................................................................................................................................CTGAAAGGCAATGAAGGAGTAG......................................................................................221.000.00------------------------------------------------------------------------------------------------------------------------1.00------------------------
............................................................................................................................................AACTGAAAGGCAATGAAGGAGGAGCA....................................................................................2611.001.00-----------------------------------------------------------------------1.00-------------------------------------------------------------------------
............................................................................................................................................AACTGAAAGGCAATGAAGGAGGT.......................................................................................2311.006.00----------------------------------------------------------------------------------------------------------1.00--------------------------------------
......AGGAAGCAGAGGTAGCGGG.................................................................................................................................................................................................................................191.000.00------------------------------------------1.00------------------------------------------------------------------------------------------------------
..............................................................................................................................................CTGAAAGGCAATGAAGGAGGAGCAT...................................................................................2511.006.00---------------------------------1.00---------------------------------------------------------------------------------------------------------------
...............................................................................................................................................TGAAAGGCAATGAAGGAGG........................................................................................1921.001.00---------------------------------------1.00---------------------------------------------------------------------------------------------------------
.......................................................................................ACCCCACTGCAGAACCAAGG...............................................................................................................................................201.000.00------------------------------------------1.00------------------------------------------------------------------------------------------------------
..................................................................................................................................................AAGGCAATGAAGGAGGAGCA....................................................................................2011.001.00-----------------------------------------------------------------------------------------------------------------1.00-------------------------------
.....CAGGAAGCAGAGGTAGATGT.................................................................................................................................................................................................................................201.000.00-------------------------------------------------------------------------------------------------------------------------1.00-----------------------
.............................................................................................................................................ACTGAAAGGCAATGAAGGACCCG......................................................................................2311.004.00-----------------------1.00-------------------------------------------------------------------------------------------------------------------------
.....................................................................................................................................................GCAATGAAGGAGGAGCGGG..................................................................................191.000.00---------------------------------------------------------------------------------------------------1.00---------------------------------------------
...............................................................................................................................................TGAAAGGCAATGAAGGAGGAGCAAT..................................................................................2511.0014.00----------------------------------------------------------------------1.00--------------------------------------------------------------------------
...........................................................................................................................................................................................................................GAAGCCACAGTCATTGAAAAGA.........2220.500.50--------------0.50----------------------------------------------------------------------------------------------------------------------------------
.............................................................................................................................................................................................................................AGCCACAGTCATTGAAAAGACA.......2220.500.50----------------------------------------------------------------------------------------------------------------------------------------------0.50--
...................................................................................................................................................................................................................................AGTCATTGAAAAGACAGAATC..2120.500.50--------------0.50----------------------------------------------------------------------------------------------------------------------------------
................................................................AAGGTTGGTCTGGGCTGCAT......................................................................................................................................................................2020.500.50--------------------------0.50----------------------------------------------------------------------------------------------------------------------
...............................................................................................................................................TGAAAGGCAATGAAGG...........................................................................................1630.330.33---0.33---------------------------------------------------------------------------------------------------------------------------------------------
......................................................................................................................................................................................................................................CATTGAAAAGACAGAAT...1730.330.33-----------------------------------------------------------------------------------------------------------------------------------------------0.33-
.................................................................................................................................................................................TACTTTCTTTCCTGTC.........................................................1690.110.11------------------------------------------------------------------------------------------------------------------------------------------------0.11

Antisense strand
CTACACAGGAAGCAGAGGTAGGAGGGTCAGAGGTCAGTTTATTCCTTGGATGTAAAGAGAATTTAAGGTTGGTCTGGGCTGCATGAGACCCCACTGCAGAACCAGGAATTCTCTGGGGAGCTTCCGCAAGTTGTGCGTGAAACTGAAAGGCAATGAAGGAGGAGCACTGTCACAGTGTACTTTCTTTCCTGTCTTTCTAGAAAGGAGCTTGTACGAGTTGAAGCCACAGTCATTGAAAAGACAGAATCAT
................................................................................................................................................((((((((..((((((((.((((((...)))))).))))))))..)))))))).....................................................
........................................................................................................................................137............................................................200................................................
SizePerfect hitTotal NormPerfect NormSRR546155(SRX180174)
Global profiling of miRNA and the hairpin pre. (ago2 Neuroblastoma)		SRR279907(GSM689057)
cell type: mouse embryonic stem cellcell line. (ESC)		SRR391847(GSM852142)
gender: femalegenotype/variation: ADAR2-/-/AD. (embryo)		SRR391846(GSM852141)
gender: femalegenotype/variation: ADAR2-/-tis. (embryo)		SRR391852(GSM852147)
gender: femalegenotype/variation: ADAR2-/-tis. (embryo)		SRR306542(GSM750585)
19-24nt. (ago2 brain)		SRR685339(GSM1079783)
"Small RNAs (15-50 nts in length) from immort. (cell line)		SRR042471(GSM539863)
mouse TFHS cells [09-002]. (spleen)		SRR346414(SRX098255)
Global profiling of miRNA and the hairpin pre. (Spleen)		SRR279903(GSM689053)
cell type: mouse embryonic stem cellcell line. (ESC)		SRR346417(SRX098258)
Global profiling of miRNA and the hairpin pre. (Brain)		SRR402760(SRX117943)
source: ES E14 male cells. (ESC)		GSM314557(GSM314557)
ESC dgcr8 (Illumina). (ESC)		SRR402762(SRX117945)
source: ES E14 male cells. (ESC)		SRR391853(GSM852148)
gender: femalegenotype/variation: ADAR2-/-/AD. (embryo)		SRR391851(GSM852146)
gender: femalegenotype/variation: wild typeti. (embryo)		SRR038742(GSM527277)
small RNA-Seq. (dgcr8 brain)		SRR248526(GSM733814)
cell type: Thy1- spermatogonial stem cellstra. (testes)		SRR279904(GSM689054)
cell type: mouse embryonic stem cellcell line. (ESC)		SRR039186(GSM485326)
shLuc.1309;ROSA-rtTA (+dox). (fibroblast)		mjTestesWT4()
Testes Data. (testes)		SRR390300(GSM849858)
cell line: NIH-3T3cell type: fibroblastinfect. (ago2 fibroblast)		SRR059766(GSM562828)
DN3_Drosha. (thymus)		SRR391845(GSM852140)
gender: femalegenotype/variation: wild typeti. (embryo)		SRR306541(GSM750584)
19-24nt. (ago2 brain)		SRR042477(GSM539869)
mouse brain tissue [09-002]. (brain)		SRR391849(GSM852144)
gender: femalegenotype/variation: ADAR2-/-tis. (embryo)		SRR034118(GSM466728)
Mili IP_Tdrd9+/- replicate1. (mili testes)		SRR042458(GSM539850)
mouse basophil cells [09-002]. (b cell)		SRR073954(GSM629280)
total RNA. (blood)		SRR042450(GSM539842)
mouse B cells activated in vitro with LPS/IL4 replicate 3 [09-002]. (b cell)		SRR042469(GSM539861)
mouse Th2 cells [09-002]. (lymph)		SRR042466(GSM539858)
mouse CD8+ T cells (spleen) [09-002]. (spleen)		SRR206941(GSM723282)
other. (brain)		SRR042444(GSM539836)
mouse pre B cells [09-002]. (b cell)		SRR042480(GSM539872)
mouse kidney tissue [09-002]. (kidney)		SRR042448(GSM539840)
mouse B cells activated in vitro with LPS/IL4 replicate 1 [09-002]. (b cell)		mjTestesWT3()
Testes Data. (testes)		SRR346416(SRX098257)
Global profiling of miRNA and the hairpin pre. (Kidney)		mjLiverWT3()
Liver Data. (liver)		SRR059769(GSM562831)
Treg_Drosha. (spleen)		SRR306544(GSM750587)
19-24nt. (ago2 brain)		SRR345200(SRX097261)
source: size fractionated RNA from mouse hipp. (brain)		SRR206942(GSM723283)
other. (brain)		SRR346424(SRX098266)
Global profiling of miRNA and the hairpin pre. (Neuroblastoma)		SRR032477(GSM485235)
sRNA_activation_deep_sequencing. (uterus)		SRR553582(SRX182788)
source: Brain. (Brain)		SRR039610(GSM527274)
small RNA-Seq. (brain)		SRR042472(GSM539864)
mouse iTreg cells [09-002]. (lymph)		RuiDGCR8KO(Rui)
DGCR8-dependent microRNA biogenesis is essent. (dgcr8 skin)		SRR042455(GSM539847)
mouse plasma cells [09-002]. (blood)		SRR042470(GSM539862)
mouse Th17 cells [09-002]. (lymph)		SRR034121(GSM466731)
Mili IP_Tdrd9-/- replicate2. (mili testes)		SRR402766(SRX117949)
source: ES PGK female cells. (ESC)		SRR028732(GSM400969)
Mili-Tdrd1 KO associated. (mili testes)		SRR042453(GSM539845)
mouse marginal zone B cells (spleen) [09-002]. (b cell)		SRR206940(GSM723281)
other. (brain)		SRR248527(GSM733815)
cell type: spermatogonial stem cell enriched . (testes)		SRR116846(GSM678422)
Small RNA deep sequencing from mouse epididym. (epididymis)		SRR038745(GSM527280)
small RNA-Seq. (dgcr8 brain)		SRR029123(GSM416611)
NIH3T3. (cell line)		SRR346413(SRX098254)
Global profiling of miRNA and the hairpin pre. (Heart)		SRR206939(GSM723280)
other. (brain)		SRR346423(SRX098265)
Global profiling of miRNA and the hairpin pre. (Brain)		SRR034119(GSM466729)
Mili IP_Tdrd9+/- replicate2. (mili testes)		SRR040489(GSM533912)
E18.5 Ago2 catalytically inactive LIVER small RNA. (ago2 liver)		SRR032476(GSM485234)
sRNA_delayed_deep_sequencing. (uterus)		SRR306540(GSM750583)
19-24nt. (ago2 brain)		SRR306529(GSM750572)
19-24nt. (ago2 brain)		SRR346419(SRX098260)
Global profiling of miRNA and the hairpin pre. (Lung)		SRR042484(GSM539876)
mouse salivary gland tissue [09-002]. (gland)		SRR553583(SRX182789)
source: Cerebellum. (Cerebellum)		SRR095855BC8(SRX039178)
sequencing of miRNA from wild type and diseas. (heart)		SRR391848(GSM852143)
gender: femalegenotype/variation: wild typeti. (embryo)		SRR042449(GSM539841)
mouse B cells activated in vitro with LPS/IL4 replicate 2 [09-002]. (b cell)		SRR306530(GSM750573)
19-24nt. (ago2 brain)		SRR042473(GSM539865)
mouse nTreg cells [09-002]. (lymph)		SRR345203(SRX097264)
source: size fractionated RNA from mouse hipp. (brain)		SRR402761(SRX117944)
source: ES E14 male cells. (ESC)		SRR346420(SRX098261)
Global profiling of miRNA and the hairpin pre. (Uterus)		mjLiverKO1()
Liver Data. (Zcchc11 liver)		GSM510454(GSM510454)
newborn_rep10. (total RNA)		SRR345201(SRX097262)
source: size fractionated RNA from mouse hipp. (brain)		SRR306538(GSM750581)
19-24nt. (ago2 brain)		SRR059770(GSM562832)
Treg_Dicer. (spleen)		SRR039184(GSM485324)
shLuc.1309 (+dox). (fibroblast)		SRR390297(GSM849855)
cell line: NIH-3T3cell type: fibroblastip ant. (fibroblast)		SRR065054(SRR065054)
Tissue-specific Regulation of Mouse MicroRNA . (jejunum)		SRR042467(GSM539859)
mouse T cells activated in vitro with Concanavalin A [09-002]. (spleen)		SRR042465(GSM539857)
mouse CD4+ T cells (spleen) [09-002]. (spleen)		SRR346425(SRX098267)
Global profiling of miRNA and the hairpin pre. (Neuroblastoma)		SRR345202(SRX097263)
source: size fractionated RNA from mouse hipp. (brain)		SRR038743(GSM527278)
small RNA-Seq. (dicer brain)		SRR248523(GSM733811)
cell type: Thy1+ spermatogonial stem cellstra. (testes)		SRR306543(GSM750586)
19-24nt. (ago2 brain)		SRR306537(GSM750580)
19-24nt. (ago2 brain)		SRR345205(SRX097266)
source: size fractionated RNA from mouse hipp. (brain)		SRR065055(SRR065055)
Tissue-specific Regulation of Mouse MicroRNA . (jejunum)		SRR042456(GSM539848)
mouse hematopoetic progenitor cells [09-002]. (bone marrow)		SRR037901(GSM510437)
testes_rep2. (testes)		SRR042447(GSM539839)
mouse mature B cells (spleen) replicate 2 [09-002]. (b cell)		SRR037914(GSM510451)
newborn_rep7. (total RNA)		SRR306534(GSM750577)
19-24nt. (ago2 brain)		SRR390299(GSM849857)
cell line: NIH-3T3cell type: fibroblastip ant. (ago2 fibroblast)		SRR039153(GSM471930)
HL1_siSrf1_smallRNAseq. (muscle)		SRR248525(GSM733813)
cell type: Thy1- spermatogonial stem cellstra. (testes)		SRR038741(GSM527276)
small RNA-Seq. (brain)		SRR346422(SRX098264)
Global profiling of miRNA and the hairpin pre. (Muscle)		Ago3IP812(Rui)
Quantitative functions of Argonaute proteins . (ago3 skin)		SRR039183(GSM485323)
shLuc.1309 (-dox). (fibroblast)		GSM519104(GSM519104)
mouse_granulocyte_nuclei_smallRNAs. (cell line)		SRR059765(GSM562827)
DN3_control. (thymus)		GSM416732(GSM416732)
MEF. (cell line)		SRR042454(GSM539846)
mouse germinal center B cells (lymph node) [09-002]. (b cell)		SRR042452(GSM539844)
mouse B1 B cells [09-002]. (b cell)		SRR042486(GSM539878)
mouse ovaries [09-002]. (ovary)		SRR553602(SRX182808)
source: Sertoli cells. (Sertoli cells)		SRR037928(GSM510466)
e7p5_rep2. (embryo)		SRR095855BC2(SRX039178)
sequencing of miRNA from wild type and diseas. (heart)		SRR065045(SRR065045)
Tissue-specific Regulation of Mouse MicroRNA . (liver)		SRR042468(GSM539860)
mouse Th1 cells [09-002]. (lymph)		SRR069809(GSM610965)
small RNA sequencing; sample 1. (testes)		SRR034120(GSM466730)
Mili IP_Tdrd9-/- replicate1. (mili testes)		SRR038744(GSM527279)
small RNA-Seq. (brain)		SRR095855BC7(SRX039178)
sequencing of miRNA from wild type and diseas. (heart)		SRR042443(GSM539835)
mouse pro B cells [09-002]. (b cell)		SRR345206(SRX097267)
source: size fractionated RNA from mouse hipp. (brain)		SRR065056(SRR065056)
Tissue-specific Regulation of Mouse MicroRNA . (jejunum)		SRR042459(GSM539851)
mouse neutrophil cells replicate 1 [09-002]. (blood)		GSM509277(GSM509277)
small RNA cloning by length. (piwi testes)		SRR042463(GSM539855)
mouse natural killer cells [09-002]. (spleen)		GSM640581(GSM640581)
small RNA in the liver with paternal control. (liver)		SRR014231(GSM319955)
16.5 dpc total. (testes)		SRR038740(GSM527275)
small RNA-Seq. (dicer brain)		SRR306531(GSM750574)
19-24nt. (ago2 brain)		SRR346421(SRX098263)
Global profiling of miRNA and the hairpin pre. (mixture)		SRR042445(GSM539837)
mouse immature B cells [09-002]. (b cell)		mjLiverKO3()
Liver Data. (Zcchc11 liver)		SRR306535(GSM750578)
19-24nt. (ago2 brain)		SRR042461(GSM539853)
mouse dendritic cells [09-002]. (bone marrow)		GSM509279(GSM509279)
MVH-/- E16.5 small RNA. (testes)		SRR042474(GSM539866)
mouse embryonic stem cells [09-002]. (ESC)		SRR037935(GSM510473)
293cand3. (cell line)		SRR073955(GSM629281)
total RNA. (blood)		SRR306536(GSM750579)
19-24nt. (ago2 brain)
................................................................................................................................................................................................................................CACAGTCATTGAAAAGACC....... 191.000.00-------------------------------------------------------------------------------------------1.00-----------------------------------------------------
................................................................................................................................................................................GTACTTTCTTTCCTGTCTTTCTAGAAA............................................... 2711.001.00---------------------------1.00---------------------------------------------------------------------------------------------------------------------
...............................................................................................................................................................................TGTACTTTCTTTCCTGTCTTTCTAGAAA............................................... 2811.001.00---------------------------1.00---------------------------------------------------------------------------------------------------------------------