ID: mmu-mir-6983
GENE: Csf1r(8)
chr18:61277017-61277235+


(1)
AGO.mut 		(2)
AGO1.ip 		(5)
AGO2.ip 		(2)
AGO3.ip 		(2)
B-CELL 		(17)
BRAIN 		(2)
CELL-LINE 		(2)
DCR.mut 		(1)
DGCR8.mut 		(4)
EMBRYO 		(1)
ESC 		(4)
HEART 		(1)
KIDNEY 		(11)
LIVER 		(2)
LUNG 		(12)
OTHER 		(3)
OTHER.mut 		(1)
PANCREAS 		(1)
PIWI.mut 		(6)
SKIN 		(3)
SPLEEN 		(8)
TESTES 		(1)
TOTAL-RNA 		(1)
UTERUS

Sense strand
TACCCTCAGCCCAGCGTGACATGGATGGAGTGCAGGGGCCACACCGATAGGTCAGTGGGCTTGGTTTTCCTCCTTAGGGTGAGTCTAAGTCTGGGTTGCGTACCCATGACTTGGAAGGGCATACTGATTCGGGAGACCCTAAAGCCTGAATCAAAGTCTGTTGTTCCAGGTGTGATGAAGCCCAGGCTTTGCAGGTTTGGAATGACACCCACCCTGAAG
...............................................................................................................(((((.((((.(((((((((((...........)))))))))..)).)))).)))))...................................................
.........................................................................................................106............................................................169................................................
SizePerfect hitTotal NormPerfect NormmjLiverWT2()
Liver Data. (liver)		mjLiverKO1()
Liver Data. (Zcchc11 liver)		SRR346414(SRX098255)
Global profiling of miRNA and the hairpin pre. (Spleen)		SRR042456(GSM539848)
mouse hematopoetic progenitor cells [09-002]. (bone marrow)		SRR206942(GSM723283)
other. (brain)		SRR038744(GSM527279)
small RNA-Seq. (brain)		SRR346418(SRX098259)
Global profiling of miRNA and the hairpin pre. (Liver)		SRR206941(GSM723282)
other. (brain)		GSM510444(GSM510444)
brain_rep5. (brain)		SRR206940(GSM723281)
other. (brain)		mjTestesWT1()
Testes Data. (testes)		SRR248523(GSM733811)
cell type: Thy1+ spermatogonial stem cellstra. (testes)		SRR553602(SRX182808)
source: Sertoli cells. (Sertoli cells)		SRR038743(GSM527278)
small RNA-Seq. (dicer brain)		SRR038742(GSM527277)
small RNA-Seq. (dgcr8 brain)		SRR042462(GSM539854)
mouse macrophages [09-002]. (bone marrow)		SRR346423(SRX098265)
Global profiling of miRNA and the hairpin pre. (Brain)		Ago2IP504(Rui)
Quantitative functions of Argonaute proteins . (ago2 skin)		SRR248524(GSM733812)
cell type: Thy1+ spermatogonial stem cellstra. (testes)		Ago1IP517(Rui)
Quantitative functions of Argonaute proteins . (ago1 skin)		SRR095855BC2(SRX039178)
sequencing of miRNA from wild type and diseas. (heart)		SRR346417(SRX098258)
Global profiling of miRNA and the hairpin pre. (Brain)		Ago3IP805(Rui)
Quantitative functions of Argonaute proteins . (ago3 skin)		SRR095855BC7(SRX039178)
sequencing of miRNA from wild type and diseas. (heart)		SRR042443(GSM539835)
mouse pro B cells [09-002]. (b cell)		SRR073954(GSM629280)
total RNA. (blood)		SRR073955(GSM629281)
total RNA. (blood)		SRR040489(GSM533912)
E18.5 Ago2 catalytically inactive LIVER small RNA. (ago2 liver)		SRR553582(SRX182788)
source: Brain. (Brain)		Ago3IP812(Rui)
Quantitative functions of Argonaute proteins . (ago3 skin)		Ago2IP517(Rui)
Quantitative functions of Argonaute proteins . (ago2 skin)		SRR346419(SRX098260)
Global profiling of miRNA and the hairpin pre. (Lung)		SRR039610(GSM527274)
small RNA-Seq. (brain)		SRR042461(GSM539853)
mouse dendritic cells [09-002]. (bone marrow)		SRR306539(GSM750582)
19-24nt. (ago2 brain)		SRR059770(GSM562832)
Treg_Dicer. (spleen)		SRR037905(GSM510441)
brain_rep2. (brain)		GSM509280(GSM509280)
small RNA cloning by length. (testes)		Ago1IP812(Rui)
Quantitative functions of Argonaute proteins . (ago1 skin)		SRR391845(GSM852140)
gender: femalegenotype/variation: wild typeti. (embryo)		mjTestesKO7()
Testes Data. (Zcchc11 testes)		SRR391846(GSM852141)
gender: femalegenotype/variation: ADAR2-/-tis. (embryo)		SRR014230(GSM319954)
10 dpp Dnmt3L-KO MILI. (mili testes)		SRR042478(GSM539870)
mouse lung tissue [09-002]. (lung)		SRR095853(SRX039174)
"sequencing of miRNA from wild type and disea. (heart)		SRR037929(GSM510467)
e7p5_rep3. (embryo)		SRR042471(GSM539863)
mouse TFHS cells [09-002]. (spleen)		GSM640579(GSM640579)
small RNA in the liver with paternal Low pro. (liver)		SRR023852(GSM307161)
ZHBT-c424hsmallrna_rep1. (cell line)		SRR065047(SRR065047)
Tissue-specific Regulation of Mouse MicroRNA . (liver)		SRR525243(SRA056111/SRX170319)
Mus musculus domesticus miRNA sequencing. (ago2 Blood)		SRR345207(SRX097268)
source: size fractionated RNA from mouse hipp. (brain)		SRR042459(GSM539851)
mouse neutrophil cells replicate 1 [09-002]. (blood)		SRR345200(SRX097261)
source: size fractionated RNA from mouse hipp. (brain)		SRR037921(GSM510459)
e12p5_rep3. (embryo)		SRR042447(GSM539839)
mouse mature B cells (spleen) replicate 2 [09-002]. (b cell)		SRR040488(GSM533911)
E18.5 wild type LIVER small RNA. (liver)		SRR065058(SRR065058)
Tissue-specific Regulation of Mouse MicroRNA . (pancreas)		SRR039154(GSM471931)
HL1_siSrf2_smallRNAseq. (muscle)		SRR553584(SRX182790)
source: Heart. (Heart)		SRR039152(GSM471929)
HL1_siNon_smallRNAseq. (muscle)		mjLiverWT3()
Liver Data. (liver)		SRR553585(SRX182791)
source: Kidney. (Kidney)		SRR032477(GSM485235)
sRNA_activation_deep_sequencing. (uterus)		SRR346415(SRX098256)
source: Testis. (Testes)		SRR038740(GSM527275)
small RNA-Seq. (dicer brain)		GSM519104(GSM519104)
mouse_granulocyte_nuclei_smallRNAs. (cell line)		GSM510456(GSM510456)
newborn_rep12. (total RNA)		SRR042479(GSM539871)
mouse liver tissue [09-002]. (liver)		SRR077864(GSM637801)
18-30 nt small RNAs. (liver)		SRR042484(GSM539876)
mouse salivary gland tissue [09-002]. (gland)		SRR042460(GSM539852)
mouse neutrophil cells replicate 2 [09-002]. (blood)		SRR306538(GSM750581)
19-24nt. (ago2 brain)		SRR042474(GSM539866)
mouse embryonic stem cells [09-002]. (ESC)		SRR077866(GSM637803)
18-30 nt small RNAs. (liver)		mjTestesKO6()
Testes Data. (Zcchc11 testes)
..................................................................................................................................................TGAATCAAAGTCTGTTGTTCCAG..................................................23185.0085.0030.0013.004.00-5.002.004.003.00-5.00-2.003.001.001.00-1.00-1.00-1.00------1.001.00--2.00------------------1.00-----------1.00--1.001.00--1.00------
..................................................................................................................................................TGAATCAAAGTCTGTTGTTCCAGT.................................................24120.0085.00------1.00-2.00--1.00-----2.001.00--1.001.001.00-1.00--1.00---1.00--------------1.001.00-----1.00-1.00--1.00----1.00--1.00--------
..............................................................................................................TTGGAAGGGCATACTGATTCGG.......................................................................................22115.0015.00---1.00--1.001.001.00------1.00---2.00----2.00----1.00---1.00---1.00-1.00---------1.00-----------------------1.00--
..............................................................................................................TTGGAAGGGCATACTGATTCGGG......................................................................................23114.0014.00---3.00-------1.00---1.00-1.00----1.00------1.002.00----------1.00----1.00----------------1.00------1.00-----
..................................................................................................................................................TGAATCAAAGTCTGTTGTTC.....................................................2018.008.00--1.00--1.00--------1.00-2.00-----------------1.001.001.00---------------------------------------
..................................................................................................................................................TGAATCAAAGTCTGTTGTTCC....................................................2117.007.00--2.00-1.001.00-1.00-----1.001.00-------------------------------------------------------------
................TGACATGGATGGAGTGCAGGGGCCAC.................................................................................................................................................................................2615.005.00----------5.00-----------------------------------------------------------------
..................................................................................................................................................TGAATCAAAGTCTGTTGTTCCA...................................................2215.005.00----1.00---1.00----1.00------1.00--1.00----------------------------------------------------
..............................................................................................................TTGGAAGGGCATACTGATTCTGG......................................................................................2312.001.00---1.00----------------------------------------------------------------1.00-------
..................................................................................................................................................TGAATCAAAGTCTGTTGTT......................................................1922.002.00----------------------------------0.50-------------------------------------1.00-0.50-
..................................................................................................................................................TGAATCAAAGTCTGTTGTTCCAGA.................................................2412.0085.00-------1.00-----------------------------------------------------1.00--------------
...................................................................................................................................................GAATCAAAGTCTGTTGTTCCAGT.................................................232.000.00-----1.00--1.00-------------------------------------------------------------------
..............................................................................................................TTGGAAGGGCATACTGATTCG........................................................................................2112.002.00---------------1.00---------------------------1.00--------------------------------
..................................................................................................................................................TGAATCAAAGTCTGTTGTTCCCG..................................................2312.007.00--1.00-----------------------------1.00-------------------------------------------
.............................................................................................................CTTGGAAGGGCATACTGATTCGG.......................................................................................2311.001.00---------------------------------1.00------------------------------------------
...................................................................................TCTAAGTCTGGGTTGCG.......................................................................................................................1711.001.00----------------------------------------1.00-----------------------------------
........................................................................CTTAGGGTGAGTCTATATC................................................................................................................................191.000.00----------------------------------------------------------1.00-----------------
..............................................................................................................TTGGAAGGGCATACTGATTCGGGAT....................................................................................2511.001.00---1.00------------------------------------------------------------------------
...............................................................................................................TGGAAGGGCATACTGATTCGG.......................................................................................2111.001.00---------------------1.00------------------------------------------------------
.......................GATGGAGTGCAGGGGCCACAC...............................................................................................................................................................................2111.001.00---------------------------1.00------------------------------------------------
............................................................................................................ACTTGGAAGGGCATACTGATTCG........................................................................................2311.001.00---------------------------------------------------1.00------------------------
..............................................................................................................TTGGAAGGGCATACTGATTCGGA......................................................................................2311.0015.00---------------------------------------------------------1.00------------------
..................................................................................................................................................TGAATCAAAGTCTGTTGTTCCAGAA................................................2511.0085.00---------------------------------------------1.00------------------------------
.................................................................................................................................................CTGAATCAAAGTCTGTTGTTC.....................................................2111.001.00--------------------------------------------1.00-------------------------------
.................................................................................................................................................CTGAATCAAAGTCTGTTGTTCCAG..................................................2411.001.00-----1.00----------------------------------------------------------------------
..............................................................................................................TTGGAAGGGCATACTGATTCGGGT.....................................................................................2411.0014.00------------------------------------------1.00---------------------------------
..................................................................................................................................................TGAATCAAAGTCTGTTGTTCCCGA.................................................2411.007.00--------------------------------------1.00-------------------------------------
...............................................................................................................TGGAAGGGCATACTGATTCGGG......................................................................................2211.001.00-------------------------------------------------------1.00--------------------
..........................................................................................................................................................................TGTGATGAAGCCCAGAAGC..............................191.000.00------------------------------------------------------------1.00---------------
..............................................................................................................TTGGAAGGGCATACTGATTC.........................................................................................2011.001.00-----------------------------------------------------------------------1.00----
............................................................................................................ACTTGGAAGGGCATACTGATTCGG.......................................................................................2411.001.00----------------------------------------------------1.00-----------------------
..............................................................................................................TTGGAAGGGCATACTGATTCGGGA.....................................................................................2411.001.00---1.00------------------------------------------------------------------------
..................................................................................................................................................TGAATCAAAGTCTGTTG........................................................1720.500.50--0.50-------------------------------------------------------------------------
............................................................................GGGTGAGTCTAAGTCT...............................................................................................................................1640.250.25---------------------------------------------------------------------------0.25

Antisense strand
TACCCTCAGCCCAGCGTGACATGGATGGAGTGCAGGGGCCACACCGATAGGTCAGTGGGCTTGGTTTTCCTCCTTAGGGTGAGTCTAAGTCTGGGTTGCGTACCCATGACTTGGAAGGGCATACTGATTCGGGAGACCCTAAAGCCTGAATCAAAGTCTGTTGTTCCAGGTGTGATGAAGCCCAGGCTTTGCAGGTTTGGAATGACACCCACCCTGAAG
...............................................................................................................(((((.((((.(((((((((((...........)))))))))..)).)))).)))))...................................................
.........................................................................................................106............................................................169................................................
SizePerfect hitTotal NormPerfect NormmjLiverWT2()
Liver Data. (liver)		mjLiverKO1()
Liver Data. (Zcchc11 liver)		SRR346414(SRX098255)
Global profiling of miRNA and the hairpin pre. (Spleen)		SRR042456(GSM539848)
mouse hematopoetic progenitor cells [09-002]. (bone marrow)		SRR206942(GSM723283)
other. (brain)		SRR038744(GSM527279)
small RNA-Seq. (brain)		SRR346418(SRX098259)
Global profiling of miRNA and the hairpin pre. (Liver)		SRR206941(GSM723282)
other. (brain)		GSM510444(GSM510444)
brain_rep5. (brain)		SRR206940(GSM723281)
other. (brain)		mjTestesWT1()
Testes Data. (testes)		SRR248523(GSM733811)
cell type: Thy1+ spermatogonial stem cellstra. (testes)		SRR553602(SRX182808)
source: Sertoli cells. (Sertoli cells)		SRR038743(GSM527278)
small RNA-Seq. (dicer brain)		SRR038742(GSM527277)
small RNA-Seq. (dgcr8 brain)		SRR042462(GSM539854)
mouse macrophages [09-002]. (bone marrow)		SRR346423(SRX098265)
Global profiling of miRNA and the hairpin pre. (Brain)		Ago2IP504(Rui)
Quantitative functions of Argonaute proteins . (ago2 skin)		SRR248524(GSM733812)
cell type: Thy1+ spermatogonial stem cellstra. (testes)		Ago1IP517(Rui)
Quantitative functions of Argonaute proteins . (ago1 skin)		SRR095855BC2(SRX039178)
sequencing of miRNA from wild type and diseas. (heart)		SRR346417(SRX098258)
Global profiling of miRNA and the hairpin pre. (Brain)		Ago3IP805(Rui)
Quantitative functions of Argonaute proteins . (ago3 skin)		SRR095855BC7(SRX039178)
sequencing of miRNA from wild type and diseas. (heart)		SRR042443(GSM539835)
mouse pro B cells [09-002]. (b cell)		SRR073954(GSM629280)
total RNA. (blood)		SRR073955(GSM629281)
total RNA. (blood)		SRR040489(GSM533912)
E18.5 Ago2 catalytically inactive LIVER small RNA. (ago2 liver)		SRR553582(SRX182788)
source: Brain. (Brain)		Ago3IP812(Rui)
Quantitative functions of Argonaute proteins . (ago3 skin)		Ago2IP517(Rui)
Quantitative functions of Argonaute proteins . (ago2 skin)		SRR346419(SRX098260)
Global profiling of miRNA and the hairpin pre. (Lung)		SRR039610(GSM527274)
small RNA-Seq. (brain)		SRR042461(GSM539853)
mouse dendritic cells [09-002]. (bone marrow)		SRR306539(GSM750582)
19-24nt. (ago2 brain)		SRR059770(GSM562832)
Treg_Dicer. (spleen)		SRR037905(GSM510441)
brain_rep2. (brain)		GSM509280(GSM509280)
small RNA cloning by length. (testes)		Ago1IP812(Rui)
Quantitative functions of Argonaute proteins . (ago1 skin)		SRR391845(GSM852140)
gender: femalegenotype/variation: wild typeti. (embryo)		mjTestesKO7()
Testes Data. (Zcchc11 testes)		SRR391846(GSM852141)
gender: femalegenotype/variation: ADAR2-/-tis. (embryo)		SRR014230(GSM319954)
10 dpp Dnmt3L-KO MILI. (mili testes)		SRR042478(GSM539870)
mouse lung tissue [09-002]. (lung)		SRR095853(SRX039174)
"sequencing of miRNA from wild type and disea. (heart)		SRR037929(GSM510467)
e7p5_rep3. (embryo)		SRR042471(GSM539863)
mouse TFHS cells [09-002]. (spleen)		GSM640579(GSM640579)
small RNA in the liver with paternal Low pro. (liver)		SRR023852(GSM307161)
ZHBT-c424hsmallrna_rep1. (cell line)		SRR065047(SRR065047)
Tissue-specific Regulation of Mouse MicroRNA . (liver)		SRR525243(SRA056111/SRX170319)
Mus musculus domesticus miRNA sequencing. (ago2 Blood)		SRR345207(SRX097268)
source: size fractionated RNA from mouse hipp. (brain)		SRR042459(GSM539851)
mouse neutrophil cells replicate 1 [09-002]. (blood)		SRR345200(SRX097261)
source: size fractionated RNA from mouse hipp. (brain)		SRR037921(GSM510459)
e12p5_rep3. (embryo)		SRR042447(GSM539839)
mouse mature B cells (spleen) replicate 2 [09-002]. (b cell)		SRR040488(GSM533911)
E18.5 wild type LIVER small RNA. (liver)		SRR065058(SRR065058)
Tissue-specific Regulation of Mouse MicroRNA . (pancreas)		SRR039154(GSM471931)
HL1_siSrf2_smallRNAseq. (muscle)		SRR553584(SRX182790)
source: Heart. (Heart)		SRR039152(GSM471929)
HL1_siNon_smallRNAseq. (muscle)		mjLiverWT3()
Liver Data. (liver)		SRR553585(SRX182791)
source: Kidney. (Kidney)		SRR032477(GSM485235)
sRNA_activation_deep_sequencing. (uterus)		SRR346415(SRX098256)
source: Testis. (Testes)		SRR038740(GSM527275)
small RNA-Seq. (dicer brain)		GSM519104(GSM519104)
mouse_granulocyte_nuclei_smallRNAs. (cell line)		GSM510456(GSM510456)
newborn_rep12. (total RNA)		SRR042479(GSM539871)
mouse liver tissue [09-002]. (liver)		SRR077864(GSM637801)
18-30 nt small RNAs. (liver)		SRR042484(GSM539876)
mouse salivary gland tissue [09-002]. (gland)		SRR042460(GSM539852)
mouse neutrophil cells replicate 2 [09-002]. (blood)		SRR306538(GSM750581)
19-24nt. (ago2 brain)		SRR042474(GSM539866)
mouse embryonic stem cells [09-002]. (ESC)		SRR077866(GSM637803)
18-30 nt small RNAs. (liver)		mjTestesKO6()
Testes Data. (Zcchc11 testes)
...................................................................................................................................GGAGACCCTAAAGCCACC...................................................................... 182.000.00--------------------------2.00-------------------------------------------------
...................................................................................................................................GGAGACCCTAAAGCCAAA...................................................................... 181.000.00-------------------------1.00--------------------------------------------------
.ACCCTCAGCCCAGCGTG......................................................................................................................................................................................................... 171.000.00-----------------------------------------------------1.00----------------------