ID: mmu-mir-6971
GENE: Skiv2l(19)
chr17:34978704-34978938-


(4)
AGO1.ip 		(16)
AGO2.ip 		(2)
AGO3.ip 		(7)
B-CELL 		(34)
BRAIN 		(8)
CELL-LINE 		(2)
DCR.mut 		(3)
DGCR8.mut 		(9)
EMBRYO 		(7)
ESC 		(2)
FIBROBLAST 		(3)
HEART 		(2)
KIDNEY 		(9)
LIVER 		(4)
LYMPH 		(16)
OTHER 		(10)
OTHER.mut 		(1)
OVARY 		(1)
PANCREAS 		(3)
PIWI.ip 		(8)
SKIN 		(5)
SPLEEN 		(18)
TESTES 		(6)
TOTAL-RNA 		(2)
UTERUS

Sense strand
ACATGATGAAGAGGAGCTTCTCAGAGTTCCCATCCCGCAAGGACAGCAAGGTGAGGTTAGGGTGAGCAACGTAGCTGTTGAGACAGGCAGTCTGGGCTGGCCAGGTGGGCATGCGGAGGCAGTGGGGTGGGGGAGGGTGTAGAGGCTGGGCTGGCAGACTCATCACAGCCTCTGCTTCTTCTCAGGCCCATGAGCAGGCTCTGGCTGACCTCACCAAGAGGCTGGGGGCTTTGGA
..................................................................................................................................(((((((.((((((((((((.(((.....))))).)))))))))).)))))))....................................................
..........................................................................................................................123...........................................................185................................................
SizePerfect hitTotal NormPerfect NormSRR546155(SRX180174)
Global profiling of miRNA and the hairpin pre. (ago2 Neuroblastoma)		SRR346417(SRX098258)
Global profiling of miRNA and the hairpin pre. (Brain)		SRR685339(GSM1079783)
"Small RNAs (15-50 nts in length) from immort. (cell line)		SRR279907(GSM689057)
cell type: mouse embryonic stem cellcell line. (ESC)		mjLiverKO2()
Liver Data. (Zcchc11 liver)		SRR038742(GSM527277)
small RNA-Seq. (dgcr8 brain)		SRR038741(GSM527276)
small RNA-Seq. (brain)		SRR038744(GSM527279)
small RNA-Seq. (brain)		SRR345200(SRX097261)
source: size fractionated RNA from mouse hipp. (brain)		SRR039610(GSM527274)
small RNA-Seq. (brain)		SRR206940(GSM723281)
other. (brain)		SRR346423(SRX098265)
Global profiling of miRNA and the hairpin pre. (Brain)		SRR391851(GSM852146)
gender: femalegenotype/variation: wild typeti. (embryo)		SRR346416(SRX098257)
Global profiling of miRNA and the hairpin pre. (Kidney)		SRR553583(SRX182789)
source: Cerebellum. (Cerebellum)		GSM510456(GSM510456)
newborn_rep12. (total RNA)		SRR042470(GSM539862)
mouse Th17 cells [09-002]. (lymph)		Ago3IP805(Rui)
Quantitative functions of Argonaute proteins . (ago3 skin)		SRR038745(GSM527280)
small RNA-Seq. (dgcr8 brain)		SRR073954(GSM629280)
total RNA. (blood)		SRR391853(GSM852148)
gender: femalegenotype/variation: ADAR2-/-/AD. (embryo)		SRR346424(SRX098266)
Global profiling of miRNA and the hairpin pre. (Neuroblastoma)		SRR390300(GSM849858)
cell line: NIH-3T3cell type: fibroblastinfect. (ago2 fibroblast)		SRR394083(GSM855969)
"background strain: C57BL6/SV129cell type: KR. (cell line)		SRR248526(GSM733814)
cell type: Thy1- spermatogonial stem cellstra. (testes)		SRR279904(GSM689054)
cell type: mouse embryonic stem cellcell line. (ESC)		SRR346422(SRX098264)
Global profiling of miRNA and the hairpin pre. (Muscle)		SRR391846(GSM852141)
gender: femalegenotype/variation: ADAR2-/-tis. (embryo)		SRR391848(GSM852143)
gender: femalegenotype/variation: wild typeti. (embryo)		SRR042449(GSM539841)
mouse B cells activated in vitro with LPS/IL4 replicate 2 [09-002]. (b cell)		mjLiverKO1()
Liver Data. (Zcchc11 liver)		SRR346415(SRX098256)
source: Testis. (Testes)		SRR345202(SRX097263)
source: size fractionated RNA from mouse hipp. (brain)		SRR346425(SRX098267)
Global profiling of miRNA and the hairpin pre. (Neuroblastoma)		SRR042447(GSM539839)
mouse mature B cells (spleen) replicate 2 [09-002]. (b cell)		SRR077865(GSM637802)
18-30 nt small RNAs. (liver)		GSM519104(GSM519104)
mouse_granulocyte_nuclei_smallRNAs. (cell line)		Ago1IP812(Rui)
Quantitative functions of Argonaute proteins . (ago1 skin)		RuiDcrWT(Rui)
DGCR8-dependent microRNA biogenesis is essent. (skin)		SRR042468(GSM539860)
mouse Th1 cells [09-002]. (lymph)		GSM475281(GSM475281)
total RNA. (testes)		SRR038740(GSM527275)
small RNA-Seq. (dicer brain)		SRR345198(SRX097259)
source: size fractionated RNA from mouse hipp. (brain)		GSM314557(GSM314557)
ESC dgcr8 (Illumina). (ESC)		GSM314552(GSM314552)
ESC wild type (Illumina). (ESC)		SRR042469(GSM539861)
mouse Th2 cells [09-002]. (lymph)		RuiDGCR8KO(Rui)
DGCR8-dependent microRNA biogenesis is essent. (dgcr8 skin)		SRR029037(GSM433289)
18dpp_homo_tdrd6-KO. (tdrd6 testes)		SRR306541(GSM750584)
19-24nt. (ago2 brain)		GSM510450(GSM510450)
newborn_rep6. (total RNA)		Ago1IP517(Rui)
Quantitative functions of Argonaute proteins . (ago1 skin)		SRR042465(GSM539857)
mouse CD4+ T cells (spleen) [09-002]. (spleen)		SRR038743(GSM527278)
small RNA-Seq. (dicer brain)		SRR391849(GSM852144)
gender: femalegenotype/variation: ADAR2-/-tis. (embryo)		SRR402762(SRX117945)
source: ES E14 male cells. (ESC)		GSM475280(GSM475280)
Mili-IP. (mili testes)		SRR023850(GSM307159)
ZHBT-c40hsmallrna_rep1. (cell line)		SRR116846(GSM678422)
Small RNA deep sequencing from mouse epididym. (epididymis)		SRR042456(GSM539848)
mouse hematopoetic progenitor cells [09-002]. (bone marrow)		SRR391852(GSM852147)
gender: femalegenotype/variation: ADAR2-/-tis. (embryo)		SRR065058(SRR065058)
Tissue-specific Regulation of Mouse MicroRNA . (pancreas)		SRR306542(GSM750585)
19-24nt. (ago2 brain)		SRR390299(GSM849857)
cell line: NIH-3T3cell type: fibroblastip ant. (ago2 fibroblast)		Ago3IP812(Rui)
Quantitative functions of Argonaute proteins . (ago3 skin)		SRR059769(GSM562831)
Treg_Drosha. (spleen)		SRR059771(GSM562833)
CD4_control. (spleen)		SRR525244(SRA056111/SRX170320)
Mus musculus domesticus miRNA sequencing. (ago2 Blood)		SRR345197(SRX097258)
source: size fractionated RNA from mouse hipp. (brain)		GSM510444(GSM510444)
brain_rep5. (brain)		SRR306530(GSM750573)
19-24nt. (ago2 brain)		SRR042471(GSM539863)
mouse TFHS cells [09-002]. (spleen)		SRR037912(GSM510449)
newborn_rep5. (total RNA)		SRR042483(GSM539875)
mouse muscle tissue [09-002]. (muscle)		SRR346420(SRX098261)
Global profiling of miRNA and the hairpin pre. (Uterus)		SRR306536(GSM750579)
19-24nt. (ago2 brain)		SRR346418(SRX098259)
Global profiling of miRNA and the hairpin pre. (Liver)		SRR042446(GSM539838)
mouse mature B cells (spleen) replicate 1 [09-002]. (b cell)		GSM640581(GSM640581)
small RNA in the liver with paternal control. (liver)		SRR553582(SRX182788)
source: Brain. (Brain)		mjLiverKO3()
Liver Data. (Zcchc11 liver)		SRR077864(GSM637801)
18-30 nt small RNAs. (liver)		SRR391845(GSM852140)
gender: femalegenotype/variation: wild typeti. (embryo)		SRR345199(SRX097260)
source: size fractionated RNA from mouse hipp. (brain)		SRR060845(GSM561991)
total RNA. (brain)		SRR042459(GSM539851)
mouse neutrophil cells replicate 1 [09-002]. (blood)		SRR037905(GSM510441)
brain_rep2. (brain)		SRR042455(GSM539847)
mouse plasma cells [09-002]. (blood)		SRR345196(SRX097257)
source: size fractionated RNA from mouse hipp. (brain)		mjTestesKO7()
Testes Data. (Zcchc11 testes)		SRR042467(GSM539859)
mouse T cells activated in vitro with Concanavalin A [09-002]. (spleen)		SRR042444(GSM539836)
mouse pre B cells [09-002]. (b cell)		SRR042453(GSM539845)
mouse marginal zone B cells (spleen) [09-002]. (b cell)		SRR037934(GSM510472)
293cand4_rep3. (cell line)		mjTestesWT3()
Testes Data. (testes)		SRR248527(GSM733815)
cell type: spermatogonial stem cell enriched . (testes)		SRR345207(SRX097268)
source: size fractionated RNA from mouse hipp. (brain)		SRR306537(GSM750580)
19-24nt. (ago2 brain)		SRR525243(SRA056111/SRX170319)
Mus musculus domesticus miRNA sequencing. (ago2 Blood)		SRR029123(GSM416611)
NIH3T3. (cell line)		SRR029043(GSM433295)
18.5dpc_homo_tdrd1-KO. (tdrd1 testes)		SRR346413(SRX098254)
Global profiling of miRNA and the hairpin pre. (Heart)		SRR553604(SRX182810)
source: Spermatocytes. (Spermatocytes)		SRR037914(GSM510451)
newborn_rep7. (total RNA)		SRR306534(GSM750577)
19-24nt. (ago2 brain)		Ago2IP504(Rui)
Quantitative functions of Argonaute proteins . (ago2 skin)		SRR029036(GSM433288)
18dpp_hetero_tdrd6-KO. (tdrd6 testes)		SRR248525(GSM733813)
cell type: Thy1- spermatogonial stem cellstra. (testes)		SRR032476(GSM485234)
sRNA_delayed_deep_sequencing. (uterus)		SRR306529(GSM750572)
19-24nt. (ago2 brain)		GSM475279(GSM475279)
Miwi-IP. (miwi testes)		mjTestesKO5()
Testes Data. (Zcchc11 testes)		GSM416732(GSM416732)
MEF. (cell line)		SRR095855BC8(SRX039178)
sequencing of miRNA from wild type and diseas. (heart)		GSM317183(GSM317183)
Ago-1 IP small RNAs from mouse brain. (ago1 brain)		SRR042454(GSM539846)
mouse germinal center B cells (lymph node) [09-002]. (b cell)		SRR248524(GSM733812)
cell type: Thy1+ spermatogonial stem cellstra. (testes)		SRR095853(SRX039174)
"sequencing of miRNA from wild type and disea. (heart)		GSM510455(GSM510455)
newborn_rep11. (total RNA)		SRR037944(GSM510482)
293DcrTN_cand5. (cell line)		SRR279903(GSM689053)
cell type: mouse embryonic stem cellcell line. (ESC)		SRR042473(GSM539865)
mouse nTreg cells [09-002]. (lymph)		SRR029038(GSM433290)
25dpp_hetero_tdrd6-KO. (tdrd6 testes)		SRR034120(GSM466730)
Mili IP_Tdrd9-/- replicate1. (mili testes)		SRR069809(GSM610965)
small RNA sequencing; sample 1. (testes)		SRR037920(GSM510458)
e12p5_rep2. (embryo)		mjTestesKO8()
Testes Data. (Zcchc11 testes)		GSM640578(GSM640578)
small RNA in the liver with paternal control. (liver)		SRR402761(SRX117944)
source: ES E14 male cells. (ESC)		SRR525240(SRA056111/SRX170316)
Mus musculus domesticus miRNA sequencing. (ago1 Blood)		GSM510453(GSM510453)
newborn_rep9. (total RNA)		SRR037897(GSM510433)
ovary_rep2. (ovary)		SRR206942(GSM723283)
other. (brain)		SRR306532(GSM750575)
19-24nt. (ago2 brain)		SRR391850(GSM852145)
gender: femalegenotype/variation: ADAR2-/-/AD. (embryo)		SRR073955(GSM629281)
total RNA. (blood)		SRR553585(SRX182791)
source: Kidney. (Kidney)		SRR345201(SRX097262)
source: size fractionated RNA from mouse hipp. (brain)		Ago2IP517(Rui)
Quantitative functions of Argonaute proteins . (ago2 skin)		SRR077866(GSM637803)
18-30 nt small RNAs. (liver)		SRR306538(GSM750581)
19-24nt. (ago2 brain)		SRR042450(GSM539842)
mouse B cells activated in vitro with LPS/IL4 replicate 3 [09-002]. (b cell)		SRR345205(SRX097266)
source: size fractionated RNA from mouse hipp. (brain)
....................................................................................................................................................................ACAGCCTCTGCTTCTTCTCAGT.................................................221172.0012.006.0013.009.00--9.007.007.00-7.003.006.003.005.003.003.001.003.004.002.001.00----4.002.00-2.00-4.001.00-2.002.003.001.003.002.00-2.001.00--2.00--1.001.00--1.002.001.001.00-1.002.001.00-2.001.002.00---1.00-1.001.00-1.001.001.002.00-1.001.001.00-2.001.00--1.00-------------1.001.001.001.00-1.00-1.00-1.001.00-1.001.00--------1.00----1.00-1.00-1.00-1.00-1.00-1.00-1.00----
...............................................................................................................................TGGGGGAGGGTGTAGAGGCT........................................................................................20120.0020.00-1.00-5.00----------1.00-1.00-------1.00----1.00--3.00------2.00------------------------------2.00-1.00------------------------1.00------1.00-------------------------------------
...................................................................................................................................................................CACAGCCTCTGCTTCTTCTCAGT.................................................23114.003.00---------2.00-1.00-1.00----1.00-------1.00-1.00-------1.00----2.00--------1.00---------------------------------------------1.00-------------------1.00-------------1.00-----------
................................................................................................................................GGGGGAGGGTGTAGAGGCTGGGCT...................................................................................24112.0012.00----12.00-----------------------------------------------------------------------------------------------------------------------------------------
....................................................................................................................................................................ACAGCCTCTGCTTCTTCTCAG..................................................21112.0012.001.00----1.001.00-----1.00-1.00----1.00----1.00-1.00----------------1.00-------------------------------1.001.00--------------1.00--------------------------------------------------
....................................................................................................................................................................ACAGCCTCTGCTTCTTCTCAGA.................................................22112.0012.001.00-------------------1.00-5.00--------1.00-------------------------------1.00-------1.00-----1.00--------------------------------------------------1.00-------------
.....................................................................................................................................................................CAGCCTCTGCTTCTTCTCAGT.................................................2110.000.002.00-2.00--------1.00------------------------1.00---------1.00------------------2.00----------------------------------------1.00-----------------------------------
....................................................................................................................................................................ACAGCCTCTGCTTCTTCTCA...................................................2018.008.00-1.00---1.00------------------1.00----1.00----------------------------------1.00-1.00--------------------------------------------------1.00--------------------1.00---
...............................................................................................................................TGGGGGAGGGTGTAGAGGCTGGG.....................................................................................2315.005.00-1.00-2.00----------------1.00----------------------------------------1.00--------------------------------------------------------------------------------
...............................................................................................................................TGGGGGAGGGTGTAGAGGC.........................................................................................1914.004.00----------------1.00---1.00----------------------------------------------2.00--------------------------------------------------------------------------
....................................................................................................................................................................ACAGCCTCTGCTTCTTCT.....................................................1814.004.00-----------------------4.00----------------------------------------------------------------------------------------------------------------------
...............................................................................................................................TGGGGGAGGGTGTAGAGGCTG.......................................................................................2114.004.001.00-------------1.00---------------------------------1.00-----------------------------------------------------------------------------------1.00---------
...............................................................................................................................TGGGGGAGGGTGTAGAGGCTGG......................................................................................2214.004.001.00-----------1.00----1.00---1.00------------------------------------------------------------------------------------------------------------------------
...............................................................................................................................TGGGGGAGGGTGTAGAGGCTGA......................................................................................2214.004.001.00------1.00--2.00-----------------------------------------------------------------------------------------------------------------------------------
....................................................................................................................................................................................................GGCTCTGGCTGACCTCAC.....................1814.004.00---------------3.00---------------------------------1.00--------------------------------------------------------------------------------------------
....................................................................................................................................................................ACAGCCTCTGCTTCTTCTCAGC.................................................2213.0012.00------2.00-----------------------------------------------------------------------------------------------1.00---------------------------------------
...............................................................................................................................TGGGGGAGGGTGTAGAGGCTGGGC....................................................................................2413.003.00-------------------------------------------------------------------------1.00-----1.00---------------------------------------1.00----------------------
...................................................................................................................................................................CACAGCCTCTGCTTCTTCTCAG..................................................2213.003.00------1.00---1.00---------------------------------------1.00-------------------------------------------------------------------------------------------
....................................................................................................................................................................ACAGCCTCTGCTTCTTCTCAGTT................................................2313.0012.00-----------------1.00-----------------------------------------------------------------1.00----------------------------1.00-----------------------------
...............................................................................................................................TGGGGGAGGGTGTAGAGGCTGT......................................................................................2213.004.001.00------------------1.00----------------------------------1.00---------------------------------------------------------------------------------------
...............................................................................................................................TGGGGGAGGGTGTAGAGGCTGGGA....................................................................................2413.005.00---3.00------------------------------------------------------------------------------------------------------------------------------------------
...............................................................................................................................TGGGGGAGGGTGTAGAGGCTGGAAA...................................................................................2513.004.00---3.00------------------------------------------------------------------------------------------------------------------------------------------
..................................................................................................................................................................TCACAGCCTCTGCTTCTTCTCAGT.................................................242.000.00-----1.00--------------------------------1.00-------------------------------------------------------------------------------------------------------
....................................................................................................................................................................ACAGCCTCTGCTTCTTCTCAGTAT...............................................2412.0012.00------------1.00---------------------------------------------1.00-----------------------------------------------------------------------------------
.....................................................................................................................................................................CAGCCTCTGCTTCTTCTCAGTAA...............................................232.000.00---------------------------2.00------------------------------------------------------------------------------------------------------------------
................................................................................................................................GGGGGAGGGTGTAGAGGCT........................................................................................1912.002.00----------------1.00----------------------------1.00------------------------------------------------------------------------------------------------
.................................................................................................................................GGGGAGGGTGTAGAGGCTGA......................................................................................202.000.001.00-----------------------------------------------------------------------------------------------------------------------------1.00---------------
....................................................................................................................................................................ACAGCCTCTGCTTCTTCTCAGTA................................................2312.0012.00------------1.00-------------------------------------------1.00-------------------------------------------------------------------------------------
...............................................................................................................................TGGGGGAGGGTGTAGAGGCTGGGG....................................................................................2412.005.00-------------------------------1.00----------------------------------------------1.00---------------------------------------------------------------
...............................................................................................................................TGGGGGAGGGTGTAGAGGCTAT......................................................................................2212.0020.00-------1.00--------------------------1.00-----------------------------------------------------------------------------------------------------------
...............................................................................................................................TGGGGGAGGGTGTAGAGGCTGAAT....................................................................................2412.004.002.00---------------------------------------------------------------------------------------------------------------------------------------------
...............................................................................................................................TGGGGGAGGGTGTAGAGGCTGTAA....................................................................................2412.004.00----------2.00-----------------------------------------------------------------------------------------------------------------------------------
...............................................................................................................................TGGGGGAGGGTGTAGAGGCTGGT.....................................................................................2312.004.001.00---------------------------------------------------------------1.00-----------------------------------------------------------------------------
....................................................................................................................................................................ACAGCCTCTGCTTCTTCTC....................................................1912.002.00-1.00-----------------------------------------------------------------------------------------------------------------------------------------1.00--
...............................................................................................................................TGGGGGAGGGTGTAGAGGTTAA......................................................................................221.000.001.00---------------------------------------------------------------------------------------------------------------------------------------------
...............................................................................................................................TGGGGGAGGGTGTAGAGGCTGGAAT...................................................................................2511.004.00---------------------1.00------------------------------------------------------------------------------------------------------------------------
...............................................................................................................................TGGGGGAGGGTGTAGAGGCTT.......................................................................................2111.0020.00---------------------------------------------------1.00------------------------------------------------------------------------------------------
...............................................................................................................................TGGGGGAGGGTGTAGAGGCTAAG.....................................................................................2311.0020.00-----------------------------1.00----------------------------------------------------------------------------------------------------------------
.....................................CAAGGACAGCAAGGTGGT....................................................................................................................................................................................181.000.00---------------------------1.00------------------------------------------------------------------------------------------------------------------
...............................................................................................................................TGGGGGAGGGTGTAGAGGCTGGAC....................................................................................2411.004.00-------1.00--------------------------------------------------------------------------------------------------------------------------------------
..................................................................................................................................................................................................CAGGCTCTGGCTGACCTCACC....................2111.001.00---------------------------------------------------------------------------1.00------------------------------------------------------------------
..............................................................................TGAGACAGGCAGTCTGTC...........................................................................................................................................181.000.00--------1.00-------------------------------------------------------------------------------------------------------------------------------------
...............................................................................................................................TGGGGGAGGGTGTAGAGGCTGGGAAT..................................................................................2611.005.00-------------------------------------------1.00--------------------------------------------------------------------------------------------------
....................................................................................................................................................................ACAGCCTCTGCTTCTTCTCAAGT................................................2311.008.00-----------------------------------------------------------------------------------------------------------------1.00----------------------------
.............................................................................................................................................................................................ATGAGCAGGCTCTGGAAC............................181.000.00---------------------------1.00------------------------------------------------------------------------------------------------------------------
...................................................................................................................................................................CACAGCCTCTGCTTCTTCTCAT..................................................221.000.00----------------------------------------------1.00-----------------------------------------------------------------------------------------------
...................................................................................................................................................................CACAGCCTCTGCTTCTTCTCAGA.................................................2311.003.00----------------------------------------------------------------------------------------------1.00-----------------------------------------------
..........................................................................................................................................................................................................................AGGCTGGGGGCTTTGGA1711.001.00---------------------------------------------------------------------------------------------1.00------------------------------------------------
...............................................................................................................................TGGGGGAGGGTGTAGAGGCTGTAG....................................................................................2411.004.00----------------------------------------------------------------------------------------1.00-----------------------------------------------------
...TGATGAAGAGGAGCTTCTCAGAGTTCT.............................................................................................................................................................................................................271.000.00-----------------------------------------------1.00----------------------------------------------------------------------------------------------
.........................................................................................................................................................................................................TGGCTGACCTCACCAAGAGGCTGGGGGCT.....2911.001.00--------------------------------------------------------------------------------------------------------------------------1.00-------------------
................................................................................................................................GGGGGAGGGTGTAGAGGCTGGCCAT..................................................................................251.000.001.00---------------------------------------------------------------------------------------------------------------------------------------------
...............................................................................................................................TGGGGGAGGGTGTAGAGGCTGGGCTAT.................................................................................271.000.001.00---------------------------------------------------------------------------------------------------------------------------------------------
...TGATGAAGAGGAGCTTCTCAGAGTTCCCAT..........................................................................................................................................................................................................3011.001.00-------------------------------------------------------------------------------------------------------------------------1.00--------------------
....................................GCAAGGACAGCAAGGGGG.....................................................................................................................................................................................181.000.00---------------------------------------------------------------1.00------------------------------------------------------------------------------
................................................................................................................................GGGGGAGGGTGTAGAGGCTTT......................................................................................2111.002.00---------------------------------------1.00------------------------------------------------------------------------------------------------------
...............................................................................................................................TGGGGGAGGGTGTAGAGGCTGGA.....................................................................................2311.004.00------------1.00---------------------------------------------------------------------------------------------------------------------------------
.........................................................................................................................GTGGGGTGGGGGAGGGTAAT..............................................................................................201.000.00--------------------------------------------------------------------------------------1.00-------------------------------------------------------
...............................................................................................................................................................................................GAGCAGGCTCTGGCTGACC.........................1911.001.00-------------------------------------------------------------------------------------------------------------1.00--------------------------------
.............................................................................................GGGCTGGCCAGGTGGAGCA...........................................................................................................................191.000.00----------------------------------------------------------------------------------1.00-----------------------------------------------------------
........................................................................................................................................................................CCTCTGCTTCTTCTCAGT.................................................181.000.00----------------------------------------------------------------------------------------------------------------------------1.00-----------------
...............................................................................................................................TGGGGGAGGGTGTAGAGGCTGGGGTT..................................................................................2611.005.00-------------------------------------------------------------------------------1.00--------------------------------------------------------------
....................................................................................................................................................................ACAGCCTCTGCTTCTTCTCAT..................................................2111.008.00-------------------------------------------------1.00--------------------------------------------------------------------------------------------
....................................................................................................................................................................ACAGCCTCTGCTTCTAGC.....................................................181.000.00----------------------------------------------------------------------------------------------------------------------1.00-----------------------
..............................................................................................................................................................................................TGAGCAGGCTCTGGCATAG..........................191.000.00------------------------------------------1.00---------------------------------------------------------------------------------------------------
...........................TCCCATCCCGCAAGGACAGCAAGGC.......................................................................................................................................................................................251.000.00-------------------------------------------------------1.00--------------------------------------------------------------------------------------
.................................................................................................................................................................................................GCAGGCTCTGGCTGACCTCAA.....................211.000.00------------------------------------------------------------------------------------------------------------------1.00---------------------------
.....................................................................................................................................................................CAGCCTCTGCTTCTTCTAAGT.................................................211.000.00--1.00-------------------------------------------------------------------------------------------------------------------------------------------
....................................................................................................................AGGCAGTGGGGTGGGGCTT....................................................................................................191.000.00---------------------------------------------------------------------------------------1.00------------------------------------------------------
...............................................................................................................................TGGGGGAGGGTGTAGAGGCTGGGT....................................................................................2411.005.001.00---------------------------------------------------------------------------------------------------------------------------------------------
........................................GGACAGCAAGGTGAGGAACT...............................................................................................................................................................................201.000.00----------------------------------------------------------------------------------------------------------------------------------------1.00-----
................................................................................................................................GGGGGAGGGTGTAGAGGCTGGGCATT.................................................................................2611.001.00-------------------1.00--------------------------------------------------------------------------------------------------------------------------
.....................................................................................................................................................................CAGCCTCTGCTTCTTCTCAAT.................................................211.000.001.00---------------------------------------------------------------------------------------------------------------------------------------------
...............................................................................................................................TGGGGGAGGGTGTAGAGGCTAA......................................................................................2211.0020.00--------------------------------------------------------------------1.00-------------------------------------------------------------------------
...............................................................................................................................TGGGGGAGGGTGTAGAGGCTAGT.....................................................................................2311.0020.00---------------------1.00------------------------------------------------------------------------------------------------------------------------
....................................................................................................................................................................ACAGCCTCTGCTTCTTCTCACT.................................................2211.008.00--1.00-------------------------------------------------------------------------------------------------------------------------------------------
...................................................................................................................................................................CACAGCCTCTGCTTCTTCTCAGTA................................................2411.003.001.00---------------------------------------------------------------------------------------------------------------------------------------------
...............................................................................................................................TGGGGGAGGGTGTAGAGGCTATA.....................................................................................2311.0020.00------------------------------------------------------------------------------------------1.00---------------------------------------------------
....................................................................................................................................................................ACAGCCTCTGCTTCTTCTCAGAT................................................2311.0012.00------------------------1.00---------------------------------------------------------------------------------------------------------------------
..............................................................................................................ATGCGGAGGCAGTGGCACG..........................................................................................................191.000.00--------1.00-------------------------------------------------------------------------------------------------------------------------------------
.........................................................................................................................GTGGGGTGGGGGAGGGTATTT.............................................................................................211.000.00-----------------------------1.00----------------------------------------------------------------------------------------------------------------
.................................................................................................................................GGGGAGGGTGTAGAGGCTGAAT....................................................................................221.000.001.00---------------------------------------------------------------------------------------------------------------------------------------------
...............................................................................................................................TGGGGGAGGGTGTAGAGGCTGGGTT...................................................................................2511.005.00---------------------1.00------------------------------------------------------------------------------------------------------------------------
................................................................................................................................GGGGGAGGGTGTAGAGGCTAAAT....................................................................................2311.002.00-----------------------------------------------------------------------------------------1.00----------------------------------------------------
.................................................................................................................................GGGGAGGGTGTAGAGGCTGG......................................................................................2011.001.001.00---------------------------------------------------------------------------------------------------------------------------------------------
....................................................................................................................................................................ACAGCCTCTGCTTCTAGCT....................................................191.000.00--------------------------------------------------------------------------------------------1.00-------------------------------------------------
...............................................................................................................................TGGGGGAGGGTGTAGAGGCTTAT.....................................................................................2311.0020.00---------------------------------------------1.00------------------------------------------------------------------------------------------------
.......GAAGAGGAGCTTCTCAGAGTTCC.............................................................................................................................................................................................................2311.001.00-----------------------------------------------------------1.00----------------------------------------------------------------------------------
................................................................................................................................GGGGGAGGGTGTAGAGGCTGGGGAAT.................................................................................261.000.00-------------------------------------------------------------------------------------------------------------------1.00--------------------------
...............................................................................................................................TGGGGGAGGGTGTAGAGGCTGAAAT...................................................................................2511.004.00--------------------------------------------------------------------------------------------------------------------------------------1.00-------
...................................................................................................................................................................................................AGGCTCTGGCTGACCTCAC.....................1911.001.00--------------------1.00-------------------------------------------------------------------------------------------------------------------------
....................................................................................................................................................................ACAGCCTCTGCTTCTTCTCAAT.................................................2211.008.00-------------------------------------------------------------------------------------1.00--------------------------------------------------------
...........................TCCCATCCCGCAAGGACAGCAAGGCCC.....................................................................................................................................................................................271.000.00---------------------------------------------------------------------------------------------------------------------------1.00------------------
...............................ATCCCGCAAGGACAGCAAGGCCC.....................................................................................................................................................................................231.000.00-------------------------------------------------------1.00--------------------------------------------------------------------------------------
.....................................................................................................................................................................CAGCCTCTGCTTCTTCTCAGA.................................................211.000.00-----------------------------------------------------------1.00----------------------------------------------------------------------------------
...............................................................................................................................TGGGGGAGGGTGTAGAGGCTGGGCA...................................................................................2511.003.00-1.00--------------------------------------------------------------------------------------------------------------------------------------------
...............................................................................................................................TGGGGGAGGGTGTAGAGGCTGGATT...................................................................................2511.004.001.00---------------------------------------------------------------------------------------------------------------------------------------------
................................................................................................................................GGGGGAGGGTGTAGAGGCTGGGC....................................................................................2311.001.00---------------------------------1.00------------------------------------------------------------------------------------------------------------
....................................................................................................................................................................ACAGCCTCTGCTTCTTCTTATT.................................................2211.004.00---------------------------------------------------------------------1.00------------------------------------------------------------------------
.................................................................................................................................GGGGAGGGTGTAGAGGCTGGGT....................................................................................221.000.00----------------------------1.00-----------------------------------------------------------------------------------------------------------------
...............................................................................................................................TGGGGGAGGGTGTAGAGGCTGGTTTA..................................................................................2611.004.00---------------------1.00------------------------------------------------------------------------------------------------------------------------
.................................................................................................................................GGGGAGGGTGTAGAGGCT........................................................................................1811.001.00----------------1.00-----------------------------------------------------------------------------------------------------------------------------
..................................................................................................................................................................TCACAGCCTCTGCTTCTTCTCAGA.................................................241.000.00-------------------------------1.00--------------------------------------------------------------------------------------------------------------
...............................................................................................................................TGGGGGAGGGTGTAGAGGCTGTAT....................................................................................2411.004.001.00---------------------------------------------------------------------------------------------------------------------------------------------
.................................................................................................................................GGGGAGGGTGTAGAGGCTAT......................................................................................2011.001.00-----------------------------------------------------1.00----------------------------------------------------------------------------------------
....................................................................................................................................................................ACAGCCTCTGCTTCTTC......................................................1730.670.67--------------------------------------------0.33------------------------------------0.33------------------------------------------------------------
........................................................................................................................................................................................................................AGAGGCTGGGGGCTTT...1620.500.50-------------------------------------------0.50--------------------------------------------------------------------------------------------------
.......................................................................................................................CAGTGGGGTGGGGGAGGGT.................................................................................................1950.400.40------------------------------------------------------------------------------------0.20-------------------------------------------------------0.20-
........................................................................................AGTCTGGGCTGGCCAGG..................................................................................................................................1740.250.25-----------------------------------------------------------------------------------0.25----------------------------------------------------------
...............................................................................................................................TGGGGGAGGGTGTAGA............................................................................................1690.220.220.22---------------------------------------------------------------------------------------------------------------------------------------------
..................................................................................................................GGAGGCAGTGGGGTGGGACA.....................................................................................................2090.110.11--------------------------------0.11-------------------------------------------------------------------------------------------------------------
...............................................................................................................................TGGGGGAGGGTGTAGAAGT.........................................................................................1990.110.22---------------------------------------------0.11------------------------------------------------------------------------------------------------
..................................................................................................................GGAGGCAGTGGGGTGGG........................................................................................................1790.110.11---------------------------------------------------------------------------------------------------------------------------------------------0.11

Antisense strand
ACATGATGAAGAGGAGCTTCTCAGAGTTCCCATCCCGCAAGGACAGCAAGGTGAGGTTAGGGTGAGCAACGTAGCTGTTGAGACAGGCAGTCTGGGCTGGCCAGGTGGGCATGCGGAGGCAGTGGGGTGGGGGAGGGTGTAGAGGCTGGGCTGGCAGACTCATCACAGCCTCTGCTTCTTCTCAGGCCCATGAGCAGGCTCTGGCTGACCTCACCAAGAGGCTGGGGGCTTTGGA
..................................................................................................................................(((((((.((((((((((((.(((.....))))).)))))))))).)))))))....................................................
..........................................................................................................................123...........................................................185................................................
SizePerfect hitTotal NormPerfect NormSRR546155(SRX180174)
Global profiling of miRNA and the hairpin pre. (ago2 Neuroblastoma)		SRR346417(SRX098258)
Global profiling of miRNA and the hairpin pre. (Brain)		SRR685339(GSM1079783)
"Small RNAs (15-50 nts in length) from immort. (cell line)		SRR279907(GSM689057)
cell type: mouse embryonic stem cellcell line. (ESC)		mjLiverKO2()
Liver Data. (Zcchc11 liver)		SRR038742(GSM527277)
small RNA-Seq. (dgcr8 brain)		SRR038741(GSM527276)
small RNA-Seq. (brain)		SRR038744(GSM527279)
small RNA-Seq. (brain)		SRR345200(SRX097261)
source: size fractionated RNA from mouse hipp. (brain)		SRR039610(GSM527274)
small RNA-Seq. (brain)		SRR206940(GSM723281)
other. (brain)		SRR346423(SRX098265)
Global profiling of miRNA and the hairpin pre. (Brain)		SRR391851(GSM852146)
gender: femalegenotype/variation: wild typeti. (embryo)		SRR346416(SRX098257)
Global profiling of miRNA and the hairpin pre. (Kidney)		SRR553583(SRX182789)
source: Cerebellum. (Cerebellum)		GSM510456(GSM510456)
newborn_rep12. (total RNA)		SRR042470(GSM539862)
mouse Th17 cells [09-002]. (lymph)		Ago3IP805(Rui)
Quantitative functions of Argonaute proteins . (ago3 skin)		SRR038745(GSM527280)
small RNA-Seq. (dgcr8 brain)		SRR073954(GSM629280)
total RNA. (blood)		SRR391853(GSM852148)
gender: femalegenotype/variation: ADAR2-/-/AD. (embryo)		SRR346424(SRX098266)
Global profiling of miRNA and the hairpin pre. (Neuroblastoma)		SRR390300(GSM849858)
cell line: NIH-3T3cell type: fibroblastinfect. (ago2 fibroblast)		SRR394083(GSM855969)
"background strain: C57BL6/SV129cell type: KR. (cell line)		SRR248526(GSM733814)
cell type: Thy1- spermatogonial stem cellstra. (testes)		SRR279904(GSM689054)
cell type: mouse embryonic stem cellcell line. (ESC)		SRR346422(SRX098264)
Global profiling of miRNA and the hairpin pre. (Muscle)		SRR391846(GSM852141)
gender: femalegenotype/variation: ADAR2-/-tis. (embryo)		SRR391848(GSM852143)
gender: femalegenotype/variation: wild typeti. (embryo)		SRR042449(GSM539841)
mouse B cells activated in vitro with LPS/IL4 replicate 2 [09-002]. (b cell)		mjLiverKO1()
Liver Data. (Zcchc11 liver)		SRR346415(SRX098256)
source: Testis. (Testes)		SRR345202(SRX097263)
source: size fractionated RNA from mouse hipp. (brain)		SRR346425(SRX098267)
Global profiling of miRNA and the hairpin pre. (Neuroblastoma)		SRR042447(GSM539839)
mouse mature B cells (spleen) replicate 2 [09-002]. (b cell)		SRR077865(GSM637802)
18-30 nt small RNAs. (liver)		GSM519104(GSM519104)
mouse_granulocyte_nuclei_smallRNAs. (cell line)		Ago1IP812(Rui)
Quantitative functions of Argonaute proteins . (ago1 skin)		RuiDcrWT(Rui)
DGCR8-dependent microRNA biogenesis is essent. (skin)		SRR042468(GSM539860)
mouse Th1 cells [09-002]. (lymph)		GSM475281(GSM475281)
total RNA. (testes)		SRR038740(GSM527275)
small RNA-Seq. (dicer brain)		SRR345198(SRX097259)
source: size fractionated RNA from mouse hipp. (brain)		GSM314557(GSM314557)
ESC dgcr8 (Illumina). (ESC)		GSM314552(GSM314552)
ESC wild type (Illumina). (ESC)		SRR042469(GSM539861)
mouse Th2 cells [09-002]. (lymph)		RuiDGCR8KO(Rui)
DGCR8-dependent microRNA biogenesis is essent. (dgcr8 skin)		SRR029037(GSM433289)
18dpp_homo_tdrd6-KO. (tdrd6 testes)		SRR306541(GSM750584)
19-24nt. (ago2 brain)		GSM510450(GSM510450)
newborn_rep6. (total RNA)		Ago1IP517(Rui)
Quantitative functions of Argonaute proteins . (ago1 skin)		SRR042465(GSM539857)
mouse CD4+ T cells (spleen) [09-002]. (spleen)		SRR038743(GSM527278)
small RNA-Seq. (dicer brain)		SRR391849(GSM852144)
gender: femalegenotype/variation: ADAR2-/-tis. (embryo)		SRR402762(SRX117945)
source: ES E14 male cells. (ESC)		GSM475280(GSM475280)
Mili-IP. (mili testes)		SRR023850(GSM307159)
ZHBT-c40hsmallrna_rep1. (cell line)		SRR116846(GSM678422)
Small RNA deep sequencing from mouse epididym. (epididymis)		SRR042456(GSM539848)
mouse hematopoetic progenitor cells [09-002]. (bone marrow)		SRR391852(GSM852147)
gender: femalegenotype/variation: ADAR2-/-tis. (embryo)		SRR065058(SRR065058)
Tissue-specific Regulation of Mouse MicroRNA . (pancreas)		SRR306542(GSM750585)
19-24nt. (ago2 brain)		SRR390299(GSM849857)
cell line: NIH-3T3cell type: fibroblastip ant. (ago2 fibroblast)		Ago3IP812(Rui)
Quantitative functions of Argonaute proteins . (ago3 skin)		SRR059769(GSM562831)
Treg_Drosha. (spleen)		SRR059771(GSM562833)
CD4_control. (spleen)		SRR525244(SRA056111/SRX170320)
Mus musculus domesticus miRNA sequencing. (ago2 Blood)		SRR345197(SRX097258)
source: size fractionated RNA from mouse hipp. (brain)		GSM510444(GSM510444)
brain_rep5. (brain)		SRR306530(GSM750573)
19-24nt. (ago2 brain)		SRR042471(GSM539863)
mouse TFHS cells [09-002]. (spleen)		SRR037912(GSM510449)
newborn_rep5. (total RNA)		SRR042483(GSM539875)
mouse muscle tissue [09-002]. (muscle)		SRR346420(SRX098261)
Global profiling of miRNA and the hairpin pre. (Uterus)		SRR306536(GSM750579)
19-24nt. (ago2 brain)		SRR346418(SRX098259)
Global profiling of miRNA and the hairpin pre. (Liver)		SRR042446(GSM539838)
mouse mature B cells (spleen) replicate 1 [09-002]. (b cell)		GSM640581(GSM640581)
small RNA in the liver with paternal control. (liver)		SRR553582(SRX182788)
source: Brain. (Brain)		mjLiverKO3()
Liver Data. (Zcchc11 liver)		SRR077864(GSM637801)
18-30 nt small RNAs. (liver)		SRR391845(GSM852140)
gender: femalegenotype/variation: wild typeti. (embryo)		SRR345199(SRX097260)
source: size fractionated RNA from mouse hipp. (brain)		SRR060845(GSM561991)
total RNA. (brain)		SRR042459(GSM539851)
mouse neutrophil cells replicate 1 [09-002]. (blood)		SRR037905(GSM510441)
brain_rep2. (brain)		SRR042455(GSM539847)
mouse plasma cells [09-002]. (blood)		SRR345196(SRX097257)
source: size fractionated RNA from mouse hipp. (brain)		mjTestesKO7()
Testes Data. (Zcchc11 testes)		SRR042467(GSM539859)
mouse T cells activated in vitro with Concanavalin A [09-002]. (spleen)		SRR042444(GSM539836)
mouse pre B cells [09-002]. (b cell)		SRR042453(GSM539845)
mouse marginal zone B cells (spleen) [09-002]. (b cell)		SRR037934(GSM510472)
293cand4_rep3. (cell line)		mjTestesWT3()
Testes Data. (testes)		SRR248527(GSM733815)
cell type: spermatogonial stem cell enriched . (testes)		SRR345207(SRX097268)
source: size fractionated RNA from mouse hipp. (brain)		SRR306537(GSM750580)
19-24nt. (ago2 brain)		SRR525243(SRA056111/SRX170319)
Mus musculus domesticus miRNA sequencing. (ago2 Blood)		SRR029123(GSM416611)
NIH3T3. (cell line)		SRR029043(GSM433295)
18.5dpc_homo_tdrd1-KO. (tdrd1 testes)		SRR346413(SRX098254)
Global profiling of miRNA and the hairpin pre. (Heart)		SRR553604(SRX182810)
source: Spermatocytes. (Spermatocytes)		SRR037914(GSM510451)
newborn_rep7. (total RNA)		SRR306534(GSM750577)
19-24nt. (ago2 brain)		Ago2IP504(Rui)
Quantitative functions of Argonaute proteins . (ago2 skin)		SRR029036(GSM433288)
18dpp_hetero_tdrd6-KO. (tdrd6 testes)		SRR248525(GSM733813)
cell type: Thy1- spermatogonial stem cellstra. (testes)		SRR032476(GSM485234)
sRNA_delayed_deep_sequencing. (uterus)		SRR306529(GSM750572)
19-24nt. (ago2 brain)		GSM475279(GSM475279)
Miwi-IP. (miwi testes)		mjTestesKO5()
Testes Data. (Zcchc11 testes)		GSM416732(GSM416732)
MEF. (cell line)		SRR095855BC8(SRX039178)
sequencing of miRNA from wild type and diseas. (heart)		GSM317183(GSM317183)
Ago-1 IP small RNAs from mouse brain. (ago1 brain)		SRR042454(GSM539846)
mouse germinal center B cells (lymph node) [09-002]. (b cell)		SRR248524(GSM733812)
cell type: Thy1+ spermatogonial stem cellstra. (testes)		SRR095853(SRX039174)
"sequencing of miRNA from wild type and disea. (heart)		GSM510455(GSM510455)
newborn_rep11. (total RNA)		SRR037944(GSM510482)
293DcrTN_cand5. (cell line)		SRR279903(GSM689053)
cell type: mouse embryonic stem cellcell line. (ESC)		SRR042473(GSM539865)
mouse nTreg cells [09-002]. (lymph)		SRR029038(GSM433290)
25dpp_hetero_tdrd6-KO. (tdrd6 testes)		SRR034120(GSM466730)
Mili IP_Tdrd9-/- replicate1. (mili testes)		SRR069809(GSM610965)
small RNA sequencing; sample 1. (testes)		SRR037920(GSM510458)
e12p5_rep2. (embryo)		mjTestesKO8()
Testes Data. (Zcchc11 testes)		GSM640578(GSM640578)
small RNA in the liver with paternal control. (liver)		SRR402761(SRX117944)
source: ES E14 male cells. (ESC)		SRR525240(SRA056111/SRX170316)
Mus musculus domesticus miRNA sequencing. (ago1 Blood)		GSM510453(GSM510453)
newborn_rep9. (total RNA)		SRR037897(GSM510433)
ovary_rep2. (ovary)		SRR206942(GSM723283)
other. (brain)		SRR306532(GSM750575)
19-24nt. (ago2 brain)		SRR391850(GSM852145)
gender: femalegenotype/variation: ADAR2-/-/AD. (embryo)		SRR073955(GSM629281)
total RNA. (blood)		SRR553585(SRX182791)
source: Kidney. (Kidney)		SRR345201(SRX097262)
source: size fractionated RNA from mouse hipp. (brain)		Ago2IP517(Rui)
Quantitative functions of Argonaute proteins . (ago2 skin)		SRR077866(GSM637803)
18-30 nt small RNAs. (liver)		SRR306538(GSM750581)
19-24nt. (ago2 brain)		SRR042450(GSM539842)
mouse B cells activated in vitro with LPS/IL4 replicate 3 [09-002]. (b cell)		SRR345205(SRX097266)
source: size fractionated RNA from mouse hipp. (brain)
........................................................................................................................................................................CCTCTGCTTCTTCTCAAGCT............................................... 203.000.00--------3.00-------------------------------------------------------------------------------------------------------------------------------------
............................................................................................................................................................GACTCATCACAGCCTGCA............................................................. 182.000.00--------2.00-------------------------------------------------------------------------------------------------------------------------------------
............................................................................................................................................................GACTCATCACAGCCTG............................................................... 162.000.00--------1.00--------------------------------------------------------------------------------------1.00----------------------------------------------
.........................................................................................................................................................................CTCTGCTTCTTCTCATGGG............................................... 191.000.00--------1.00-------------------------------------------------------------------------------------------------------------------------------------
.........................................................................................................................................................................CTCTGCTTCTTCTCATAGC............................................... 191.000.00------------------------------------------1.00---------------------------------------------------------------------------------------------------
.........................................................................................................................................................................CTCTGCTTCTTCTCATGGC............................................... 191.000.00--------1.00-------------------------------------------------------------------------------------------------------------------------------------
...........................................................................................................................................................AGACTCATCACAGCCT................................................................ 1630.670.67------------------------------------------0.33---------------------------------------0.33-----------------------------------------------------------
...........................................................................................................................................................AGACTCATCACAGCCTCGA............................................................. 190.330.00------------------------------------------0.33---------------------------------------------------------------------------------------------------